ID: 1132763189

View in Genome Browser
Species Human (GRCh38)
Location 16:1520932-1520954
Sequence GGGTGGGTATGGAGGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 810
Summary {0: 1, 1: 2, 2: 9, 3: 96, 4: 702}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132763179_1132763189 8 Left 1132763179 16:1520901-1520923 CCTCGGCTCAGCGGCGGCTTCTG 0: 1
1: 0
2: 5
3: 14
4: 151
Right 1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG 0: 1
1: 2
2: 9
3: 96
4: 702
1132763175_1132763189 15 Left 1132763175 16:1520894-1520916 CCAGGCCCCTCGGCTCAGCGGCG 0: 1
1: 0
2: 4
3: 16
4: 173
Right 1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG 0: 1
1: 2
2: 9
3: 96
4: 702
1132763172_1132763189 30 Left 1132763172 16:1520879-1520901 CCGCTTCAGAGGAAACCAGGCCC 0: 1
1: 0
2: 4
3: 24
4: 193
Right 1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG 0: 1
1: 2
2: 9
3: 96
4: 702
1132763177_1132763189 10 Left 1132763177 16:1520899-1520921 CCCCTCGGCTCAGCGGCGGCTTC 0: 1
1: 0
2: 1
3: 10
4: 79
Right 1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG 0: 1
1: 2
2: 9
3: 96
4: 702
1132763178_1132763189 9 Left 1132763178 16:1520900-1520922 CCCTCGGCTCAGCGGCGGCTTCT 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG 0: 1
1: 2
2: 9
3: 96
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132763189 Original CRISPR GGGTGGGTATGGAGGGGACA AGG Intronic
900131809 1:1090421-1090443 AGCTGGGCCTGGAGGGGACACGG + Exonic
900647226 1:3714448-3714470 GGGTGAGGATGGTGGGGGCAAGG + Intronic
900750521 1:4394069-4394091 ATGTGGGTATGGAGGGTACTTGG + Intergenic
901056543 1:6451081-6451103 TGGTGGGGAGGGAGGGGACCAGG + Intronic
901078750 1:6571811-6571833 GGGGGAGGATGGAGGGGACAAGG - Intronic
901781751 1:11598908-11598930 GGGTGGGCATGGGGGCGACATGG + Intergenic
901874335 1:12158372-12158394 GAGTGGGTTTGGAGGGGTTACGG + Intergenic
902218531 1:14950071-14950093 GGGTGGGTGTGGAGGGTGCAGGG - Intronic
902336690 1:15758526-15758548 GGGTGGGAATGGGGGGGAATGGG - Intronic
902398246 1:16143959-16143981 GGGTGTGTGTGAAAGGGACAGGG - Intronic
902638657 1:17751747-17751769 TGGTGGGTGTAGAGGGCACAGGG - Intergenic
903178831 1:21595389-21595411 AGGTGACAATGGAGGGGACAGGG - Intergenic
903603144 1:24556425-24556447 GCTTGGGTGGGGAGGGGACAAGG - Intronic
903739969 1:25553025-25553047 GGGTGGGTGGGGAGAGGAGAAGG - Intronic
903763006 1:25712372-25712394 GGGAGGGTCTGGAGAGGAGATGG + Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
903885470 1:26538513-26538535 GGCTGGAGATGGATGGGACATGG + Intronic
904607220 1:31704383-31704405 GGGGGGGCGGGGAGGGGACAGGG + Intergenic
904796250 1:33058434-33058456 GGGTGGGGCTGGAGGGGGCAGGG + Intronic
904823466 1:33259405-33259427 GTGTGGGTAAGGTGGGGACCGGG + Intronic
905238294 1:36565585-36565607 GGGAGGGAAGGGAGGGGACAGGG - Intergenic
905715597 1:40146740-40146762 TGGGGGGTATGGGGGGGACCTGG + Intergenic
906501354 1:46343371-46343393 GGGTAGATATGGAGGCCACAGGG - Intronic
907437743 1:54460180-54460202 GGGAGGGAGTGGAGTGGACAAGG + Intergenic
908155655 1:61350049-61350071 GGGTAGGCATGGAGGTGAAAGGG - Intronic
908835614 1:68226686-68226708 GGGTTGGTAAAGAGGAGACATGG - Intronic
910497477 1:87848184-87848206 GGACAGGTATGTAGGGGACAGGG + Intergenic
910793107 1:91071525-91071547 GGGAGGCTTTGGAGGGGGCAGGG + Intergenic
911165672 1:94722353-94722375 TGGTGGGAAAGGAGGGGACAGGG + Intergenic
912232851 1:107815875-107815897 GGCGGGGTGTGGAGGGGGCATGG + Intronic
912392153 1:109310789-109310811 GGGTGGGTATGGATGGCCCTGGG + Exonic
912812150 1:112802604-112802626 GGGTAGGGATGGAGGTGTCAGGG + Intergenic
912815426 1:112824655-112824677 GGGTTGGGACTGAGGGGACAAGG + Intergenic
913275985 1:117138168-117138190 GGATGGGAAGGGAGGGCACATGG - Intergenic
913324621 1:117615862-117615884 TGGTGTGTATGGTGGGGACGGGG + Intronic
913326478 1:117632713-117632735 GGGAGGGGATGAAGGGCACAGGG - Intergenic
913428181 1:118758308-118758330 GGGTGGGTATTATGGTGACAAGG - Intergenic
914239868 1:145846195-145846217 GGGTGAGTATTCTGGGGACAAGG + Exonic
914677147 1:149914064-149914086 GGGTGGATGGGGAAGGGACAGGG + Exonic
914882246 1:151556393-151556415 GGGTGGGAAGGGAGGAGACGGGG - Intronic
914959602 1:152194680-152194702 GGGGGGGTGGGGAGGGGAGAGGG - Intergenic
915070706 1:153263394-153263416 CGGTGAGTCTGGAGAGGACAAGG + Intergenic
915560395 1:156683725-156683747 GGGTTTGGAGGGAGGGGACAGGG + Intergenic
915610583 1:156988742-156988764 GGGCAGGTATGTGGGGGACAAGG + Intronic
915948764 1:160173746-160173768 GGCTGGGGATGGAGGGAACATGG - Intronic
916195524 1:162218755-162218777 GAGTGGGGCTGGAAGGGACAGGG - Intronic
917098030 1:171418973-171418995 GGCTGGGAATGGAGGTGACTGGG + Intergenic
917114762 1:171591763-171591785 TGGTGGCTATGGAGGGTGCAGGG - Exonic
917505994 1:175627685-175627707 GGGTGGGTAAGGATGGGGGATGG - Intronic
917513334 1:175686631-175686653 AGAGGGGGATGGAGGGGACAAGG - Intronic
917649548 1:177063311-177063333 AGGTGGTTAGGGAGGGGCCAAGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917713535 1:177711119-177711141 GGCTGAGTGTGGAGGGGGCATGG + Intergenic
917739394 1:177947768-177947790 GGGAGGGGAGGGAAGGGACAGGG + Intronic
917762881 1:178182855-178182877 GGGTGGGTAGGTGGGGGAAATGG + Intronic
918031307 1:180814894-180814916 GGGTGGGGATGGAGTGTAGAAGG + Intronic
918105718 1:181413579-181413601 GAGTGAGTATGGCGGGGACGCGG + Intronic
918181306 1:182087641-182087663 GGGTGTGCATGCAAGGGACAGGG + Intergenic
919540264 1:198836925-198836947 GGGTGGGGAGGTTGGGGACAGGG - Intergenic
920833545 1:209487002-209487024 GGCTGGGGATGGTGGTGACAGGG - Intergenic
921034902 1:211367620-211367642 AGCTGAGTAGGGAGGGGACATGG + Intronic
921096606 1:211892129-211892151 GGTGGGGGGTGGAGGGGACAGGG + Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
922369274 1:224893153-224893175 GGGGCGGTATGGAGGGGTGAGGG - Intergenic
922452325 1:225747052-225747074 GGTTGGGTGTGGAGGATACAGGG + Intergenic
922718583 1:227889165-227889187 GGGGGGGTAGGGAGCGGGCAGGG - Intergenic
922770829 1:228182303-228182325 GGGTGTGTGTGGTGGGGACGGGG + Intergenic
922770836 1:228182323-228182345 GGGTGTGTATGGTGGGGACGGGG + Intergenic
922770863 1:228182401-228182423 GGGTGTGTGTGGTGGGGACGGGG + Intergenic
922770882 1:228182459-228182481 GGGTGTGTGTGGTGGGGAGATGG + Intergenic
922770889 1:228182481-228182503 GGGTGTGTGTGGTGGGGACGAGG + Intergenic
922770971 1:228182719-228182741 GGGTTTGTATGGTGGGGACGGGG + Intergenic
923014855 1:230118925-230118947 GGGTGGTCATGGACAGGACAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923422916 1:233837011-233837033 GGAAGGGTATGGAGGGGTAAAGG + Intergenic
923660679 1:235954628-235954650 GGTGGGGTGTGGAGGGGACGGGG + Intergenic
924328674 1:242921177-242921199 GGGAGGGAATGGAGGGGAGGAGG + Intergenic
1062818206 10:516419-516441 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818217 10:516439-516461 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818228 10:516459-516481 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818239 10:516479-516501 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818260 10:516518-516540 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818271 10:516538-516560 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818292 10:516577-516599 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818303 10:516597-516619 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818314 10:516617-516639 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818325 10:516637-516659 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818346 10:516676-516698 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818357 10:516696-516718 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818368 10:516716-516738 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1063898628 10:10708835-10708857 GTGTGTGTTTGGAGGGGTCAAGG - Intergenic
1064876554 10:20001467-20001489 GTGTGCGTGTGGAGGGGGCAAGG + Intronic
1064964339 10:21000200-21000222 GAGGGGGTATAGAGGGGGCATGG + Intronic
1065452337 10:25871830-25871852 GGGTGGGGATGGAGGGGTTGGGG + Intergenic
1066189678 10:33044909-33044931 GACAGGGTATGGAGGGGAGATGG + Intergenic
1066294259 10:34040577-34040599 AGGTGGGTAAGGAGAGGACGAGG + Intergenic
1066598671 10:37079989-37080011 GGTTGGGTAGGGAGGGGGCTGGG + Intergenic
1067199525 10:44155333-44155355 GGGTGGGTGGGGTGGGGAAATGG + Intergenic
1067267260 10:44757077-44757099 AGATGGGGATGGAGGGGATAGGG - Intergenic
1069826373 10:71257424-71257446 GGGTGGGCCTGGAGGGGGAAGGG - Intronic
1069853299 10:71424511-71424533 GTGGGGGTATCGAGGAGACAGGG - Intronic
1069871643 10:71536686-71536708 GTTTGGGTCTGGATGGGACAGGG - Intronic
1069891843 10:71656919-71656941 GGTAGGGGATGGAGGGGACCAGG + Intronic
1070395324 10:76007251-76007273 GGGTGGGCAGAGAGGGGCCAAGG - Intronic
1070729146 10:78813413-78813435 AGGTAGGTGGGGAGGGGACAGGG - Intergenic
1070773437 10:79096149-79096171 GGGTGGGTCTGGAGGAGAGGGGG + Intronic
1071284227 10:84129525-84129547 GGGTCAGAATGGAGGGGAGAAGG - Intergenic
1072100730 10:92226869-92226891 GGGAAGGGATGGAGGGAACAGGG + Intronic
1072626714 10:97116811-97116833 GGCTGGGGATGGAGGGGATGTGG - Intronic
1072806081 10:98424727-98424749 GGGAGGGTATGGGGTGGGCATGG + Intronic
1073115883 10:101091403-101091425 GGGTGGGGCCTGAGGGGACAGGG - Intronic
1074713034 10:116193254-116193276 GAGTGGGTGTGGAGGTGGCAGGG - Intronic
1075121763 10:119669692-119669714 TGGGGGGTTTGGAGGGTACAGGG + Intronic
1075138228 10:119806751-119806773 GGGTGGGCTTGGAGGTGAGAGGG - Intronic
1075399659 10:122151769-122151791 CCGTGGGGATGGAGGGGACCTGG + Intronic
1075720789 10:124586190-124586212 GGGTGGGTGTGGGAGGGGCACGG - Intronic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1075912688 10:126139572-126139594 GGCTAGGTATGCAGGGGCCATGG + Intronic
1076108866 10:127845997-127846019 GTTTGGGTATGTTGGGGACATGG - Intergenic
1076382866 10:130037146-130037168 GGGTGGGGACCAAGGGGACAGGG + Intergenic
1076613191 10:131738955-131738977 GGGTGGGTGGGGAGGGAGCATGG - Intergenic
1076619518 10:131778344-131778366 GGGTGGGCAGGGAGGAGAGATGG + Intergenic
1076903119 10:133349696-133349718 GGGTGGGTATGGAGCAGCGAGGG - Intronic
1077037683 11:503170-503192 GGGTGGGTGGGGTGGGGAGAGGG + Exonic
1077063005 11:625973-625995 GGGAGGGTGTGAAGGGGCCAGGG - Intronic
1077219547 11:1409639-1409661 GGGGGTGTATGAAGGGCACAAGG + Intronic
1077344209 11:2038971-2038993 GGGGTGGCATGGAGGGCACAGGG + Intergenic
1077402927 11:2367898-2367920 GGTAGGGAATGGAGGGGTCAGGG + Intergenic
1078429745 11:11280007-11280029 GTGTGTGTTGGGAGGGGACATGG + Intronic
1078464953 11:11543467-11543489 TGGTGGGGACGGTGGGGACAGGG - Intronic
1079043239 11:17077964-17077986 GGGTGGGTATGGAGCAGGTAGGG + Intronic
1079093851 11:17498462-17498484 GAGGGGGTGTGGAAGGGACAGGG - Intronic
1079103697 11:17557384-17557406 GGGAGGGGTTGGAGGGGACTTGG + Intronic
1079698130 11:23509603-23509625 GGGTGTGTTTGGAGGTGACAGGG - Intergenic
1080902551 11:36509920-36509942 TGGTGGGAAGCGAGGGGACAGGG + Intronic
1081737480 11:45414043-45414065 GGGTGGGTTGGGAGGGCTCATGG + Intergenic
1081854739 11:46296216-46296238 GGTTGGGGGTAGAGGGGACAAGG + Intronic
1082788139 11:57328607-57328629 GGCTGGGTCTGGAGAGGGCATGG - Intronic
1082853825 11:57788671-57788693 GGGTGGGAAGGGAGGGGGAAGGG + Intronic
1083253546 11:61482963-61482985 TGGTGGGGATGGTGGGGACAAGG - Intronic
1083309276 11:61776188-61776210 GCTTGGGAATGGAGGGGCCAGGG + Intronic
1083661967 11:64255615-64255637 GGGTGTGTGGGGTGGGGACAGGG + Exonic
1083902680 11:65651217-65651239 AGGTGGGTAGAGAGAGGACAAGG - Intergenic
1083945243 11:65919650-65919672 GGGAGGGCATGGAGGGGGCGGGG - Intronic
1084009554 11:66340035-66340057 GGAGGGGGTTGGAGGGGACATGG - Intronic
1084024220 11:66437914-66437936 GGGCAGGAATAGAGGGGACAGGG - Intronic
1084086478 11:66857385-66857407 GGGAGGGTATGGCGGGGAGTGGG + Intronic
1085331611 11:75656653-75656675 GGGTGGGTAGGGAAGAGAGAGGG - Intronic
1085465814 11:76722521-76722543 AGGTGTGTATGCAGGGCACAGGG - Intergenic
1086124243 11:83333596-83333618 AGGTGAGTATGGAGGGGAGTTGG - Intergenic
1086385251 11:86300824-86300846 AGGTGGGTATGAAGAAGACATGG + Intergenic
1087189909 11:95242759-95242781 GGGTGGTTATAAAGGGGACCAGG + Intergenic
1087199412 11:95330478-95330500 AGCTGGGTATGGAGAGGGCAAGG + Intergenic
1088401416 11:109424737-109424759 GGGTGGGAATGGGGAGGAAAGGG - Exonic
1089059767 11:115617041-115617063 GGGTGGCTGTGGAGGAGGCAGGG - Intergenic
1089108768 11:116037336-116037358 GGGCGGGTTAGCAGGGGACAGGG + Intergenic
1089194285 11:116684053-116684075 GGGTGGGGGTGGAGGGGAGCGGG - Intergenic
1089257974 11:117204031-117204053 GGGTGGAAAGGGAGGGGTCAAGG - Intronic
1089290964 11:117437784-117437806 GGGTGGGGAAGGAGGGGTCCAGG - Intronic
1089325371 11:117653188-117653210 GGGTGTGTGTGTAGGGGAAATGG + Intronic
1089756230 11:120689439-120689461 GGGTGGGTATGGCTGGATCATGG - Intronic
1089760697 11:120720866-120720888 GGGTGAGGATGGAGGGAAAAGGG + Intronic
1090021951 11:123136433-123136455 GGGTGGGGTGGGGGGGGACAAGG - Intronic
1090277697 11:125431454-125431476 GGGTGGGGGGGAAGGGGACATGG + Exonic
1090422004 11:126581852-126581874 GGAAGGGAATGGAAGGGACAAGG + Intronic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1202827195 11_KI270721v1_random:94160-94182 GGGGTGGCATGGAGGGCACAGGG + Intergenic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1092045339 12:5428484-5428506 GGGTGGGGATGGAGGGGGTAGGG + Intergenic
1092111443 12:5967671-5967693 GGGTGGGTGGGCAGGAGACAGGG - Intronic
1092153530 12:6267560-6267582 GGGAGGGAAAGGAGGGGCCAGGG - Intergenic
1092288595 12:7144751-7144773 GGGTGGGTTTAGAGGGGAGAGGG + Intronic
1094003048 12:25717029-25717051 GGATGGGTGTGTAGGGGAAATGG + Intergenic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095946822 12:47758530-47758552 AGGTGGGTAAGGTGGGGTCAGGG - Exonic
1096028679 12:48391496-48391518 GGGTAGGGATGTGGGGGACAGGG - Intergenic
1096074684 12:48795678-48795700 GGGTGGGTAGGGTGGGGTAATGG - Intergenic
1096492282 12:52019335-52019357 GGGTGGGGGTGGATGGGAAAAGG + Intergenic
1096647228 12:53045527-53045549 GGGTGGATATGGTTGGGACTGGG - Intergenic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1097974500 12:65670037-65670059 GGGTAGGGAGGGTGGGGACATGG + Intergenic
1098611701 12:72466800-72466822 GGGTGGGTGTGGTGTGGTCAAGG - Intronic
1099015481 12:77338922-77338944 GGGTGAGTTTGGAGGGAAAAAGG + Intergenic
1100906506 12:99306081-99306103 GGGAGGATATGGTGGGGGCAAGG + Intronic
1101087887 12:101254807-101254829 GGGTGGATGTGGAGAGAACATGG + Intergenic
1102188098 12:110965390-110965412 GGGGGGGTGTGGAGGGGAGTGGG - Intergenic
1102948516 12:117011383-117011405 GGGTGGGTATCTAGGGGTGAAGG - Intronic
1103918493 12:124387900-124387922 GGGTGGGCATGGAGAGCTCAGGG + Intronic
1103948772 12:124540795-124540817 GGGTGGATATGGAGGGGAATGGG + Intronic
1103949101 12:124541770-124541792 GGGTGGATATGGAGGGGGATGGG + Intronic
1103949111 12:124541792-124541814 GGGTGGATATGGAGGGGGATGGG + Intronic
1103971193 12:124673961-124673983 GGGTGGGGAGGGAGGGCATAGGG - Intergenic
1104646757 12:130502916-130502938 TGGTAGGGATGGAGGGGACAGGG + Intronic
1104673933 12:130700082-130700104 GGGTGGCTGGGGAGGGAACATGG - Intronic
1104844699 12:131840922-131840944 GGTTGGGGATGGGGGGGCCATGG - Intronic
1104964514 12:132502900-132502922 GGGTGTGAATGCAGGGGGCACGG - Intronic
1105450159 13:20492551-20492573 GGCTGGCTATGGAGGGGGAAGGG - Intronic
1105560341 13:21484594-21484616 GGGTGGGATGGGGGGGGACAGGG + Intergenic
1105838267 13:24230031-24230053 AGATGGTTATGGAGAGGACAGGG + Intronic
1106138277 13:26990682-26990704 GGGTGTGGTGGGAGGGGACAGGG - Intergenic
1107061295 13:36162583-36162605 TGGTGGGTATGGAGGGGGTGTGG - Intergenic
1107788488 13:43977802-43977824 GGGAGGGAAGGGAGGGGAGAGGG - Intergenic
1108803978 13:54131827-54131849 GGGTTGGTACTGAGGGGACAGGG + Intergenic
1110735272 13:78928782-78928804 GGGGGGGGAGGCAGGGGACAGGG - Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1112257732 13:97850187-97850209 GGGCTGGTCTGGAGGGGCCAGGG - Intergenic
1112441233 13:99426414-99426436 GGCTGGGTGTGGAGAGGGCAGGG - Intergenic
1112920542 13:104606090-104606112 GGGCGGGAAAGGAGGAGACAGGG + Intergenic
1113066081 13:106375317-106375339 GGCTGGGGCTGGAGGGGACTTGG - Intergenic
1113417908 13:110144935-110144957 TAGTGGGTATGAAGGGGTCACGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114307416 14:21436869-21436891 GGGTGGGGGTGGGGGGGACCCGG + Intronic
1114486682 14:23067009-23067031 GGGTGGGGGTGGATGGGAAAGGG - Intronic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114495503 14:23128807-23128829 GGATGTGTGTGGTGGGGACATGG + Intronic
1114533920 14:23411521-23411543 AAGGGGGTAGGGAGGGGACAAGG - Intergenic
1117010258 14:51463822-51463844 TGGGGGTGATGGAGGGGACAGGG + Intergenic
1117019632 14:51556586-51556608 TGGTGGGGAGGGAGGCGACAGGG + Intronic
1117105485 14:52393957-52393979 GGGCGGGAAGGGAGGGCACAGGG - Intergenic
1117288998 14:54314611-54314633 GGCAGGGACTGGAGGGGACAAGG - Intergenic
1117340045 14:54784733-54784755 GGAGGGGTAGGCAGGGGACAGGG + Intronic
1117474892 14:56084144-56084166 GGTTGGGGATGGAGGCGGCAGGG - Intergenic
1117983348 14:61363566-61363588 GAATGGGTATGTAGGGGCCAAGG + Intronic
1118321876 14:64758133-64758155 GGGTGGATAGGGAGGGGTGAAGG - Intronic
1118881929 14:69836216-69836238 TGGTGTGAAAGGAGGGGACAGGG - Intergenic
1119228116 14:72959738-72959760 GAGTGGGTCTGGAGGGGCCCAGG - Intergenic
1119328817 14:73778665-73778687 GGGAGGCTGAGGAGGGGACATGG + Intronic
1119895909 14:78219918-78219940 GGATGGGGATGGAGGGTAGAAGG + Intergenic
1120280231 14:82429853-82429875 AAGTGGGGAGGGAGGGGACAGGG - Intergenic
1120711952 14:87801876-87801898 GTGTGTGGATGTAGGGGACAAGG - Intergenic
1121316558 14:92964403-92964425 GGGTGGGGAGGGAGGGGAGCTGG + Intronic
1121592355 14:95125664-95125686 GGGGGAGGAGGGAGGGGACAGGG + Intronic
1121667622 14:95685227-95685249 GGGTGGGAATGGAGTGGGCCAGG - Intergenic
1121668772 14:95692253-95692275 TGGTGGGTATGAAGGGGATTTGG - Exonic
1122317074 14:100832346-100832368 GGGGCGGTAGGGAGGGGGCAGGG - Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122606033 14:102948192-102948214 GGGTGGGCGTGGAGGTGACAGGG + Intronic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606092 14:102948324-102948346 GGGTGGGTTTGGAGGTGAGGGGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122606239 14:102948677-102948699 GGGTGGGTGTGGAGGTGAGGGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122668197 14:103349106-103349128 GGGTGGGGATTGATGGGAAAGGG + Intergenic
1123130654 14:105982916-105982938 AGGTGGTTATGGAAGGGCCACGG - Intergenic
1124514436 15:30354624-30354646 GGGTGGGTATGGAGCTGCCATGG - Intergenic
1124723945 15:32138430-32138452 GTGGGGGTTGGGAGGGGACATGG - Intronic
1124728484 15:32176141-32176163 GGGTGGGTATGGAGCTGCCATGG + Intergenic
1124970074 15:34479972-34479994 GGGTTGGTGGGGAGGGGAGAGGG - Intergenic
1125055968 15:35359228-35359250 TGGGGGGTGTTGAGGGGACATGG - Intronic
1125434495 15:39630525-39630547 GGTGGGGCATGGAGGGAACAGGG + Intronic
1125470789 15:40001429-40001451 GGGTGGGTAGGGAGGAGGAAAGG - Intronic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1127657746 15:61071561-61071583 GGAGGGGTAGGGAGGGGAGAGGG + Intronic
1128155382 15:65388643-65388665 AGGTGGGCAGGGAGGGGACTGGG + Intronic
1128361576 15:66965338-66965360 GGGAGGATATGGTGAGGACATGG + Intergenic
1128632434 15:69280380-69280402 GGGTGGTGATGGGGGGGATACGG - Intergenic
1129245682 15:74277403-74277425 CGGTGGGCGTGGAGGGGCCATGG + Intronic
1129875343 15:78971778-78971800 GGACGGGTATGGAGGGGACAGGG + Intronic
1130986522 15:88848081-88848103 GGGTGGGCAGGGAGCTGACAGGG + Intronic
1131143090 15:89993489-89993511 GGATGGGGAAGGAGGGGGCAGGG - Intergenic
1131399111 15:92110466-92110488 AGGTGGGCGTGGAGGGAACAGGG - Intronic
1131423558 15:92326998-92327020 GGGTGGATATGAGGGCGACAGGG - Intergenic
1131650166 15:94389315-94389337 GGGTGGGCATGGAGGGGAAGTGG + Intronic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1133025926 16:2988925-2988947 GGGAGAGGAGGGAGGGGACAAGG + Intergenic
1133031772 16:3014451-3014473 GGGTGGGGATGTTGGGGAGAGGG - Exonic
1133036074 16:3035144-3035166 GGGTGGGCCTGGAGAGGACAAGG - Intronic
1133305227 16:4804222-4804244 CGGTGGGCATGCAGGGGACTTGG + Exonic
1133328372 16:4956275-4956297 GGGTGAGTAGGTGGGGGACATGG - Intronic
1133908464 16:10042738-10042760 GGGTTGGGATGGAGGCGGCATGG + Intronic
1134260559 16:12647855-12647877 GGCTGGGCTTGGAGGGTACAAGG - Intergenic
1134297952 16:12963232-12963254 GAGTGGGAATGGTGAGGACATGG + Intronic
1135058299 16:19249379-19249401 GGGAGGGGATGGAGTGGAAAGGG + Intronic
1135173621 16:20208851-20208873 GGGTGGGTATTGAGGGGACAGGG + Intergenic
1135925553 16:26690512-26690534 GGGTGGCTTTGGAGGAGTCATGG + Intergenic
1136116360 16:28097404-28097426 GGGTGGGGATGGGTGGGACTTGG - Intergenic
1136413714 16:30091396-30091418 GGGTGGGGAGGGAGGGGAGGAGG - Intronic
1136422949 16:30148031-30148053 TGGGGAGTAGGGAGGGGACAGGG - Intergenic
1137013239 16:35344737-35344759 GGGAGGGAATGGAGAGGACCAGG - Intergenic
1137742175 16:50789459-50789481 GAGTGGGTAGGGAGGGATCAGGG + Intronic
1138088383 16:54154512-54154534 GGCAGGGCATGGTGGGGACATGG + Intergenic
1138454889 16:57115573-57115595 GGGTGGGGATGGAGGGGGTGCGG - Intronic
1138460101 16:57143006-57143028 AGGTGGGAATGCTGGGGACAGGG + Intronic
1139431358 16:66912613-66912635 GGGTAGGAACAGAGGGGACAGGG + Intronic
1139468430 16:67166081-67166103 GGGCGGGGAAAGAGGGGACAGGG + Intronic
1140732876 16:77872231-77872253 AGGTGGGTACGCAGGGGAGAGGG - Intronic
1140800994 16:78488162-78488184 GGCTGGGGATGGAGGGAACATGG + Intronic
1141281859 16:82636150-82636172 GGCTGGGTATGGAGATGGCAGGG + Intronic
1141685446 16:85567219-85567241 GGGTGGGTCTGCAGGGGACCAGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142284328 16:89165603-89165625 GGGTGGGCATGGGGAGCACAGGG - Intergenic
1142875929 17:2852340-2852362 GGGTGGGGGTGGGGGGCACAAGG + Intronic
1143921554 17:10334217-10334239 GGGTGGGAGTGGTGGGGCCAAGG + Intronic
1144426759 17:15150401-15150423 GGGTTTGTAAGGTGGGGACAAGG - Intergenic
1145241808 17:21244540-21244562 GGGTGGGGATGCAGGGAGCAGGG - Intronic
1146125839 17:30230711-30230733 GGTGGGGCATGGAGGGGAGAAGG + Intronic
1146485713 17:33240820-33240842 GGCTGGCTATGGAGAGGACAGGG - Intronic
1146950462 17:36901746-36901768 TGGTGGGTATGGAGGGGCTGTGG + Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147237913 17:39071372-39071394 GGGTGGGTTGGGAGGGAACTAGG + Intronic
1147261572 17:39212193-39212215 GGAAGGGTATGGAGTGGACAAGG + Exonic
1147558645 17:41495816-41495838 GGGTGGGTATTTGGGGGACTTGG - Intergenic
1147617408 17:41837699-41837721 GGGGTGGTAAGGAGGGGAGAAGG + Intronic
1147662605 17:42125081-42125103 GGGTGGGTAAGGGGGGGAGTGGG - Intronic
1148205139 17:45775252-45775274 GGGTGGATGTGGAGGGGAATGGG + Intergenic
1148240410 17:45996477-45996499 GGGTGGGGTTGGAAGGGACGGGG - Exonic
1148555927 17:48578536-48578558 GGGTGGGTGGGGAGGGGGAAGGG - Exonic
1148789144 17:50163760-50163782 GGGTGGGAAGGGAGGTCACAGGG - Intergenic
1149492794 17:57097188-57097210 GGGTGGGTAGGGAGGGGGACAGG - Intronic
1149614660 17:57988039-57988061 GGGGGGGCACGGGGGGGACAGGG - Intronic
1149979353 17:61297284-61297306 GGCTGGGGATGGAGGAGAGAAGG + Intronic
1149993083 17:61393559-61393581 GGGTGTGTGTGAAGGGGGCAGGG - Intergenic
1150563743 17:66319119-66319141 GGGTGGGGGTGGAGGGGACAGGG - Intronic
1151196494 17:72435455-72435477 AGGTGGGAATGCAGGTGACAAGG + Intergenic
1151381296 17:73727471-73727493 GGGTGTGTGTGGAGGAGAAAGGG + Intergenic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1151658094 17:75504920-75504942 GGGTGGGTGCGGAGGGGAGGCGG + Exonic
1151885593 17:76921580-76921602 GGGTGTGCATGGAGGGAGCAGGG - Intronic
1152080896 17:78186713-78186735 GGGAGGGGAGGGACGGGACAAGG + Intronic
1152195686 17:78916851-78916873 GGGTGGGTATGGGGAGCCCAGGG - Intronic
1152279174 17:79375293-79375315 GGATGGGTAAAGAGGGGACAGGG + Intronic
1152380601 17:79940767-79940789 GGCTGGGCGTGAAGGGGACAGGG - Exonic
1152635838 17:81430198-81430220 CGGTGGGGAGGGAGGGGACCAGG - Intronic
1152696651 17:81800915-81800937 AGCTGGGAATGGAGGGGGCAGGG - Intergenic
1152789805 17:82273039-82273061 GGTTGGGGAAGGAGGGGATAGGG - Intronic
1152821741 17:82441095-82441117 GGGAGGGGAAGAAGGGGACAGGG - Exonic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155165289 18:23227236-23227258 GGGTGGGGAGGAAGGGGGCATGG - Intronic
1155569181 18:27171284-27171306 GGGTGGGCATGGGGAGGACATGG + Intronic
1155930533 18:31702861-31702883 GAGTGGATATGGAGGGGAAATGG + Intergenic
1157446701 18:47751624-47751646 GTGTGGATGAGGAGGGGACAAGG + Intergenic
1157555848 18:48612457-48612479 GAGAGGGGATGGAGGGGACCAGG + Intronic
1157625196 18:49045146-49045168 GGGTGGGGAGAGAGGGGACAGGG + Intronic
1158403938 18:57144778-57144800 GGGTGGGTGTGGTGGGGGAATGG + Intergenic
1158470905 18:57735963-57735985 GGGTGGGGGTGGGGGGGGCAAGG - Intronic
1158626777 18:59078437-59078459 TGGTGGGAATGGAGGGATCAGGG + Intergenic
1159343957 18:67174352-67174374 GGGTGGGTATGGGGAAGAAATGG + Intergenic
1160012197 18:75114516-75114538 GGGTGGGTGTGGAGTGGCCTGGG + Intergenic
1160123917 18:76153529-76153551 TGGTGGAAATGGAGGTGACAGGG + Intergenic
1160586298 18:79915315-79915337 GGGGGGATGGGGAGGGGACAGGG - Intronic
1161142037 19:2653794-2653816 GGCTGAGTGAGGAGGGGACACGG - Intronic
1161207857 19:3051203-3051225 GGCTGGGAGTGGAGGGGACAGGG - Intergenic
1161268927 19:3378737-3378759 GGGTGGGTCTGCAGGGAACGGGG + Intronic
1161285404 19:3465883-3465905 GGGTGGGGATGCACGGGGCAGGG - Intronic
1161302965 19:3551798-3551820 GGCAGGGCACGGAGGGGACAGGG - Intronic
1161331980 19:3692814-3692836 GGGAGGGCAGGGAGGGGACGGGG - Intronic
1161347162 19:3774193-3774215 GTGTGGGTATGGAGGTGCAAGGG + Intergenic
1161431274 19:4233666-4233688 GGGAGGGCATGGAGGAGACAGGG - Intronic
1161505788 19:4642748-4642770 GGGAGGGCAGGGAGGGGACAGGG + Intronic
1161618030 19:5283153-5283175 GGGCAGGGTTGGAGGGGACAGGG - Intronic
1161619200 19:5289556-5289578 GGGAGGGCACGGAGGGGACAGGG - Intronic
1161649868 19:5477912-5477934 GAGAGGGCAGGGAGGGGACAGGG - Intergenic
1161664204 19:5565122-5565144 GGGAGGGCAGGGAGGGGCCAGGG - Intergenic
1161719756 19:5896239-5896261 GGGAGGGTGGGGAGGGGACAGGG + Intronic
1161846938 19:6717085-6717107 GGGAGGGCAGGGAAGGGACAGGG + Intronic
1161980465 19:7627655-7627677 TGGTGGGTGGGGCGGGGACAGGG - Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162155143 19:8672949-8672971 TGGTGGGTTTGTGGGGGACAAGG + Intergenic
1162256736 19:9496594-9496616 AGGTGGGGGTGGGGGGGACAGGG + Intronic
1162330946 19:10029205-10029227 GGGATGGTATGGAGGGGTGATGG + Intergenic
1162444313 19:10712894-10712916 GGCAGGGCATGGAGGGGACAGGG + Intronic
1162774361 19:12969991-12970013 GGGTGGGTGTGGGGAGGAGAGGG + Intronic
1163183985 19:15623582-15623604 GGGTAGATCTGGAGGTGACAAGG + Intronic
1163255449 19:16153321-16153343 GGGTGGGGCCGGAGGGGCCAAGG - Intronic
1163405039 19:17116759-17116781 TGGTGGGTATGGAGAGGATGGGG + Intronic
1163475596 19:17524209-17524231 GGATGGGCATGGAGGGGTCACGG - Intronic
1163490872 19:17616551-17616573 GAGTGTGTGTGGAGGGGGCAGGG + Intronic
1163611506 19:18304294-18304316 AGGTGGGGAGGGAGGTGACAGGG + Intergenic
1163719904 19:18894074-18894096 GGGAAGGTGTGGCGGGGACATGG + Intronic
1163845395 19:19635607-19635629 GGGTAGGTCAGGATGGGACAGGG - Intronic
1163856769 19:19708501-19708523 GTGTGGGTTTGGATGGGAAACGG + Intergenic
1164575029 19:29400888-29400910 ATGTGGGCATGGTGGGGACAGGG + Intergenic
1166103876 19:40588200-40588222 ATGAGGGTATGGAGGTGACAAGG + Intronic
1166323543 19:42034861-42034883 GGGGCGGGAAGGAGGGGACAAGG + Intronic
1166379673 19:42349416-42349438 GGGTGGGTTTGGAGGTATCAGGG + Intronic
1166549310 19:43654725-43654747 TGGGGGGTATGGGGGGGACAGGG - Intronic
1166743640 19:45129655-45129677 GGGTGAGTGGGGAGGGCACAAGG - Intronic
1166991081 19:46693181-46693203 GGGTGGGCAGGGTTGGGACAAGG - Intronic
1167217159 19:48172126-48172148 GGGTGGGTGTGGGTGGGAGACGG + Intronic
1167463134 19:49636772-49636794 GGGTGGGTGTGGGGAGGACCTGG - Intronic
1167487206 19:49769605-49769627 GGGCGGGTGTGGAGGGGAGTGGG + Intronic
1167691750 19:50989242-50989264 GGGAGGGTATGAAGAGGATAAGG - Intergenic
1168020173 19:53603394-53603416 GGGTGGGGATGGTGCTGACAGGG + Exonic
1168292872 19:55365636-55365658 GGGTGGGGACGGAGGGGAAAGGG - Exonic
1168307531 19:55443414-55443436 GGGTGGGAAAGGAGGAGTCAGGG + Intergenic
925293989 2:2765918-2765940 GTATGGGGAAGGAGGGGACAGGG - Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926223777 2:10953316-10953338 GAGTGGGTAAAGAGGGGATAGGG + Intergenic
926232933 2:11018623-11018645 GGCAGGGTATGGCGGGGAGACGG - Intergenic
926370834 2:12177276-12177298 GTGTGGGGAGGGAGGGCACACGG - Intergenic
926641705 2:15244610-15244632 GGGTGGGTGTGGGGGAAACAGGG + Intronic
926676403 2:15626182-15626204 GGGTATGTGTGGAGGGGAGAGGG - Intronic
926918927 2:17919908-17919930 AGGTTGGTAAGGAGGAGACATGG + Intronic
927086458 2:19677823-19677845 GGGCGAGTAAGGAGGGCACAAGG + Intergenic
927428614 2:23007993-23008015 GGGTGGGGCTGAAGGGGAGAGGG + Intergenic
928085002 2:28340476-28340498 AGTGGGGGATGGAGGGGACATGG - Intergenic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
929024701 2:37588689-37588711 CGGTGTGTATGGTGGGGGCAGGG - Intergenic
929248376 2:39726806-39726828 GGGTGGGTAAGGAAGGGCCCTGG + Intergenic
929511418 2:42568600-42568622 GGGAGGGAAGGGAGGGGACAGGG - Intronic
929723350 2:44395539-44395561 GAGTGGTTATGGAAGGTACATGG + Intronic
929885325 2:45872839-45872861 GGGTGGGCATGGAGGGGCAGCGG + Intronic
930022351 2:47009099-47009121 GGGTGTGGATGGAGGGGCCTTGG + Intronic
930540099 2:52694882-52694904 GGTTGGGGATGGAGAGAACAGGG + Intergenic
931348089 2:61465193-61465215 GGGTGGGTGTGGTGGGGCAAGGG + Intronic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932297467 2:70638926-70638948 GGGTGGGGAAGGATGGGACAGGG + Intronic
932411247 2:71549297-71549319 GGGTGGGCATGGCTGGGAGAAGG - Intronic
933811325 2:86034547-86034569 GAAGTGGTATGGAGGGGACAGGG - Intronic
933891959 2:86780298-86780320 GGGTGGTTGGGGAGGGGATAAGG + Intergenic
933938454 2:87225865-87225887 GGCTGGGTCTGGTGGGCACATGG - Intergenic
934494382 2:94784520-94784542 GGGTGGGTGTGGACGGAAAAAGG - Intergenic
934504449 2:94879862-94879884 GGGTGGGAATGGAGAGGTCCAGG + Intergenic
934521329 2:95021971-95021993 GGATGGGGATGGAGGGTAGAGGG - Intergenic
934532840 2:95106354-95106376 GGGTGGGTGGGGCAGGGACAGGG - Intronic
934615019 2:95765247-95765269 GGGTGGGGAGGCAGGAGACAGGG + Intergenic
934645882 2:96059239-96059261 GGGTGGGGAGGCAGGAGACAGGG - Intergenic
934839285 2:97615329-97615351 GGGTGGGGAGGCAGGAGACAGGG - Intergenic
935011556 2:99141205-99141227 GGGTGGGAAGGGAGGAGAAAGGG - Intronic
935282027 2:101526615-101526637 GGGTGAATTTGGAGGGGAAATGG + Intergenic
935796438 2:106645642-106645664 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
936354684 2:111739909-111739931 GGCTGGGTCTGGTGGGCACATGG + Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
937028908 2:118721802-118721824 GGGTGGGAATGGAGCCGACAGGG + Intergenic
937315243 2:120928004-120928026 AGGTGGGTATGACAGGGACAGGG - Intronic
937355621 2:121196440-121196462 GGGTGTGTGGGCAGGGGACAGGG - Intergenic
937772848 2:125741782-125741804 GGGGAGGTATGGAGAGGAAATGG + Intergenic
937886243 2:126901674-126901696 GGTGGGGTGTGCAGGGGACAGGG - Intronic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
939302869 2:140368957-140368979 AGGTGTGAATGGAGGGGAAAGGG + Intronic
939393525 2:141599945-141599967 GGGTGTGTGTGGAGCGGGCAGGG - Intronic
939567064 2:143797693-143797715 GGGTGGGAATGGAGGAGCCAAGG - Intergenic
939631488 2:144531291-144531313 GTGTGGGATTGGAGGGGAAAGGG - Intergenic
939970122 2:148648634-148648656 GGGTGGGGATAGAGGGGGAATGG - Intronic
940009326 2:149038254-149038276 GGGTGGGCAAGGTGGGGACGGGG + Intronic
940841962 2:158594151-158594173 GGTTGGGTTTGGAGTGGAGATGG + Intronic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941604496 2:167580555-167580577 GGCTGGGTAGGGAGGACACAGGG - Intergenic
942100509 2:172577715-172577737 GGATGGGTGGGGAGGGGAAAAGG - Intronic
942305041 2:174599196-174599218 GAGTGGGAATGGTGGGGGCAGGG + Intronic
943063236 2:183060578-183060600 GGGTGGGTCTGGTGGGGTCTGGG + Intergenic
943706769 2:191043998-191044020 GGGTGGGTACAGAGAGGAAAAGG + Intronic
944663205 2:201938306-201938328 GGGTGGGGGTGGACAGGACATGG - Intergenic
944736292 2:202569654-202569676 GGATAGGCATGGAGGAGACAAGG - Intergenic
944757392 2:202777716-202777738 AGATGGCTATGGATGGGACATGG + Exonic
944770193 2:202906369-202906391 GGGTGGGGGAGGAGGGGACAGGG - Intronic
946403530 2:219481124-219481146 GGGGGGCTGGGGAGGGGACAGGG + Intronic
946594273 2:221288754-221288776 GCGGGGGAATGGAGGGGCCAAGG + Intergenic
946861119 2:224001244-224001266 GGGTGGCTGTGGAGGGCCCAGGG - Intronic
946948086 2:224843068-224843090 GGGTGGGGGTGGCGGGGAAAGGG + Intronic
946954844 2:224918032-224918054 AGATGGGTAGGGAGGGGTCAAGG + Intronic
947741491 2:232486937-232486959 GTGTGTGCAGGGAGGGGACAGGG - Intronic
948106069 2:235414685-235414707 GAGTGGGTATGAAGGGAACTGGG + Intergenic
948163569 2:235844284-235844306 GAGTGGGTTTGGAGGGGGCAAGG + Intronic
948261344 2:236606499-236606521 GGGTGAATCTGGAGGGCACAGGG - Intergenic
948742317 2:240056128-240056150 GCGTGCGGCTGGAGGGGACACGG + Intergenic
948790100 2:240372522-240372544 GGCAGGGCATGGAGGGGGCAGGG + Intergenic
1168733005 20:103628-103650 GGGTGGCTAGGCAGGGGCCATGG - Intergenic
1169266104 20:4168125-4168147 GGGGGGGTGGGGAGGGGGCATGG + Intronic
1169837522 20:9897070-9897092 GGGTGGTTTTGTAGGGGACAAGG - Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170475876 20:16713969-16713991 GGGTGGGAATGGAGGGTGGAAGG + Intergenic
1170478101 20:16736719-16736741 GGGTAGGTTTGGAGAGGAAAGGG + Intronic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170853123 20:20021941-20021963 GAATGGGGATGGTGGGGACAGGG + Intronic
1170950321 20:20930778-20930800 GGGAGGGGATGGTGGGGATAAGG - Intergenic
1170950329 20:20930798-20930820 GGGAGGGGATGGTGGGGATAGGG - Intergenic
1170950338 20:20930818-20930840 GGGAGGGGATGGTGGGGATAGGG - Intergenic
1170950347 20:20930838-20930860 GGGAGGGGATGGTGGGGATAGGG - Intergenic
1170950356 20:20930858-20930880 GGGAGGGGATGGTGGGGATAGGG - Intergenic
1170950563 20:20932208-20932230 GAGTGGTGATGGAGTGGACAAGG + Intergenic
1171848693 20:30292785-30292807 GGGTGGGTGTGCGGGGGACAGGG + Intergenic
1172129342 20:32645382-32645404 GGGGGTGTATGGAGGGGAGGGGG + Intergenic
1172151193 20:32791794-32791816 AGGGTGGTTTGGAGGGGACAGGG + Intronic
1172179009 20:32989402-32989424 GGGTGGGGTGGGAGGGAACACGG - Intronic
1172208640 20:33182095-33182117 GGGTGTGGATGGAGGGGCCTTGG - Intergenic
1172222053 20:33280780-33280802 GGGTGGGGGAGCAGGGGACAAGG - Intronic
1172952097 20:38728786-38728808 GGGGGGGATGGGAGGGGACAGGG + Exonic
1174056715 20:47803192-47803214 GGGTCAGCATGGAGGGAACAAGG + Intergenic
1174431570 20:50473653-50473675 GGGTGGCTATGGAGGCTACTGGG + Intergenic
1175316973 20:58055226-58055248 GGCTGAGGAAGGAGGGGACATGG + Intergenic
1175381524 20:58567464-58567486 TGGTGGGAATGAAGGGGACAGGG + Intergenic
1175403197 20:58712121-58712143 GTGTGTGTATTGAGGGGACGCGG + Intronic
1175403844 20:58714897-58714919 GGGTGGGGATGGGTGAGACAGGG - Intronic
1175914653 20:62419977-62419999 GGGAGGGGCTGGAGGGGCCAGGG + Intronic
1176122361 20:63459915-63459937 GGAGGAGTCTGGAGGGGACAAGG - Intronic
1176184155 20:63769084-63769106 GGGTGGGAGAGGAGGGCACATGG + Intronic
1176301839 21:5102291-5102313 GGCTGGGTAGGCAGGGGACGGGG - Intergenic
1176430265 21:6571134-6571156 GGCTGGCTGTTGAGGGGACAGGG + Intergenic
1176670362 21:9728391-9728413 GGGGGGGAATGGAGGGGGAAGGG + Intergenic
1177617739 21:23545947-23545969 GGGAGGGTAGGAAGGGGGCATGG + Intergenic
1178536049 21:33411312-33411334 GGGTGGGTGGCGAGGGGACAAGG - Intronic
1178664299 21:34533309-34533331 GAGTGAGAATGGAGTGGACAGGG - Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1179149666 21:38799095-38799117 GGGTGGGAGCTGAGGGGACAAGG + Intergenic
1179543715 21:42100791-42100813 GGGAGGGTGAGGAGGGCACAGGG - Intronic
1179595267 21:42438872-42438894 GGGCAGGAATGGAGGGGCCATGG + Intronic
1179705659 21:43178596-43178618 GGCTGGCTGTTGAGGGGACAGGG + Intergenic
1179855192 21:44159609-44159631 GGCTGGGTAGGCAGGGGACGGGG + Intergenic
1180093186 21:45542797-45542819 GGGGGGGTCAGGAGGGGACCGGG - Intronic
1180198643 21:46212056-46212078 GGAGGGGCAGGGAGGGGACAGGG + Intronic
1181116598 22:20635659-20635681 CGGTGGGTATGGAGGGGCCTTGG + Intergenic
1181305761 22:21916467-21916489 GGGTGGGGATGGAGGTGAAAGGG - Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181480752 22:23197831-23197853 GGGGAGGGATGGAGAGGACAAGG + Intronic
1181558285 22:23684695-23684717 GCACGGGTAGGGAGGGGACAGGG - Intergenic
1181681620 22:24499519-24499541 GGGTGGGCTTGGAGGGGCCCAGG - Intronic
1182096870 22:27631223-27631245 AGGGTGGTATGGAGGGGAAAGGG + Intergenic
1182113843 22:27743574-27743596 GGGTTGGTACTGAGGGGACAGGG - Intergenic
1182778601 22:32849699-32849721 GGATGGGTAGGGAGGGGGCATGG + Intronic
1183382237 22:37496002-37496024 GGCTGGGCATGGATGGGGCAGGG + Exonic
1183473222 22:38020795-38020817 GGGTGGAGGTGGAGGGGAAAAGG - Intronic
1183522337 22:38302832-38302854 GGCTGGGGATGGAGGGGACGGGG + Intronic
1183753183 22:39734043-39734065 TGGGGGGTGGGGAGGGGACAAGG - Intergenic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184257421 22:43295183-43295205 AGGTGGGCATGGAGGGGCCAGGG - Intronic
1184366435 22:44054571-44054593 GGCTGGGCAGGGAGGGGACAGGG + Intronic
1184513273 22:44945430-44945452 GGGTGGGAATTGAGAGTACATGG + Intronic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
949905637 3:8856241-8856263 GGCTGGGGAGGGAGGGGCCAAGG - Intronic
950023483 3:9805473-9805495 GGCTGAGTATGGAGTGGGCAGGG + Intronic
950096116 3:10331678-10331700 GGGTAGGCAGGGAGGGGAGATGG - Intronic
950169976 3:10832214-10832236 GGGTGGGTTTGCAGGGCACCAGG - Intronic
950531221 3:13553306-13553328 GAGTGGGCCTGGAGAGGACAAGG + Intronic
950555925 3:13696011-13696033 AGCTGGGAAAGGAGGGGACATGG + Intergenic
950634783 3:14307234-14307256 GGGTGGGGATGCAGGGGAGGTGG + Intergenic
950644116 3:14367075-14367097 GGGTGAGTAAGGATGGGACAGGG + Intergenic
950670131 3:14521019-14521041 TGGTGGCTAAGGAGGGGAGAAGG - Intronic
950729964 3:14948139-14948161 GGGTGGGGGTGGAGGGGGAATGG + Intronic
950764139 3:15260759-15260781 GGGTGGGCATGGAGGTGGCCTGG + Intronic
951094180 3:18609136-18609158 AGGTGGGAATGGAGGCTACAAGG + Intergenic
951973498 3:28475821-28475843 GGGTGGGTAATGAGTGGTCAAGG - Intronic
952843412 3:37667089-37667111 GGGAGGGGATGGCAGGGACATGG + Intronic
953138850 3:40208877-40208899 GGGTGGGAATGGAGAGGAAGAGG - Intronic
953571564 3:44075819-44075841 GGGTGTGGATGGGGAGGACATGG + Intergenic
953820892 3:46206645-46206667 GGGGGTGTATGGAGGTGACTCGG - Intronic
953921764 3:46956807-46956829 GGGTGGGTGTGGTGGTGACAGGG - Intronic
954099686 3:48359944-48359966 GGGTGGGCATTGAGGGGTCTGGG + Intergenic
954149151 3:48648573-48648595 GGGCGGGGCTGGAGAGGACAAGG + Intronic
954394634 3:50287005-50287027 GGCTGGGTCTGCAGGGGTCACGG + Intronic
954419771 3:50412613-50412635 GGGTGGGGAGGGAGAGGATAGGG + Intronic
957740726 3:84264996-84265018 GGGAGGGGATGGAGGGAGCAAGG - Intergenic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
959900622 3:111657500-111657522 GGGTGGGGGTGGTGGGAACAAGG + Intronic
960591364 3:119368944-119368966 GGGTGGGTAGAGAGGGGAGAGGG + Intronic
961082941 3:124042087-124042109 GGATGGGTATGGTTTGGACAGGG + Intergenic
961522475 3:127475076-127475098 GGGTGGGGAAGGAAGGGACTAGG + Intergenic
961524949 3:127490780-127490802 GGGTGGGCATGGTGGGGGTAGGG - Intergenic
961865860 3:129953061-129953083 GGGTGAGGATGGAGTGGAGAGGG - Intergenic
962506114 3:136047953-136047975 GGGTAGGGATGGAGGGAGCAAGG + Intronic
965826946 3:172741139-172741161 AGATGGATATGGAGGGGAGAGGG + Intergenic
966715740 3:183011400-183011422 GGGAGGGTAGGGAGGGGACAGGG + Intergenic
966923298 3:184628589-184628611 AGGTGGCTATGGAAGGGAAATGG - Intronic
967097909 3:186192952-186192974 GGATAGAGATGGAGGGGACAGGG - Intronic
967303061 3:188035824-188035846 GGGTGGGAAGGGAGTGGAAATGG + Intergenic
967313315 3:188127127-188127149 AGGTGGGGCTGGAGGTGACAGGG - Intergenic
968052221 3:195662975-195662997 GGGTGGGTGGGGAGGGTAGATGG - Intergenic
968103589 3:195985363-195985385 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968234780 3:197025061-197025083 GGGTGTGTGTGGTGGGGCCAGGG + Intronic
968301891 3:197622956-197622978 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968542087 4:1172867-1172889 GGAGGGGAAGGGAGGGGACAGGG - Intronic
968549173 4:1213648-1213670 GGCTGGGTACGGAGGGGAGGTGG + Intronic
968615750 4:1577064-1577086 GAGCGGGTACGGTGGGGACAGGG + Intergenic
968810068 4:2795784-2795806 GTGAGGGTATGGAGGGGCCTGGG + Intronic
968887257 4:3341430-3341452 GGGTATGTGGGGAGGGGACAAGG + Intronic
969036938 4:4262027-4262049 GGGTGGGGATGGAGGGCACAAGG - Intergenic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
969446042 4:7245186-7245208 GGGAGGGTAGGGAGGTGACTGGG - Intronic
969599149 4:8165640-8165662 GTGTGGGCATGGAAGGGATAAGG + Intergenic
970819802 4:20198687-20198709 GGGGCGGTATGGAGGGGTGATGG - Intergenic
972249165 4:37281040-37281062 GAGTGGGTCTGGAGGGGCAAAGG + Intronic
972265194 4:37453315-37453337 GAGTGGGTGAGGAGGGGACGGGG + Intergenic
972282213 4:37613451-37613473 GGGTGGGATGGGATGGGACAGGG - Intronic
972359479 4:38314176-38314198 GGGTGGGGTAGGATGGGACAGGG + Intergenic
972656307 4:41066869-41066891 GGGTGGATTTGAAGGGGGCAGGG + Intronic
972904652 4:43729673-43729695 GGGTCGGGAGGGAGGGGAGAGGG + Intergenic
974202912 4:58663967-58663989 GGGTGGGTGGGAAGTGGACAAGG - Intergenic
974254014 4:59425631-59425653 GGGTTGGTTTGGAGGGGGCAGGG + Intergenic
974542494 4:63256035-63256057 GGGTGGGTTTGGGGAGGAGAAGG - Intergenic
976108199 4:81641894-81641916 GAGTGGGTAGAGATGGGACAAGG - Intronic
976687885 4:87836024-87836046 TTGGGGGTATAGAGGGGACAAGG + Intronic
976748967 4:88434527-88434549 GGTTGGGGATGGAGAGGAGATGG + Intronic
977828522 4:101562404-101562426 GGGTGGGTAAAGAGTGGAGAGGG - Intronic
981040142 4:140215083-140215105 GGGTTGGGACTGAGGGGACAGGG - Intergenic
981805374 4:148709307-148709329 GGGAGGATATGCAGGGGACAAGG - Intergenic
983918244 4:173315313-173315335 GGGAGTGAATGGAGGGGGCAAGG + Intronic
984129577 4:175856877-175856899 GAGTGGTTTTGGAGGGGGCATGG + Intronic
985118558 4:186616386-186616408 GAGTGGGTGGGGAGGGGCCATGG - Intronic
985824619 5:2183195-2183217 GGGTGGGTGAGGAGGGGCCAGGG + Intergenic
985869425 5:2542548-2542570 GGGTGGGTATGGGGGATACATGG - Intergenic
986587796 5:9336552-9336574 CGGTGAGTATGGATTGGACAAGG - Intronic
987258722 5:16182332-16182354 TGGTGGGGATGGAGGTGAAAAGG - Intergenic
988428103 5:31087573-31087595 GGGTGGGTGGGGAGGGGAGGAGG - Intergenic
989273463 5:39558842-39558864 GGGTGGATATGGAGAGGAACTGG + Intergenic
989460835 5:41696655-41696677 GCCTGGGTATGGAGAGGAGAGGG + Intergenic
990849695 5:60188594-60188616 GAGTGGAGATGGAGGGGAAATGG + Intronic
990903291 5:60776720-60776742 GGGAGGGAAGGAAGGGGACAAGG + Intronic
991054517 5:62306582-62306604 GGGTGTGCACGGAGGGGACGCGG + Intronic
992029312 5:72705213-72705235 GGGTGGGGAGGGAGGGTAAAGGG + Intergenic
992334472 5:75751465-75751487 GGTTGGGGTTGGAGGGGAGAGGG + Intergenic
992533389 5:77673281-77673303 GGGTGCCTATGGAGAAGACAGGG - Intergenic
992549528 5:77847579-77847601 GGGAGGGTGGGGAGAGGACAGGG - Intronic
994040675 5:95256366-95256388 AGATGGGTAAGGAGAGGACAAGG - Intronic
994502895 5:100602444-100602466 GGGTGGGGAGGGAGGGAGCATGG + Intergenic
995381937 5:111545058-111545080 GAGAGGATATGGTGGGGACAGGG - Intergenic
995873359 5:116765238-116765260 GGGTGGGGAGGGGGGGAACAGGG - Intergenic
996012563 5:118497337-118497359 GGGTCAGAATGGAGGGGGCAGGG + Intergenic
996698638 5:126425862-126425884 GGGTGGGGAAGGAGGGAATAGGG + Intronic
997035935 5:130191207-130191229 TGGTGGGTATGGAAGTGAAAGGG - Intergenic
997158389 5:131581612-131581634 GGGGCGGTATGGAGGGGTGATGG - Intronic
997292181 5:132745590-132745612 GGGGAGGGAAGGAGGGGACAAGG - Intergenic
997603523 5:135156555-135156577 GGATGGGTCTGGAGGGAACAAGG + Intronic
997689739 5:135819585-135819607 GGATGGGAATGGAGGGAAAATGG + Intergenic
997863934 5:137444309-137444331 GGGTGGGAGTGGAGGAGCCAGGG - Intronic
998103297 5:139451803-139451825 GGGTGGGTGTGTAGGGTATAGGG + Intronic
999713164 5:154336676-154336698 GGGTGGGACTGGAGGGGAATTGG - Intronic
999720843 5:154398256-154398278 GGGTGGGAGTTGAAGGGACAGGG + Intronic
999827788 5:155290640-155290662 GGTTGGGGGTGGAGGGGAAATGG + Intergenic
999946362 5:156600305-156600327 GGGAGGGGATGGAGGAGAGAAGG - Intronic
1000205138 5:159051327-159051349 GGGAGGGGAGAGAGGGGACAGGG - Intronic
1001254703 5:170174678-170174700 GGGTGTGTAGGGAGAGGATATGG - Intergenic
1001629982 5:173167907-173167929 GGGTGGGTATGGGCGGGAGATGG - Intergenic
1001781311 5:174371380-174371402 GGGTAAGTTTGGAGGGAACACGG - Intergenic
1002477742 5:179478299-179478321 GGTTAGGGATGGTGGGGACATGG - Intergenic
1002498999 5:179635027-179635049 GGGGTGGTCTGGAGAGGACATGG - Intergenic
1002499009 5:179635067-179635089 GGGGTGGTCTGGAGAGGACATGG - Intergenic
1002502667 5:179657457-179657479 GGGGTGGTCTGGAGAGGACATGG + Intergenic
1002502677 5:179657497-179657519 GGGGTGGTCTGGAGAGGACATGG + Intergenic
1002915858 6:1527237-1527259 GGGTGTGTGTGGAGGGGGCAGGG - Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1004599355 6:17132824-17132846 GTCTGGGCATGGAGTGGACAGGG - Intergenic
1005421322 6:25654312-25654334 GGGAGGGTATGTGGGGGGCAGGG + Intronic
1005763689 6:28989930-28989952 GGGAGGGTATGGAGAGGATAAGG + Intergenic
1006672459 6:35737948-35737970 GGGTTGGGAAGTAGGGGACAGGG - Intronic
1007174762 6:39888125-39888147 GGGTGCATGTGGAGGGGATAGGG + Intronic
1007277878 6:40689046-40689068 GGATGGGAATGGTGGGGAGATGG - Intergenic
1007370294 6:41422443-41422465 GGGAAGGGAGGGAGGGGACATGG - Intergenic
1007373772 6:41443109-41443131 GGGTGGGTCAGGAGGGGCCTTGG - Intergenic
1007714561 6:43848226-43848248 GGGTGGCTAGGGAGGTGAGAGGG + Intergenic
1007895385 6:45351079-45351101 GGGTTGGTGGGGTGGGGACATGG - Intronic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1008201836 6:48600319-48600341 GGGCCGGCATGGAGGGTACATGG - Intergenic
1008527064 6:52417932-52417954 GAGTGGGTAGGGAGGGATCATGG + Intergenic
1010016534 6:71110814-71110836 AGGTGAGTGTGGAGAGGACAAGG - Intergenic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1011785783 6:90843112-90843134 GGGTGGGGGTGGAGTGGAGATGG + Intergenic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1013079764 6:106801926-106801948 GGGGGGAAGTGGAGGGGACAAGG + Intergenic
1014189224 6:118473728-118473750 GGGTGGCAATGGAGGAGGCAAGG + Intronic
1014957382 6:127637655-127637677 GTGTGGGAATGGTGGGGACAGGG + Intergenic
1015249276 6:131109892-131109914 TGGTGGGCAGGGAGAGGACAGGG - Intergenic
1015461463 6:133496476-133496498 GGGTGGTCATGTAGGGGAAATGG - Intronic
1015875594 6:137818859-137818881 GGGTAAGTATGGTGGGGAAAAGG + Intergenic
1016303568 6:142658367-142658389 GGGGAGGGATGGAGGGGACAAGG - Intergenic
1016752843 6:147650335-147650357 GGGTGGCAAAGGAGGGGGCAAGG + Intronic
1017491641 6:154950673-154950695 GGGTGAGGTTGGAGGGGACAGGG + Intronic
1017963922 6:159247219-159247241 GGGTGGGGAGGGAGGGAACGGGG - Intronic
1018702302 6:166436724-166436746 GGGTGGGTTTGCATGGGAAATGG + Intronic
1018766124 6:166934304-166934326 GGGTGGGGAAGGCGGGGACTGGG - Intronic
1019496631 7:1343659-1343681 GGGTGGGCATGGCGGGGACCAGG - Intergenic
1019598934 7:1871856-1871878 GAGGGGACATGGAGGGGACAGGG + Intronic
1019916897 7:4139165-4139187 GGGTGGGTAGAGAAGTGACACGG - Intronic
1020154429 7:5710724-5710746 GGGTGGGAGTGGAGTGGAGATGG - Intronic
1020246402 7:6432707-6432729 GGGAGGGGAGGGAGGGGAAAGGG + Intronic
1021296832 7:18918333-18918355 TGGGGGGGATGGAGGGGAAAGGG + Intronic
1021817661 7:24463992-24464014 GGGTTGGTATGGAGGTTGCATGG + Intergenic
1022245118 7:28551686-28551708 TGGTGAGTCGGGAGGGGACAAGG + Intronic
1022275061 7:28847178-28847200 GGCTGGGAATGGAGGGGGCAGGG - Intergenic
1022813649 7:33893469-33893491 GGGTAGGTATGGAGGCTAGAAGG - Intergenic
1023250678 7:38257505-38257527 GGGTGGATCTGGAGTGGACATGG - Intergenic
1023252220 7:38277132-38277154 GGGTGGATCTGGAGTGGACATGG - Intergenic
1023416193 7:39935247-39935269 AGTGGGGTAGGGAGGGGACATGG - Intergenic
1024565497 7:50676759-50676781 GAGGGGGTATGGAGTGGGCAGGG + Intronic
1025071532 7:55903781-55903803 GGGGGTGGATGGAGGGCACATGG + Intronic
1025198184 7:56947690-56947712 GGGCGGGCATCGAGGGGTCACGG - Intergenic
1025236292 7:57236987-57237009 GGGTCAGCATGGAGGGAACAAGG - Intergenic
1025673765 7:63629246-63629268 GGGCGGGCATCGAGGGGTCACGG + Intergenic
1025916792 7:65872976-65872998 GGGTGGGGATGGGCGGGGCAGGG - Intergenic
1027233722 7:76286002-76286024 GGGTGGGCATCCAGTGGACAAGG + Exonic
1027261094 7:76465179-76465201 GGGTGGGTAAGGTGAGGACAGGG + Intronic
1027312476 7:76963287-76963309 GGGTGGGTAAGGTGAGGACAGGG + Intergenic
1027578094 7:79956335-79956357 GGGAGGGTGGGAAGGGGACAAGG + Intergenic
1028224194 7:88231006-88231028 GGGTGGGTATGTATGGGTGAAGG - Intergenic
1028413484 7:90556129-90556151 AGGTGGGAAGGAAGGGGACAAGG + Intronic
1029692417 7:102191100-102191122 GGGAGAGCATGGTGGGGACAGGG - Intronic
1030106250 7:105989859-105989881 GGGGGTGTATGGTGGGGACAGGG - Intronic
1030927646 7:115477593-115477615 GGGCGGGAAGGCAGGGGACAAGG + Intergenic
1031866117 7:127039959-127039981 GAAGGGGTATGGAGGGGAAAGGG + Intronic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032443669 7:131961865-131961887 GGGAGGCTGAGGAGGGGACAAGG - Intergenic
1032525338 7:132575571-132575593 GGGAGGGTAGGGAGGTGAGAGGG + Intronic
1032534936 7:132655318-132655340 GGGAGGGGATGGAGGAGAAAGGG - Intronic
1033396226 7:140976396-140976418 GGGTGGGAATGGAGGAGACAGGG - Intergenic
1033715858 7:144001529-144001551 GGATGGGTTAGGATGGGACAAGG - Intergenic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034972992 7:155430779-155430801 GGAAGGCTGTGGAGGGGACAAGG + Intergenic
1034987131 7:155523343-155523365 GGGTCGGTGTGGCGGGGGCAGGG + Intronic
1035299480 7:157887725-157887747 GAGTGGGTATGGTGGGGAGTGGG - Intronic
1035345202 7:158192864-158192886 GGGTGGGCATGGGGGGCCCAAGG + Intronic
1035961132 8:4139586-4139608 GAGTGGGCATCAAGGGGACAAGG + Intronic
1035975830 8:4310301-4310323 GGGTGGGTGTGGAAGGGAAAAGG + Intronic
1038780153 8:30563180-30563202 GGGGGGGTCAGAAGGGGACAGGG + Intronic
1039280147 8:35975959-35975981 GGGTGAGTTTGGAGAGGAAAAGG - Intergenic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1039544977 8:38403315-38403337 GTGTGGGTATTGCAGGGACAAGG + Intronic
1039547206 8:38418813-38418835 GGGTGGGCACACAGGGGACAAGG + Intronic
1039640361 8:39213815-39213837 GGGCAGGTGGGGAGGGGACAAGG - Intronic
1039848423 8:41342460-41342482 GGGCGGGCATGGTGGGGGCAGGG + Intergenic
1040060688 8:43100551-43100573 GGGTGCTTATGGAGGGGAGGTGG + Intronic
1040447421 8:47509344-47509366 AGGTGGGTAAGCAGGAGACATGG + Intronic
1041053471 8:53959626-53959648 GGCAGGCTATGGAGGGGCCAGGG - Intergenic
1041142793 8:54841056-54841078 GGGTGGGTAAGGAGTGGTCTGGG + Intergenic
1042578591 8:70250602-70250624 AGCTGGGTATGAAGGGTACATGG + Intronic
1043373604 8:79622116-79622138 GCGTGGGTATCCAGTGGACATGG + Intronic
1044434934 8:92150828-92150850 GGGTGGGGGTGGAGGGGGCAGGG + Intergenic
1044462053 8:92457191-92457213 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
1044794268 8:95880443-95880465 AGGTGGGTGTGGTGGGGATAAGG + Intergenic
1044942117 8:97354053-97354075 GGGTGGGTGTGAAGGGGATTTGG - Intergenic
1046622994 8:116547551-116547573 GGGTGGAGATGGAGGAGACGAGG - Intergenic
1047191645 8:122683649-122683671 GGGGGAGTATGGAGGGAAAATGG + Intergenic
1047779290 8:128098435-128098457 GGTGGGGTGGGGAGGGGACAAGG - Intergenic
1048043738 8:130754278-130754300 GGGTGGCTATGAAGAGGTCATGG - Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048429709 8:134358769-134358791 GGGTGGTTCTGGAGTGCACATGG - Intergenic
1049197979 8:141325822-141325844 GGGTGGGGGTGGCGGGGGCAAGG + Intergenic
1049221362 8:141430249-141430271 TGGTGGGGATGGTGGGGACAGGG + Intronic
1049221426 8:141430462-141430484 TGGTGGGGATGGTGGGGACAGGG + Intronic
1049283605 8:141762899-141762921 GGGTGGGGAGAGAGGAGACAAGG - Intergenic
1049353715 8:142177539-142177561 AGGGGGGTCTGGAGGGGTCAGGG + Intergenic
1049408000 8:142460236-142460258 GGGTGGGTCTGCTGGGGGCAGGG + Intronic
1049488593 8:142879223-142879245 GGGTGGGGCTAGCGGGGACATGG - Intronic
1049554629 8:143275783-143275805 GGGGGGGCTTAGAGGGGACAAGG - Intronic
1049638181 8:143700548-143700570 GGCTGTGTATGGACAGGACAGGG - Intronic
1049645987 8:143735822-143735844 GGGTGGGTAGGGAAGGACCAGGG - Intergenic
1049703349 8:144024764-144024786 GGGTAGGTCTTGAGGGGAGAGGG - Intronic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1051340074 9:16102901-16102923 GGGTGGGTATGGACTGGGGAGGG - Intergenic
1051411637 9:16795537-16795559 TGGAGGGTGTGGAGAGGACATGG - Intronic
1051942777 9:22529147-22529169 GGGTGGGTGGGGTGGGGAAAGGG - Intergenic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052987631 9:34499776-34499798 GATTTGATATGGAGGGGACACGG + Intronic
1053170072 9:35872071-35872093 GGCTGGGTATGGAAGAGTCAGGG - Intergenic
1053301688 9:36957013-36957035 GGGTGGAAGTGGGGGGGACAAGG - Intronic
1053662744 9:40295848-40295870 GGGTGGGTGTGGATGGAAAAAGG + Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1053913190 9:42926023-42926045 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1054374874 9:64442072-64442094 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1054521869 9:66080436-66080458 GGGTGGGTGTGGATGGAAAAAGG - Intergenic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1055495568 9:76851138-76851160 GGGTGGGGACTGTGGGGACAGGG + Intronic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056316519 9:85395568-85395590 GGGATGGTGTGCAGGGGACAGGG + Intergenic
1056759590 9:89405259-89405281 GGGTGGCTGGGGACGGGACAGGG - Intronic
1056805792 9:89727616-89727638 AGGGGGGTGTGGAGGGGAGATGG + Intergenic
1057124651 9:92607411-92607433 GGGTGGGTGTTAAGGGGACTAGG + Intronic
1057130530 9:92651389-92651411 GGGTGGGGATGGAGGAGAAAGGG + Intronic
1057319153 9:93996321-93996343 TGGTGGTTATGAAGGGGAAATGG - Intergenic
1057483449 9:95463356-95463378 GGGTGAGCGTGGAGGGGAGACGG + Intronic
1057502084 9:95603977-95603999 GGGAGGGTGGGGAGGGGAAAAGG - Intergenic
1057505114 9:95627334-95627356 GGCTGGGGAGGGAGGGGACCAGG - Intergenic
1057572389 9:96214500-96214522 GGATGGGCATGGAGGGCTCAGGG + Intergenic
1057800600 9:98189029-98189051 GGCAGGGTGTGGTGGGGACAAGG - Intronic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1057962633 9:99471151-99471173 GGGTGTGTGTGGCGGGGACTAGG - Intergenic
1059743913 9:117181955-117181977 GGGTGGGGAAGGAGGGCACTGGG - Intronic
1060025605 9:120168228-120168250 GGGTGGGTATGCAGAGAAGAGGG - Intergenic
1060197900 9:121635097-121635119 GGGTGGCTATGGAGTGGAGGGGG + Intronic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060353553 9:122881668-122881690 GGGTGGGGATGGAGAGGACAGGG + Intronic
1060689977 9:125649169-125649191 TTGTAGGTATGGAGGGGACTAGG - Intronic
1061079327 9:128360771-128360793 GTGAGGGTAGGGAGAGGACAAGG + Exonic
1061166090 9:128922880-128922902 GGGAGGGTAGGGAGGAGACGGGG + Intronic
1061212005 9:129199043-129199065 GGGTGGGAAGGGATGGGACTTGG + Intergenic
1061306445 9:129735792-129735814 TGGTGGGTATGGAAGGGAGGTGG - Intergenic
1061712359 9:132497184-132497206 GGGTGGGGTTGGAGGGTGCAGGG + Intronic
1061839191 9:133347881-133347903 GGGTGGGGATGGAGGGGGGGTGG - Intronic
1062099521 9:134720984-134721006 TGGTGGGTCTGGCGGGGACTGGG - Intronic
1062315045 9:135962997-135963019 TGGTGACTGTGGAGGGGACAGGG + Intergenic
1185621734 X:1454084-1454106 GGGTGGGAAGGGCGGGGAGATGG + Intergenic
1187471530 X:19574015-19574037 GGGTGGGCTTGGAGTGGAGATGG + Intronic
1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG + Intronic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1188894718 X:35653068-35653090 GCGTGTGTATGGATGGGACAGGG - Intergenic
1189214863 X:39314281-39314303 GGGAGGCTAAGGAGGGGAAAGGG + Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1190131923 X:47755873-47755895 AGGTAGGTATGAGGGGGACATGG + Intergenic
1190303191 X:49067961-49067983 GGGTGGGTGTGGCGGGCCCACGG - Exonic
1190404044 X:50068461-50068483 GGGTGGGGGTGGAGTGGAAAAGG - Intronic
1190420817 X:50282495-50282517 CAGTGTGTATGTAGGGGACATGG + Intronic
1191044681 X:56122990-56123012 GGGTGGGCAGGGAGTGGAAAAGG - Intergenic
1192137566 X:68618517-68618539 GGGTGGGGGTGGTGGAGACAAGG + Intergenic
1192146839 X:68688110-68688132 GTGTATGTATGGAGGGGAAAGGG + Intronic
1192174420 X:68876870-68876892 GGGTTGGAGGGGAGGGGACAGGG + Intergenic
1192763705 X:74122068-74122090 GGGGCGGTATGGAGGGGTGATGG + Intergenic
1193018817 X:76767701-76767723 GGGAGGGTAAGGTGGGGAGATGG - Intergenic
1194634478 X:96327611-96327633 GGGTAGGGATGGAGGGGAATTGG - Intergenic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1197234302 X:124041903-124041925 TGGTGGGTATGGAGTGGAGGTGG + Intronic
1197782346 X:130171315-130171337 GGGTGGGGGTAGAGGGGACGGGG + Intergenic
1198203903 X:134448303-134448325 GGGTGGGGAGCGAGGGGACCAGG - Intergenic
1198269012 X:135036476-135036498 GAGTGGGTATGAAGAGGACTGGG - Intergenic
1200067647 X:153511873-153511895 GAGTGGCTGTGGAGGGCACAGGG + Intergenic
1200089124 X:153626201-153626223 GGGTGGGCAAGGCTGGGACATGG - Intergenic
1200761683 Y:7044650-7044672 GGGCGGGTGTGGGGTGGACAGGG + Intronic
1201427287 Y:13866415-13866437 GTGTGGGAATGAAGGAGACATGG + Intergenic