ID: 1132762847

View in Genome Browser
Species Human (GRCh38)
Location 16:1519412-1519434
Sequence AGCCGATGGTCTCGGTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132762847_1132762856 14 Left 1132762847 16:1519412-1519434 CCTGAAAACCGAGACCATCGGCT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1132762856 16:1519449-1519471 CCTCTCCACAAGCTTGGAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 136
1132762847_1132762854 8 Left 1132762847 16:1519412-1519434 CCTGAAAACCGAGACCATCGGCT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1132762854 16:1519443-1519465 GGGTCTCCTCTCCACAAGCTTGG 0: 1
1: 0
2: 0
3: 12
4: 132
1132762847_1132762857 17 Left 1132762847 16:1519412-1519434 CCTGAAAACCGAGACCATCGGCT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1132762857 16:1519452-1519474 CTCCACAAGCTTGGAGCTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132762847 Original CRISPR AGCCGATGGTCTCGGTTTTC AGG (reversed) Intronic
901622374 1:10598924-10598946 AGTTGATGGTATCTGTTTTCGGG + Intronic
1062834737 10:628306-628328 GGCCAATGGTCTCGTTCTTCAGG - Intronic
1064084341 10:12334008-12334030 GGCCGAGGTTCTAGGTTTTCTGG - Intergenic
1064550520 10:16496324-16496346 ATCCGAAGGTCTTGGTCTTCTGG + Intronic
1066634730 10:37489400-37489422 GGCCGAGGTTCTAGGTTTTCTGG - Intergenic
1067469045 10:46523178-46523200 AGCCCAAGCTCTGGGTTTTCTGG + Intergenic
1074123073 10:110507759-110507781 AGGCCAAGGCCTCGGTTTTCAGG - Intronic
1081762211 11:45584461-45584483 AGCCGGTGGACCCGGTCTTCAGG - Intergenic
1104565509 12:129877931-129877953 TGCAGATGGTCTCAGTTCTCAGG - Intronic
1110554915 13:76849010-76849032 AACCGGTGATCTCAGTTTTCTGG + Intergenic
1121241227 14:92431378-92431400 AGCCGATGGACTTAGATTTCAGG - Intronic
1132762847 16:1519412-1519434 AGCCGATGGTCTCGGTTTTCAGG - Intronic
1157487442 18:48098497-48098519 CTCAGATGGTCTCGGTTTCCAGG + Intronic
1160020869 18:75179955-75179977 AGCTGATGGTTTGGCTTTTCTGG - Intergenic
1162534659 19:11255721-11255743 AGCTGATTGCCTGGGTTTTCAGG + Intronic
1163124836 19:15239240-15239262 AGCCCATGTTCTTGATTTTCAGG + Exonic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
941439424 2:165514759-165514781 AGAGGCTGGTCTCGGATTTCTGG + Intronic
949031651 2:241799946-241799968 GGCCGCTGGTCTCGGCTTTGGGG + Intronic
1169266052 20:4167935-4167957 AGCAGCTGGTCTGGGATTTCTGG + Intronic
1175544934 20:59772045-59772067 AGCTGATGGTCTCATTTTACAGG + Intronic
1181437571 22:22919461-22919483 AGCCCCTGGCCTCAGTTTTCAGG - Intergenic
1184851375 22:47123197-47123219 AGCTGGTGCTCTCTGTTTTCAGG - Intronic
953011178 3:39026902-39026924 AGCCCATGGTCTGGGTCTTCAGG + Intergenic
954532530 3:51333324-51333346 AGCACATGGTCTCAGTTTTCAGG - Intronic
960131416 3:114060297-114060319 AGCCAATGGTCTGGGCTTCCAGG + Intronic
960592145 3:119376863-119376885 AGCCAATTGTCTTGGTTTCCAGG + Intronic
961020536 3:123502777-123502799 AGCCGCTGGTCTCTATCTTCAGG + Intronic
1019263274 7:94503-94525 ATCCAATGTTCTCGCTTTTCAGG + Intergenic
1022503724 7:30897812-30897834 AGCAGAGGGTCTGGGTTGTCAGG + Intergenic
1026574598 7:71561666-71561688 ACCCGTTGGTCTCTGTTCTCTGG - Intronic
1038493771 8:27987751-27987773 AGCAGAGGGTCCCGGTGTTCAGG - Intronic
1041107001 8:54453991-54454013 AGCCGGTGGCCGCGATTTTCCGG + Intergenic
1055278136 9:74642574-74642596 TGCCGCTGGTCTCGTTGTTCAGG - Exonic
1061219045 9:129238223-129238245 TACCAATGGCCTCGGTTTTCTGG + Intergenic
1187036570 X:15546698-15546720 AGTCGATTGCCTCAGTTTTCTGG - Intronic
1192458043 X:71293926-71293948 GGCCAATGGTCTTTGTTTTCTGG + Intronic