ID: 1132759068

View in Genome Browser
Species Human (GRCh38)
Location 16:1500220-1500242
Sequence GGCTCACCTTTTGGGCGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132759057_1132759068 8 Left 1132759057 16:1500189-1500211 CCTGCGAGGCCCTGGGAGAAGAG 0: 1
1: 3
2: 13
3: 33
4: 285
Right 1132759068 16:1500220-1500242 GGCTCACCTTTTGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1132759059_1132759068 -1 Left 1132759059 16:1500198-1500220 CCCTGGGAGAAGAGCCGTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1132759068 16:1500220-1500242 GGCTCACCTTTTGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1132759061_1132759068 -2 Left 1132759061 16:1500199-1500221 CCTGGGAGAAGAGCCGTGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1132759068 16:1500220-1500242 GGCTCACCTTTTGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1132759056_1132759068 9 Left 1132759056 16:1500188-1500210 CCCTGCGAGGCCCTGGGAGAAGA 0: 1
1: 3
2: 1
3: 31
4: 265
Right 1132759068 16:1500220-1500242 GGCTCACCTTTTGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1132759055_1132759068 13 Left 1132759055 16:1500184-1500206 CCGTCCCTGCGAGGCCCTGGGAG 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1132759068 16:1500220-1500242 GGCTCACCTTTTGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1132759051_1132759068 22 Left 1132759051 16:1500175-1500197 CCTGGCTCTCCGTCCCTGCGAGG 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1132759068 16:1500220-1500242 GGCTCACCTTTTGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1132759050_1132759068 25 Left 1132759050 16:1500172-1500194 CCTCCTGGCTCTCCGTCCCTGCG 0: 1
1: 0
2: 2
3: 18
4: 304
Right 1132759068 16:1500220-1500242 GGCTCACCTTTTGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132759068 Original CRISPR GGCTCACCTTTTGGGCGGCA GGG Intronic
900454678 1:2768367-2768389 TGCTCACCTTGTGGTGGGCATGG - Intronic
900456195 1:2775992-2776014 TGCTCACCTTGTGGTGGGCATGG - Intronic
902840990 1:19073792-19073814 GGCTCACCTCGTGGGAGGGAGGG - Intergenic
903534191 1:24055899-24055921 GGCTCACCTTCCAGGCTGCATGG - Intergenic
906189127 1:43884635-43884657 GTCTCACCTTGTGGGAGCCAAGG + Intronic
911948680 1:104143860-104143882 GCCTCACCTTCTGAGTGGCAGGG + Intergenic
916515680 1:165514241-165514263 GGGCCACCTTTTGAGTGGCAAGG - Intergenic
919826607 1:201507522-201507544 GGGACACATTTTGGGCGCCAGGG + Intronic
920311122 1:205048861-205048883 GCCTCACCTTTAGGGAGGCAAGG + Intronic
920374159 1:205498085-205498107 GCCTAACCTTTTTGGCGCCAGGG + Intergenic
920955868 1:210619601-210619623 TGCTGACCTTTTGGGCAGGACGG + Intronic
922504908 1:226120840-226120862 GGCTCACCTGATGGGCGCCTAGG - Intergenic
1062934651 10:1376846-1376868 GGCTCAGCTTTGGTGGGGCAGGG + Intronic
1071932166 10:90484718-90484740 GACTAGCCTTTTGGGCTGCATGG - Intergenic
1077122342 11:915461-915483 GGCTCACATTTAGGGAGGCTGGG + Intergenic
1082802832 11:57427029-57427051 GGGTCCCCTTTCGGGCGCCATGG - Intronic
1083296611 11:61718654-61718676 AGCTCAGCTTCTGGGAGGCAGGG - Intronic
1083596926 11:63922159-63922181 GGCTCACAGTTTGGGAGGCTGGG - Intergenic
1083686711 11:64380793-64380815 GGCTCAGCTTTGGGGAGGAAGGG - Intergenic
1085830438 11:79895215-79895237 GGCTTACATTTTGGGAGCCAGGG - Intergenic
1089291391 11:117439626-117439648 GGCTCCCCTCTTGGGAGCCAAGG - Intronic
1090117044 11:123984598-123984620 GTCTTACCTGTTGGGTGGCACGG + Intergenic
1091479114 12:808371-808393 GGCTCACACTTTGGGAGGCTAGG - Intronic
1095410199 12:41913037-41913059 GGTTAACCTTTTGGGGTGCAAGG - Intergenic
1096325799 12:50660257-50660279 GGATCGCCTTTTGGTTGGCATGG - Exonic
1101757650 12:107633678-107633700 GGAGCACGTTTTGGGTGGCAGGG + Intronic
1114670348 14:24407785-24407807 GGCTGGCCTTTTGGGTGGCGAGG + Intronic
1115881555 14:37925053-37925075 GACTTACCTTTTGGGAGTCAGGG - Intronic
1118055962 14:62080172-62080194 GGCTCACACTTTGAGCAGCAAGG - Intronic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1122135972 14:99633236-99633258 GGGTGACCTTCTGGGCTGCAGGG - Intergenic
1124239800 15:28019796-28019818 GAATCACCTTGTGGGGGGCAGGG + Intronic
1125714401 15:41811095-41811117 GTCTCACCTTTTGAGAGGCTGGG + Intronic
1127931054 15:63597790-63597812 GGCTTCCCTCTTGGGGGGCAGGG + Intronic
1132759068 16:1500220-1500242 GGCTCACCTTTTGGGCGGCAGGG + Intronic
1138131911 16:54487097-54487119 GGCTCACCTTTTTAGCTGCAAGG - Intergenic
1146373452 17:32279636-32279658 GGCTGCCCTTGTGGGCTGCATGG + Intronic
1146967691 17:37046838-37046860 GTCTCACCTTCTGTGCGGCTGGG + Intronic
1148908728 17:50928289-50928311 GGCTCCCCTTTTGGGTGACCAGG - Intergenic
1153072007 18:1116640-1116662 GACTGGCCTTTTGGGCTGCATGG - Intergenic
1153182314 18:2448350-2448372 GGCTCACATTATGTGCTGCAGGG - Intergenic
1156470907 18:37376733-37376755 GGCTCACCTTTCAGGGTGCAAGG + Intronic
1157240800 18:46007879-46007901 GTCTCACCTCTTGGGCCCCAGGG - Intronic
1164516109 19:28936990-28937012 TTCTCACCATTTGGGAGGCAGGG - Intergenic
927587237 2:24318851-24318873 CGCTCACCTTCTGTGCGGCCAGG - Intronic
935487628 2:103677292-103677314 GGTTAACCTTTTGGGCAGGAAGG - Intergenic
937737482 2:125310081-125310103 GGCTCACATTTAGGGTGGCAAGG + Intergenic
945042159 2:205751663-205751685 GGCTCACCTCATGGGGGGCAGGG - Intronic
948816590 2:240513446-240513468 GGCTCTCCCTTAGGACGGCAGGG - Intronic
1169293299 20:4371193-4371215 TGTTCACCTTTAGGGCCGCATGG + Intergenic
1172859978 20:38041513-38041535 GGCTCACCTTTTGATCAACATGG + Intronic
1174872155 20:54192849-54192871 TGCCCACCTTTTGTGCTGCAAGG - Intergenic
1175288618 20:57856821-57856843 GGCTCACCTTTTCTGCACCAAGG - Intergenic
1175974895 20:62705843-62705865 GGCACGCCTTGTGGGGGGCAGGG - Intergenic
1176041476 20:63068208-63068230 GGCTGACGTTTTGGGGAGCAGGG + Intergenic
1179968031 21:44818094-44818116 GGCGCACCCGTTGGCCGGCACGG + Exonic
1182647742 22:31824097-31824119 TGCTCACCCTTTGGGAGGCCAGG + Intronic
1183619591 22:38964789-38964811 GGTTCCCCATGTGGGCGGCAGGG - Intronic
963361009 3:144271817-144271839 TGTTCACCTTTTGGGGAGCAGGG + Intergenic
964894780 3:161582530-161582552 GGCTCACATTTTGGGAGGGTGGG + Intergenic
968703200 4:2066391-2066413 TGCTCACCTCAGGGGCGGCAGGG - Exonic
969208907 4:5671362-5671384 AGCTCACCTTTTGGGGGTGAGGG + Intronic
969710140 4:8838455-8838477 TGCCCAGCTTTTCGGCGGCAGGG - Intergenic
986989218 5:13532102-13532124 GGATCACATTTTGAGTGGCAAGG + Intergenic
994370785 5:98964703-98964725 TCCTCCCCTTTTGGGAGGCAAGG - Intergenic
997362437 5:133303632-133303654 GGCCCAGCTTGTGGGCTGCACGG - Intronic
997916380 5:137930213-137930235 TGCTCACCTATTGGGCCACAAGG + Intronic
998445022 5:142191810-142191832 GCCTCACCTTGAGGGTGGCAGGG + Intergenic
1002485131 5:179530142-179530164 GGCTCACCTGGTGGGAGGAAAGG + Intergenic
1002870922 6:1166683-1166705 GGCTCTCCTTTTCGAGGGCAGGG - Intergenic
1018431665 6:163727484-163727506 GGCTCACACTTTGGGAGGCTGGG - Intergenic
1022402723 7:30055897-30055919 GGCTCACATTTTGGGAGGGAAGG - Intronic
1035376740 7:158411486-158411508 GGCTCACCTCCTGGGAGCCAAGG + Intronic
1039212832 8:35235849-35235871 GGCTGTGCTTCTGGGCGGCAGGG + Exonic
1039454811 8:37699393-37699415 GGCCCTACTTTTGGGGGGCAGGG - Exonic
1044957626 8:97498116-97498138 GAGTCACCTTTTGGGCCCCATGG + Intergenic
1047901901 8:129431919-129431941 GACTGGCCTTTTGGGCTGCATGG - Intergenic
1049644533 8:143730129-143730151 GGCGCACCTGCTGGGCGGAACGG + Exonic
1049879380 8:145052000-145052022 GGCTCACCTTTTGGTGGGGAGGG - Intergenic
1049978619 9:883490-883512 GGCTCTCCTTTTGGGGGTCGGGG - Intronic
1050581702 9:7064410-7064432 GGCTCACCATGTTGGCAGCAAGG + Intronic
1052628223 9:31004437-31004459 AGGTTACCTTTTGGGGGGCAGGG + Intergenic
1055073074 9:72187473-72187495 GGCTCACCGTTTTGGAGGCTAGG - Intronic
1055745490 9:79439502-79439524 GGCTCCACTTCTGGGGGGCAGGG + Intergenic
1056026076 9:82496419-82496441 GACTCGCCTTTTGGGCTGCATGG - Intergenic
1056803754 9:89712509-89712531 TGCTCACCTTCTGTGAGGCATGG - Intergenic
1057819196 9:98318273-98318295 GGGCCACCCTTTGGGCAGCAAGG + Intronic
1061636333 9:131911953-131911975 GGCTCAGCTGTGGGGCAGCAGGG - Intronic
1200069485 X:153520882-153520904 GGCTCAGCTTCTGAGCTGCAAGG - Intronic