ID: 1132760738

View in Genome Browser
Species Human (GRCh38)
Location 16:1507447-1507469
Sequence GCTGCCTGTCAGCCACCTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132760738_1132760747 17 Left 1132760738 16:1507447-1507469 CCTCGAGGTGGCTGACAGGCAGC 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1132760747 16:1507487-1507509 AAATAGGAAGTGTGCCAGGCAGG 0: 1
1: 0
2: 4
3: 31
4: 239
1132760738_1132760744 13 Left 1132760738 16:1507447-1507469 CCTCGAGGTGGCTGACAGGCAGC 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1132760744 16:1507483-1507505 TCCCAAATAGGAAGTGTGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 145
1132760738_1132760742 1 Left 1132760738 16:1507447-1507469 CCTCGAGGTGGCTGACAGGCAGC 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1132760742 16:1507471-1507493 TGGCCTGGTACTTCCCAAATAGG 0: 1
1: 0
2: 0
3: 6
4: 93
1132760738_1132760749 29 Left 1132760738 16:1507447-1507469 CCTCGAGGTGGCTGACAGGCAGC 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1132760749 16:1507499-1507521 TGCCAGGCAGGGCCGCAGCGTGG 0: 1
1: 0
2: 4
3: 27
4: 394
1132760738_1132760750 30 Left 1132760738 16:1507447-1507469 CCTCGAGGTGGCTGACAGGCAGC 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1132760750 16:1507500-1507522 GCCAGGCAGGGCCGCAGCGTGGG 0: 1
1: 0
2: 4
3: 28
4: 278
1132760738_1132760748 18 Left 1132760738 16:1507447-1507469 CCTCGAGGTGGCTGACAGGCAGC 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1132760748 16:1507488-1507510 AATAGGAAGTGTGCCAGGCAGGG 0: 1
1: 0
2: 8
3: 75
4: 833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132760738 Original CRISPR GCTGCCTGTCAGCCACCTCG AGG (reversed) Intronic
900001083 1:15221-15243 GCCACCTCCCAGCCACCTCGGGG + Intergenic
900020798 1:185742-185764 GCCACCTCCCAGCCACCTCGGGG + Intergenic
900495710 1:2975105-2975127 GCTGCCAGTCGGCCACTGCGTGG - Intergenic
901521229 1:9786740-9786762 CCTGCCTGTCCGCCACCAGGCGG + Intronic
902721563 1:18307675-18307697 GCTGCCTGTCTGCCCGCACGTGG - Intronic
903934926 1:26889104-26889126 GCTGACTGCCGTCCACCTCGTGG - Exonic
909170712 1:72290594-72290616 GCAGCCTTTCAGTCACCTCTAGG + Intergenic
912622899 1:111182675-111182697 GCTGCCTATCAGGCACCATGAGG + Intronic
915495675 1:156281365-156281387 GCTGCCTGTCAGACAGAGCGTGG - Intronic
919539787 1:198831907-198831929 GATGCCTTTCAGCCAGCTCTTGG - Intergenic
919759089 1:201085728-201085750 GCTGTCTCTCAGCCACCTTGAGG - Intronic
919929280 1:202210617-202210639 GCTGCCAGCCAGTCAGCTCGTGG + Intronic
922641412 1:227235634-227235656 GCTACCTCTCAGCCTCCTTGAGG + Intronic
924118474 1:240771609-240771631 GCTTCCCGTCAGCCTCCTCCAGG - Intergenic
1062947548 10:1472864-1472886 GCTGCCTGACAGCCACCTGATGG - Intronic
1067481093 10:46598052-46598074 GCGGCCCCTCCGCCACCTCGCGG - Intergenic
1067613659 10:47743770-47743792 GCGGCCCCTCCGCCACCTCGCGG + Intergenic
1069826677 10:71258923-71258945 GTTGCCTGTCAGCTGCCTCCTGG - Intronic
1071497254 10:86177297-86177319 GCTGCTTCTGAGCCACCCCGTGG + Intronic
1071603332 10:86969540-86969562 GCCACCTGTCAGCCCCCCCGGGG + Intronic
1071629069 10:87203742-87203764 GCGGCCCCTCCGCCACCTCGCGG + Intergenic
1072533762 10:96343982-96344004 GCTGCCTGGAAGCCTCCTCATGG + Exonic
1074752818 10:116603232-116603254 GCAGCCTGGCAAGCACCTCGAGG - Intronic
1075064741 10:119281769-119281791 CCAGCTTCTCAGCCACCTCGGGG - Intronic
1075288075 10:121204438-121204460 GTTGCCTGTCTGACACCTCAGGG - Intergenic
1076188514 10:128466944-128466966 GGTGCCTGTCTTCCACCCCGCGG - Intergenic
1081605609 11:44525497-44525519 GGGGCCTGGCAGGCACCTCGAGG - Intergenic
1081801963 11:45866188-45866210 GCTGCCTCTCAGGCAGCTCAAGG - Intronic
1082106561 11:48227825-48227847 GCTGCCTGTCTGTCACCTTCTGG + Intergenic
1083675542 11:64322921-64322943 GCTGCCTCTCAGCCACCTACAGG + Intergenic
1084118968 11:67057794-67057816 GCTGCCTGTCAGCCTCCCCTGGG - Intronic
1085042319 11:73333812-73333834 GCTGACTGTCTGCCACCCTGGGG + Intronic
1085048846 11:73369107-73369129 GCCTCCTGTCAGCAACCTCAGGG + Intergenic
1091374172 12:15336-15358 GCCACCTCCCAGCCACCTCGGGG + Intergenic
1102012482 12:109627169-109627191 TCTGCCTGTCTGCCTCCTCCTGG - Intergenic
1104963337 12:132498363-132498385 CCTGCCTGTCAGACACCTTCTGG + Intronic
1105787116 13:23760187-23760209 GCTGCGATTCAGCCACCTCGTGG - Exonic
1113759178 13:112835653-112835675 GCTGCCCCTCAGCCTCCTCAGGG - Intronic
1117767579 14:59098970-59098992 GTTACCTGTCAGCCATCTAGGGG - Intergenic
1121567335 14:94919984-94920006 GCTGCCTGCCAGCCACATCTTGG - Intergenic
1121903643 14:97719227-97719249 GCTGGCTGTCTGCAACCTGGAGG - Intergenic
1122463506 14:101915657-101915679 CCTGACTGTGAGCCCCCTCGAGG + Intronic
1122805470 14:104254129-104254151 GCTGCCTGGAAGCCTCCTCTGGG - Intergenic
1122993388 14:105249295-105249317 GCTGCGTGTCAGCCACACGGCGG - Intronic
1124885193 15:33678744-33678766 ACTGGCTGTCAGACCCCTCGAGG - Intronic
1127560151 15:60128118-60128140 GCTGCCAGTGAGCCAACTCTTGG - Intergenic
1128228166 15:66017244-66017266 GCAGCCTGGGAGCCACCTCAGGG + Intronic
1132223610 15:100123847-100123869 GCTGCCCATCAGCCACCACGAGG + Intronic
1132452426 15:101975719-101975741 GCCACCTCCCAGCCACCTCGGGG - Intergenic
1132454470 16:14903-14925 GCCACCTCCCAGCCACCTCGGGG + Intronic
1132760738 16:1507447-1507469 GCTGCCTGTCAGCCACCTCGAGG - Intronic
1134092645 16:11399705-11399727 GCTGCCTGGCCGCCTCCCCGGGG - Exonic
1137252311 16:46749197-46749219 GCTCCCTGTGCCCCACCTCGGGG - Intronic
1137506489 16:49058219-49058241 GCTCCCTGCAAGCCACCTCTAGG - Intergenic
1138191233 16:55015898-55015920 GCTGCCTGTTGGCCACCCCTGGG - Intergenic
1142178886 16:88657679-88657701 TCTGCCTGCCAGACTCCTCGTGG + Intronic
1142285549 16:89170094-89170116 CCTGCCTCCCACCCACCTCGGGG - Intergenic
1142693733 17:1621975-1621997 GCTGGCTCTCAGGGACCTCGTGG - Intronic
1142764536 17:2057863-2057885 CCCGCCTGGCGGCCACCTCGAGG + Exonic
1143378135 17:6479318-6479340 GCAGGCTTTCAGCCCCCTCGGGG - Intronic
1143499823 17:7332133-7332155 ACTGCCTGACACCCACCTCCCGG + Intergenic
1146922266 17:36721598-36721620 ACTGCCTGTCAGCAGCCTCTGGG - Intergenic
1147882918 17:43665454-43665476 GGCGTCTGTCAGCCACCTTGCGG + Intergenic
1148109645 17:45137256-45137278 GCTGCCTGGGATCCACCTCTCGG - Intronic
1148115626 17:45172949-45172971 GCTGCATGTGTGCCACCTCCAGG - Intergenic
1149984351 17:61335971-61335993 GCTGCCAGCCCCCCACCTCGGGG + Intronic
1152139596 17:78528675-78528697 GCTGCCTCCCAGCCACGTCTAGG - Intronic
1152606401 17:81293290-81293312 GCTTTCTGCCAGCCACCTCTGGG - Intronic
1158350933 18:56563808-56563830 GCAGCCAGTCAGCCCCCTGGTGG + Intergenic
1158558425 18:58493795-58493817 GCTGGCTGGCAGCCACTGCGAGG + Intronic
1158570898 18:58596330-58596352 TCTGCCTGGCTGCCACCTCCTGG + Intronic
1160512300 18:79459359-79459381 GCTGCGGGGCAGCCACCTGGAGG + Intronic
1160617062 18:80138350-80138372 GCTGCCTGACGGCCACTTAGGGG + Exonic
1165438875 19:35812550-35812572 GCTCCCTGTCACCCAGCTCCAGG - Exonic
1165924379 19:39318252-39318274 GCTTGCTGTCAGCCAGCTGGGGG - Intergenic
928207531 2:29296883-29296905 CCTACCTGTCAGACACATCGAGG + Exonic
929759875 2:44798126-44798148 GCTGCCTGTCAGGTGCCTAGGGG - Intergenic
930204287 2:48572818-48572840 CCTACCTGTGAGCCTCCTCGTGG + Intronic
934954603 2:98607256-98607278 GCTGCCGTTCAGCCAGCTCCTGG - Intronic
936568639 2:113598193-113598215 GCCACCTCCCAGCCACCTCGGGG - Intergenic
937263691 2:120602614-120602636 GCTGCCTCCCAGCCTCCACGGGG + Intergenic
941436537 2:165480075-165480097 GCTGCCTGTCAGCCGGCTGAAGG + Intronic
948319278 2:237056618-237056640 GCTTCATGTTATCCACCTCGGGG - Intergenic
1168975910 20:1965859-1965881 GCTGCCGCCCACCCACCTCGCGG + Intergenic
1169796657 20:9469868-9469890 GCTGCCCATCATCCACCTCAAGG + Intronic
1173582869 20:44159775-44159797 GCTGCCCGACGGCCACCGCGAGG - Exonic
1174311817 20:49662043-49662065 CCTGCCCTTCAGCCACCTCTTGG + Intronic
1175217607 20:57399772-57399794 CCTGCCTGCCAGGCGCCTCGGGG + Intronic
1175818942 20:61898104-61898126 CCTGCCTGTCACCCATCTCTAGG - Intronic
1181476014 22:23168288-23168310 GCTACCTGTCAGCATCCCCGGGG - Intergenic
1181513831 22:23400634-23400656 GCTGCCAGTCAGCACCCACGGGG + Intergenic
1183145535 22:35988014-35988036 GCTGCCTGTTAGCATCCTCTGGG - Intronic
1183309836 22:37103378-37103400 CCTGCCCGCCAGCCACCTGGGGG + Exonic
1184614624 22:45629710-45629732 GCTGCCTGACAGTGGCCTCGGGG - Intergenic
1185036196 22:48478357-48478379 GCTGCCTCTCAGAGACCTCAGGG - Intergenic
1185074503 22:48676092-48676114 GCTGCCTGTGAGCCCTCTGGGGG - Intronic
1185291732 22:50030823-50030845 GCTGCCCGTCTGCAACCTCAAGG - Exonic
955488202 3:59456218-59456240 GCTGTCTTTCAGCTACCTCAAGG + Intergenic
961365339 3:126395864-126395886 GGTGGCTGTCAGCCACCCAGGGG + Intronic
961372292 3:126438961-126438983 CCTGCCTGGCAGCCCCCTCCTGG - Intronic
961427533 3:126859838-126859860 GCTGCCTGTCAGAGACATTGAGG + Intronic
975808534 4:78139189-78139211 GCTGCCTGTCAGCCTGCCCAAGG - Intronic
976312934 4:83630444-83630466 TCTGCCTGTCTGCCAGCTTGAGG + Intergenic
982216308 4:153085334-153085356 GCTGGCTGCCCGCCACCTGGTGG + Intergenic
986344617 5:6823055-6823077 GCTCCCAGTCAGCCGCCTCTGGG + Intergenic
998349746 5:141492704-141492726 TCTGCCTGTCCGCCTGCTCGAGG - Intronic
1001639996 5:173237227-173237249 GCTGCATGTCAGCGGCCTTGCGG + Intergenic
1002564905 5:180105947-180105969 GCTGCCTATCAGTCACTTAGTGG - Intronic
1002606900 5:180389074-180389096 GCTGCCTGCCTGCCATCTCCTGG + Intergenic
1002992262 6:2248902-2248924 GCTGCATCTCAGCCAACTCCAGG + Intergenic
1006953785 6:37848361-37848383 GCTGCCTGACAGGCACCTACAGG - Intronic
1007383013 6:41502853-41502875 GCTGCCTCTCATCCACTTCCGGG + Intergenic
1007934869 6:45723871-45723893 GCTGCCTATCAGCCAGGACGAGG + Intergenic
1011471481 6:87712256-87712278 GATGCCTGTGAGTCACCTGGGGG + Intergenic
1013589088 6:111605251-111605273 GCTGGCTGTGAGCCGCCTCCCGG - Intronic
1013631856 6:111993482-111993504 ACTGCCTCTCAGCCCCCACGTGG - Intergenic
1018380657 6:163255380-163255402 GCTGCCCGTCAGTCACCTCCTGG - Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1024714552 7:52061147-52061169 GCTGCCTCTCAGTCATCTCTTGG - Intergenic
1026735311 7:72945326-72945348 CCTGCCCCGCAGCCACCTCGTGG - Intronic
1026785651 7:73300256-73300278 CCTGCCCCGCAGCCACCTCGTGG - Intergenic
1026806771 7:73433917-73433939 GGTGCCTGCCCGCCACGTCGCGG - Exonic
1027108415 7:75419680-75419702 CCTGCCCCGCAGCCACCTCGTGG + Intronic
1029703770 7:102264735-102264757 GCTGCTTCTCAGCCACCACGTGG + Intronic
1034998141 7:155591372-155591394 GCTGCTTCTGAGCCACCTCCAGG + Intergenic
1036418379 8:8572131-8572153 TGTGCCTCTCAGCCACCTCTAGG + Intergenic
1038268233 8:26052202-26052224 GCCTCCAGTCAGCCACCTCCTGG - Intergenic
1042965768 8:74350455-74350477 CCTGCCTCTCAGCCATCTTGGGG - Exonic
1048018568 8:130518930-130518952 GCTGGCTTTCAGCCACCTACAGG + Intergenic
1049188821 8:141274708-141274730 GCTGAAGGTCAGCCATCTCGAGG + Intronic
1049816295 8:144604179-144604201 GCTGCCTCCCGGCCACCTCTGGG - Intronic
1049883888 9:15332-15354 GCCACCTCCCAGCCACCTCGGGG + Intergenic
1050106312 9:2170108-2170130 GCTGCCTGTCTCCCACCTTCTGG + Intronic
1052039705 9:23724214-23724236 CCTGCCTGTCAGCCACACAGTGG - Intronic
1056618681 9:88191624-88191646 GCTGCCTTTGAGCCACCTGCTGG + Intergenic
1057114485 9:92507631-92507653 GCTGCCTGCCAGGAACATCGAGG - Intronic
1059359652 9:113731814-113731836 GCAGCCTGCCAGCCACCATGGGG - Intergenic
1059506697 9:114805832-114805854 CCTGCTTGTCAGCCAGCTCCGGG - Exonic
1061007483 9:127936391-127936413 GCTGCCAGTCAGTAACCTCTGGG - Intronic
1062199955 9:135297322-135297344 CCTGCCTGTCAGCATCCTGGGGG - Intergenic
1196402475 X:115330714-115330736 GCTGCCTGTCAACCACCAGATGG + Intergenic
1197183624 X:123562988-123563010 GCTTCCTGTCTGTCCCCTCGAGG + Intergenic
1198143056 X:133825344-133825366 GCAGCCTGACAGCCACCTTAAGG + Intronic
1198330468 X:135618059-135618081 GCTTGCAGTCAGCCACCTTGCGG - Intergenic
1198336459 X:135670940-135670962 GCTTGCAGTCAGCCACCTTGCGG + Intergenic
1200401923 X:156024827-156024849 GCCACCTCCCAGCCACCTCGGGG - Intergenic