ID: 1132760642

View in Genome Browser
Species Human (GRCh38)
Location 16:1507115-1507137
Sequence CCTCACCTGCGCCCAGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132760635_1132760642 11 Left 1132760635 16:1507081-1507103 CCTGTGCTAACCATGGATCAGGA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1132760642 16:1507115-1507137 CCTCACCTGCGCCCAGGGATGGG 0: 1
1: 0
2: 1
3: 31
4: 204
1132760631_1132760642 22 Left 1132760631 16:1507070-1507092 CCGGGCGCCGGCCTGTGCTAACC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1132760642 16:1507115-1507137 CCTCACCTGCGCCCAGGGATGGG 0: 1
1: 0
2: 1
3: 31
4: 204
1132760633_1132760642 15 Left 1132760633 16:1507077-1507099 CCGGCCTGTGCTAACCATGGATC 0: 1
1: 0
2: 0
3: 13
4: 310
Right 1132760642 16:1507115-1507137 CCTCACCTGCGCCCAGGGATGGG 0: 1
1: 0
2: 1
3: 31
4: 204
1132760636_1132760642 1 Left 1132760636 16:1507091-1507113 CCATGGATCAGGAGCGCTCCTCA 0: 1
1: 0
2: 3
3: 15
4: 118
Right 1132760642 16:1507115-1507137 CCTCACCTGCGCCCAGGGATGGG 0: 1
1: 0
2: 1
3: 31
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132760642 Original CRISPR CCTCACCTGCGCCCAGGGAT GGG Intronic
900269708 1:1780855-1780877 CCTGACCAGGCCCCAGGGATGGG + Intergenic
900362866 1:2298399-2298421 CCACACCTGCTCCAAGGGAGAGG - Intronic
900533315 1:3165291-3165313 ACTCACCTGGGCTCAGGGACAGG + Intronic
900533359 1:3165483-3165505 ACTCACCTGGGCTCAGGGACAGG + Intronic
900533371 1:3165531-3165553 ACTCACCTGGGCTCAGGGACAGG + Intronic
900533385 1:3165579-3165601 ACTCACCTGGGCCCAGGGACAGG + Intronic
900533394 1:3165603-3165625 ACTCACCTGGGCTCAGGGACAGG + Intronic
900533401 1:3165627-3165649 ACTCACCTGGGCTCAGGGACAGG + Intronic
900533413 1:3165675-3165697 ACTCACCTGGGCCCAGGGACAGG + Intronic
900533432 1:3165747-3165769 ACTCACCTGGGCCCAGGGACAGG + Intronic
900533454 1:3165819-3165841 ACTCACCTGGGCTCAGGGACAGG + Intronic
900533474 1:3165891-3165913 ACTCACCTGGGCTCAGGGACAGG + Intronic
900533481 1:3165915-3165937 ACTCACCTGGGCTCAGGGACAGG + Intronic
900656853 1:3762833-3762855 CCTCACCTGCTCCCCTGGAGTGG - Intronic
900800499 1:4734225-4734247 CCTCAGCTGAGCCCCGGAATAGG + Intronic
902361294 1:15943890-15943912 CCCTACCTGTGCCCAGGGAGGGG + Exonic
903225043 1:21889975-21889997 GCTCACCTGTGCCCAGGCGTCGG + Exonic
903365631 1:22804030-22804052 CAACTCCTGCTCCCAGGGATTGG - Intronic
904401036 1:30256915-30256937 CCTCCCCTGTGCCCAGGGCTTGG + Intergenic
904584444 1:31572143-31572165 CCTCCCCTGGGCCCTGGGAATGG + Intergenic
905463119 1:38134137-38134159 GCTCCCCTGCCCCCATGGATGGG + Intergenic
907398912 1:54212407-54212429 CCTCGCCTTAGCCCAGGGACAGG - Intronic
908410423 1:63859118-63859140 CCTCACTTGCTCCCTGGGTTGGG + Intronic
909486640 1:76181054-76181076 CCACAGCAGCGTCCAGGGATGGG - Intronic
910997114 1:93117803-93117825 GATCACCTGGGCCCAGGAATTGG + Intronic
912435242 1:109656904-109656926 CCTCACCGGGGCTCAGGGAAGGG - Intronic
912436952 1:109668617-109668639 CCTCACCAGGGCTCAGGGAAGGG - Intronic
915308867 1:154997271-154997293 TCTCACCTGGTCCCAGTGATGGG + Intergenic
915584611 1:156837606-156837628 CACCACCTGCTCCCAGGGTTAGG - Intronic
920263966 1:204708159-204708181 CCCCACCTGCTCACAGGGATGGG + Intergenic
920309433 1:205040111-205040133 CCCCACTTGTCCCCAGGGATGGG + Intergenic
921358096 1:214305397-214305419 CCTCACAGGCGGCCAGTGATAGG + Intronic
922350627 1:224732243-224732265 CCTCACCTGCACCCAATTATGGG - Intronic
924508500 1:244709257-244709279 CCACACCTGCTCACAGGGAGGGG + Intergenic
1063297142 10:4818002-4818024 CCTCTCCTGGACCCAAGGATGGG - Intronic
1069249197 10:66246304-66246326 CCACAACTGCGCCCAGGGTTGGG + Intronic
1076426941 10:130373653-130373675 CCTCGCCTCCCCACAGGGATGGG - Intergenic
1077014634 11:394134-394156 CCCCAGCTGCGCTCAGGGCTGGG + Intronic
1077145393 11:1042113-1042135 CCTCATCTGAGCACAGGGAGAGG + Intergenic
1079094257 11:17500880-17500902 CATCCCATGCCCCCAGGGATTGG + Intronic
1079126171 11:17719992-17720014 CCTCACGTGCGCCCGGGGCCGGG - Exonic
1081754205 11:45532986-45533008 CCTCACCTCTTCCCAGGGGTGGG + Intergenic
1083886722 11:65576668-65576690 CCTCAGCTGCGGTCAGGGCTGGG + Intronic
1084153856 11:67303380-67303402 CCTGACCTGTGCCCAGGGGCTGG + Intergenic
1084428943 11:69100848-69100870 CCTGCCCTGGGCCCAGGGTTGGG + Intergenic
1084980662 11:72826892-72826914 CCTCACCTGCTCTCTGGGAGTGG + Intronic
1085054048 11:73393936-73393958 CCTCTCCTGGGCACTGGGATGGG - Intronic
1090874662 11:130778133-130778155 CCTCATCAGAGCCCAGGGGTCGG + Intergenic
1091770678 12:3149188-3149210 CCTCACCTGCCTCCAGGGTAGGG + Intronic
1092275332 12:7056513-7056535 CCACAGCTCTGCCCAGGGATTGG + Intronic
1098003709 12:65972304-65972326 CCTCCCCTGCCACCAGGGATTGG - Intergenic
1100517571 12:95343005-95343027 CATGAGCTGGGCCCAGGGATAGG + Intergenic
1101804030 12:108047944-108047966 CCTGACTTGAGCCTAGGGATTGG + Intergenic
1103249399 12:119486795-119486817 CCACACTTGAGCCCAGGGATTGG + Intronic
1104686532 12:130788550-130788572 CCTCAGCTGCGCCGAGGGCCTGG + Intergenic
1104692470 12:130837646-130837668 CATCACTTGAGCCCAGGTATTGG - Intronic
1106781939 13:33067767-33067789 CATCACCTGTGCCCAGAGACTGG + Intergenic
1112424757 13:99287704-99287726 GCTCACTTGAGCCCAGGAATTGG - Intronic
1113152812 13:107283515-107283537 CCTCACCTGCTCCCTGGCTTGGG + Intronic
1113552849 13:111206440-111206462 CTGCCCCTGCTCCCAGGGATGGG - Intronic
1113603706 13:111589697-111589719 CCTGCCCTGCGCTCAGGGACAGG - Intronic
1113875977 13:113594629-113594651 CCTCAGCTGTGCCCAGGCTTGGG + Intronic
1116169392 14:41380534-41380556 CCTCACTTGTTACCAGGGATAGG + Intergenic
1119217393 14:72879602-72879624 CATCAAGTGCGCCCAGGGACAGG + Intronic
1121812616 14:96904677-96904699 CCTCACCTCTGCCCAGGGGAAGG - Intronic
1122722933 14:103732222-103732244 GCCCACCTGCACCCAGGGCTGGG - Intronic
1124019755 15:25909562-25909584 CCTAACCAGCGCGCAGGGAAAGG - Intergenic
1124250078 15:28101319-28101341 CCTCAGCTGCCGCCAGGGCTGGG - Intergenic
1124701713 15:31919436-31919458 GCTCATTTGAGCCCAGGGATTGG - Intergenic
1128299535 15:66557176-66557198 TCTCACCTGAGCCCAGGGAAGGG - Intronic
1128739801 15:70075842-70075864 CATCACCTGAGTCCAGAGATTGG - Intronic
1128977143 15:72162267-72162289 CCTCACCTGTGCCCAGGGACTGG + Exonic
1129198577 15:73985312-73985334 CCTCACCTGGCCCCGGGGACGGG + Exonic
1129775368 15:78233162-78233184 CCTGACCTATGCCCAGGGAGGGG + Intronic
1130996899 15:88909038-88909060 CCACATGTGGGCCCAGGGATGGG - Intronic
1132741071 16:1413802-1413824 CCCCACCTCCGCCCAGGCAGCGG + Intronic
1132760642 16:1507115-1507137 CCTCACCTGCGCCCAGGGATGGG + Intronic
1132872707 16:2122877-2122899 TCGCACCTGCCCCCAGGCATGGG + Intronic
1133023595 16:2977745-2977767 CCACACCTGCCCCCAGTGCTAGG - Intronic
1137061210 16:35793067-35793089 TCTCACCTGTGCCCAGAGACTGG + Intergenic
1138442236 16:57042025-57042047 GCTCAGCTGCTCCCAGGGCTGGG + Exonic
1138527649 16:57618273-57618295 CATCCCCTGAGACCAGGGATTGG - Intronic
1138551597 16:57751736-57751758 CCTGACCTGGGCCCAGGGGCTGG + Intronic
1139420872 16:66848873-66848895 CCGCTCCTGCTTCCAGGGATGGG + Intronic
1139430335 16:66907709-66907731 AGTCACCTACACCCAGGGATGGG - Intergenic
1141719863 16:85750312-85750334 CCGCAGCTCCCCCCAGGGATAGG - Intronic
1141886314 16:86894820-86894842 CCTCACATGTGCCCAGGGTTAGG - Intergenic
1142066417 16:88065506-88065528 CCTAAACAGGGCCCAGGGATTGG + Intronic
1142801337 17:2347921-2347943 CCTCCCCACCCCCCAGGGATTGG + Intronic
1143898983 17:10158971-10158993 CATCACCTGAGCCCAGGAAGTGG + Intronic
1145875329 17:28314918-28314940 CCTCTCCTGGGCCCTGGGTTTGG + Intergenic
1146523064 17:33541535-33541557 ACTCACCTGAGCCCAGGAATAGG + Intronic
1151426866 17:74036461-74036483 CTTCACCTGGGCCCTGGGCTTGG + Intergenic
1151717951 17:75840926-75840948 CCTGGCCTGCCCCTAGGGATGGG - Intronic
1151815886 17:76471203-76471225 CCTCAGTTGCCCCCAGGGCTGGG - Exonic
1152445082 17:80337737-80337759 CCGCAGCTGCGCCGAGGGCTGGG - Intronic
1152635202 17:81428063-81428085 CCTCCCCTGCACCCAGGAAGAGG - Intronic
1155143253 18:23062482-23062504 CCTCACCTGACCCCTGTGATGGG + Intergenic
1157514240 18:48299554-48299576 CCTCACCTGGGCCAAGGCATGGG + Intronic
1157781951 18:50447321-50447343 CCACCCCTGAGCCCAGGTATCGG + Intergenic
1159174627 18:64816488-64816510 TTTCGCCTACGCCCAGGGATGGG + Intergenic
1160187014 18:76683874-76683896 CCTCACGTGCAGCCCGGGATGGG - Intergenic
1160917963 19:1506733-1506755 CCTCACCTGGGGCCAGCGTTGGG + Exonic
1160972618 19:1776173-1776195 CGTCCCCTGCGGCCTGGGATGGG - Exonic
1161117410 19:2505825-2505847 GATCACCTGAGCCCAGGAATTGG + Intergenic
1161150266 19:2703896-2703918 CCCCACCTGAGCCCTGGGATTGG + Intergenic
1161237632 19:3205709-3205731 CCTTACCTGCGCACAGGGACGGG + Intronic
1162450287 19:10750142-10750164 CCTGGCCTGGGCCCATGGATAGG + Intronic
1162855311 19:13463539-13463561 TTTCACTTGCACCCAGGGATGGG + Intronic
1163226405 19:15964449-15964471 CCTCACCTGCTCCCATGGCCTGG + Intergenic
1164934930 19:32202744-32202766 GATCACCTGAGCCCAGGAATTGG - Intergenic
1165434524 19:35788720-35788742 CCTGACCTGTGCACGGGGATGGG + Exonic
1166209138 19:41294541-41294563 CATCACCTGCGGGCAGGAATTGG - Exonic
1166749135 19:45156421-45156443 TCCCACCTGAGCCCAGGGTTGGG + Intronic
925979685 2:9166780-9166802 CATCAGCTGAGCCCAGGGCTGGG + Intergenic
928217336 2:29372588-29372610 CCTCACATGGACCCAGGGATAGG + Intronic
928408326 2:31032320-31032342 CCTCGCCTAAGCCCAGGGTTGGG + Intronic
931139863 2:59445556-59445578 CCAGTCCTGAGCCCAGGGATTGG + Intergenic
931434996 2:62238353-62238375 CCCCACCCCCGCCCAGGGTTGGG + Intergenic
933707002 2:85298817-85298839 CCTCAGCTGCCCCCAGGGGCAGG - Intronic
933969248 2:87456948-87456970 CGTCACCCTCGCCGAGGGATTGG + Intergenic
934529273 2:95075075-95075097 CGTCACCTGCTCCCAGGGTTGGG - Intergenic
935004797 2:99062646-99062668 GATCACCTGTGCCCAGGAATTGG + Intronic
936324538 2:111493546-111493568 CGTCACCCTCGCCGAGGGATTGG - Intergenic
937318420 2:120946747-120946769 CCTCAGCTGGGGCCTGGGATGGG + Intronic
946268307 2:218568172-218568194 CCTTACCTGCGCCGAGGGTCCGG + Exonic
946528720 2:220548485-220548507 CCTCACCTGCCTCCAGGCCTTGG - Intergenic
946706670 2:222465083-222465105 CCTCTGCTGCGTCCAAGGATAGG - Intronic
948591568 2:239053956-239053978 GCTCACCTGCTCCCAGAGATAGG - Intronic
948752770 2:240142037-240142059 CCTCACCTGCCCCCTGAGCTGGG + Intronic
1169107476 20:3009291-3009313 CTTCATCTGCACCCTGGGATTGG + Intronic
1172187938 20:33042961-33042983 CCCCATCTGGGCCCAGTGATAGG - Intronic
1173376184 20:42485376-42485398 CCTCACCAGGGCCCAGTGCTAGG - Intronic
1174060806 20:47831591-47831613 CCACACCTGCTCCCAGGCAAAGG + Intergenic
1174071092 20:47899779-47899801 CCACACCTGCTCCCAGGCAAAGG - Intergenic
1174152960 20:48498883-48498905 CCACACCTGCTCCCAGGCAAAGG + Intergenic
1174378511 20:50141731-50141753 TGTCCCCTGCCCCCAGGGATGGG - Intronic
1174386216 20:50190043-50190065 CCCGACCTGGGCCCTGGGATGGG - Intergenic
1174395557 20:50244686-50244708 TCCCACCTGGGCCCAGGGACAGG + Intergenic
1175582441 20:60111049-60111071 CCTCAGCTGCCCCCAGGGTTGGG + Intergenic
1175739014 20:61407394-61407416 CCACACCTGTCCCCAGGGTTCGG - Intronic
1178584072 21:33858346-33858368 TCTCACCTGCGCACTGGGAGGGG - Intronic
1179937482 21:44614471-44614493 CCTCGCCTGGGCCCTGGGATTGG - Intronic
1181478084 22:23180798-23180820 CCTCACCTGCCACCAGGGAGTGG + Exonic
1181802325 22:25355761-25355783 CCTGACCTGCTCCCATGGGTAGG + Intronic
1183432656 22:37774990-37775012 CCTCACCCCTGCCCAGGGCTGGG - Exonic
1183779827 22:39992161-39992183 CCTCAGCTGGGCGCAGTGATGGG - Intergenic
1184249493 22:43252126-43252148 CTTCACCTGTGCTCAGGGACTGG + Intronic
1184384670 22:44167319-44167341 TAGCACCTGCGCCCAGGGATAGG - Intronic
1184860149 22:47168982-47169004 CCTCACCTGCCCTCCGGCATTGG + Intronic
1185079683 22:48702749-48702771 CCTCACCCGAGCCCGGGGAAAGG + Intronic
1185219565 22:49622638-49622660 CCTCTCCTGCCCCCGGGGCTTGG - Intronic
1185238748 22:49729334-49729356 CCACACCTGCTCCCGGGGCTGGG - Intergenic
1185349312 22:50326425-50326447 CCTCGCCTATGCCCAGAGATGGG + Intronic
950216183 3:11161423-11161445 CCTCACCTGGGCCGAGGGCAAGG - Intronic
950578853 3:13850127-13850149 CCACACCTGTGCCCAGGGGCGGG + Intronic
950869039 3:16213024-16213046 CCTCACCTGGGGCCAGGGGAGGG + Intronic
951217551 3:20039941-20039963 CCTCACCCACACCCAGGGATTGG + Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
964830860 3:160882929-160882951 CCTCAGCTGGGTTCAGGGATGGG + Intronic
966911486 3:184562473-184562495 CCGCTCCGGGGCCCAGGGATGGG + Intronic
969046348 4:4339344-4339366 CCTCACCTCCACCCAGGGGACGG + Intergenic
969376965 4:6769301-6769323 CCGCAGCTGCACCCAGGTATGGG - Intergenic
969536681 4:7760588-7760610 CCTGACCTGGGCACAGGCATGGG - Exonic
970066257 4:12097217-12097239 CCTCACCTTCCCACAGGGACTGG + Intergenic
974272137 4:59664159-59664181 CCTTACCTGTGGCCATGGATGGG + Intergenic
976376805 4:84354802-84354824 CCTAACCTCAGCCCAGGGAATGG + Intergenic
976658133 4:87510901-87510923 CCTCACCAGCGTCCAGGTGTGGG - Intronic
982421808 4:155208080-155208102 CCGCACCCTCGCCCAGGGCTGGG - Intergenic
985665953 5:1181627-1181649 GCTCACCTGGGCCCAGGGTGAGG - Intergenic
985979735 5:3452444-3452466 CATCACCTGTGCCCAGGAAGTGG + Intergenic
986995297 5:13601005-13601027 ACTCAGCTGCTCCCAGGAATTGG + Intergenic
990033645 5:51292474-51292496 CCTCTCCTGACCCCAGAGATAGG + Intergenic
990149483 5:52800326-52800348 CCTCACCTCCGCCCCGGGAGAGG - Exonic
992554899 5:77893463-77893485 CCTGACCTGTGGCCAGGGATTGG - Intergenic
992615067 5:78539636-78539658 CCACACCATCACCCAGGGATGGG + Intronic
997423519 5:133787501-133787523 CCTGAACTGAACCCAGGGATGGG + Intergenic
998007225 5:138665132-138665154 CCTCAGCTGCCCCCAAGGATGGG - Intronic
998349690 5:141492519-141492541 TCCCACCTGCGCCCCGGGCTGGG + Intronic
999232543 5:150070137-150070159 CCTCACCTGGGCTCAGGGGCTGG - Intronic
999732169 5:154482951-154482973 CCCAGCCTGCTCCCAGGGATGGG + Intergenic
1001880727 5:175241845-175241867 CCACAGCTGTGACCAGGGATGGG + Intergenic
1002279145 5:178120683-178120705 CCTCACCTGCGTGAAGGGGTTGG - Exonic
1002837375 6:876352-876374 CCTGACCCTCTCCCAGGGATGGG + Intergenic
1003320664 6:5048399-5048421 GCTCACTTGAGCCCAGGAATTGG - Intergenic
1003559513 6:7169290-7169312 CCTCACCTACCCCCAGGGCAAGG - Intronic
1004629676 6:17409283-17409305 AATCACCTGCGCCCAGGAAGCGG + Intronic
1005331397 6:24753970-24753992 GATCACCTGTGCCCAGGAATTGG + Intergenic
1006583409 6:35089607-35089629 CCACACCGGGGGCCAGGGATGGG - Exonic
1006770247 6:36547184-36547206 ACTCACCAGAGCCCAGGGAGAGG + Exonic
1007398850 6:41592250-41592272 CCCCACCAGCGCCCAGGACTTGG + Intronic
1007781366 6:44256826-44256848 CCCCACCTGCCCCTAGGGAGGGG + Exonic
1011802754 6:91036418-91036440 CCCCACCTTCTCCCAAGGATGGG - Intergenic
1016563034 6:145418380-145418402 CCTCACCTGCACCCAGCAGTTGG - Intergenic
1016941847 6:149488855-149488877 CCCCACCTGGACCCATGGATGGG - Intergenic
1018736525 6:166690640-166690662 CCCCTCCTGCCCCCAGGGAGCGG - Intronic
1018971940 6:168536160-168536182 CCTCACCTCAACCCAGGGCTTGG - Intronic
1019143764 6:169963812-169963834 CCGCACCTGTGCCCAGAGACCGG - Intergenic
1019522953 7:1468801-1468823 CCTCCCCAGCCCCCAGGGGTGGG - Intergenic
1019864716 7:3696485-3696507 CCTCATCTGAGCCCAGGATTTGG + Intronic
1021237022 7:18154841-18154863 CCTCACCTGCGTGGAGGCATGGG - Intronic
1022146090 7:27542536-27542558 GATCACCTGAGCCCAGGGGTGGG - Intronic
1022521054 7:31007104-31007126 CCTCACCTGAGAACAGGGAAGGG - Intergenic
1022945454 7:35279519-35279541 TCTCACCTGCTCCCAGAGAATGG - Intergenic
1023345416 7:39266465-39266487 CCTCAACCCAGCCCAGGGATTGG + Intronic
1024579807 7:50792908-50792930 CCACACCTCCCCCCAGGGGTCGG + Intronic
1024905701 7:54376486-54376508 CCTACCCTGTGCCCAGGGCTTGG - Intergenic
1026526371 7:71156804-71156826 GATCACTTGAGCCCAGGGATTGG - Intronic
1026596793 7:71739652-71739674 CCTCACCTGCCCCCAGGGGCCGG + Intergenic
1027662127 7:80999535-80999557 CCTCATCTGTGCCCAGGGCTGGG - Intergenic
1028677142 7:93478465-93478487 CCTCTCCTGAGCCCAGGAGTTGG + Intronic
1029515543 7:101020930-101020952 CCTCACCTGCCCCCAGAGAAGGG + Intronic
1029712982 7:102309715-102309737 CCTGACCTGAGCCCAGGGCTGGG - Intronic
1032085327 7:128880661-128880683 CCTCTCCTGCCCCCATGGCTGGG - Exonic
1032193514 7:129777591-129777613 CCTGACCTGCGCCAAGCCATAGG - Intergenic
1034490796 7:151392210-151392232 GCTCCCCTGCGCCCAGGCCTGGG + Intronic
1035818090 8:2562216-2562238 CCTCACCTGCCTCCAGGGACCGG + Intergenic
1037230919 8:16657364-16657386 TCCCACCTGGGGCCAGGGATGGG + Intergenic
1037769162 8:21788983-21789005 CCTCTCCTCCGCCCCGGGCTCGG + Intronic
1038033199 8:23662631-23662653 CCTCACGGGCCCCCAAGGATTGG - Intergenic
1040598873 8:48865146-48865168 CCTCGCCTGTGCTCCGGGATGGG + Intergenic
1040839633 8:51771540-51771562 CCTTACTTGCCCCCAAGGATAGG - Intronic
1044287441 8:90425454-90425476 GCTCACTTGAGCCCAGGAATTGG - Intergenic
1044299089 8:90563002-90563024 CCTCACCTGATCCCACGAATTGG - Intergenic
1045565637 8:103311591-103311613 GCTCACTTGAGCCCAGGAATTGG + Intronic
1047547975 8:125838655-125838677 CCTCACATGCCCCCAGGGTAGGG + Intergenic
1049374328 8:142281810-142281832 CCTCACCTGGGGCAAGGGAGGGG - Intronic
1050878989 9:10675626-10675648 CCTCACATGCCCCCAGGAAAGGG - Intergenic
1053162069 9:35820063-35820085 CCTCACCTCCATCAAGGGATAGG - Intronic
1058413823 9:104764322-104764344 CCTCCCCTCCGGCCAGGGCTCGG - Intronic
1060416399 9:123433864-123433886 CTTCTCCTGTGCCCAAGGATGGG - Intronic
1062004825 9:134233880-134233902 CCTCCACTGTGCCCAGGAATTGG + Intergenic
1062009573 9:134259735-134259757 CTGCACCTGCGCCCCAGGATGGG - Intergenic
1062201061 9:135302920-135302942 CCTCAGCTGTCCCCAGGGAAAGG + Intergenic
1191108060 X:56784402-56784424 ACTCATCTGTGCCCAGGGGTGGG + Intergenic
1191110125 X:56797985-56798007 CCTCACATGGGCACAGGGGTTGG + Intergenic
1193317257 X:80077856-80077878 CCTCACATGCCCCCAGGAAAGGG - Intergenic