ID: 1132763244

View in Genome Browser
Species Human (GRCh38)
Location 16:1521351-1521373
Sequence GGAAAATCAGGCCGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 829
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 775}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132763244_1132763249 13 Left 1132763244 16:1521351-1521373 CCACCGTGCCGGCCTGATTTTCC 0: 1
1: 0
2: 3
3: 50
4: 775
Right 1132763249 16:1521387-1521409 AATATATATATTTTTTTCTGAGG 0: 1
1: 4
2: 56
3: 398
4: 2305
1132763244_1132763252 18 Left 1132763244 16:1521351-1521373 CCACCGTGCCGGCCTGATTTTCC 0: 1
1: 0
2: 3
3: 50
4: 775
Right 1132763252 16:1521392-1521414 ATATATTTTTTTCTGAGGTGGGG 0: 1
1: 0
2: 9
3: 136
4: 1649
1132763244_1132763251 17 Left 1132763244 16:1521351-1521373 CCACCGTGCCGGCCTGATTTTCC 0: 1
1: 0
2: 3
3: 50
4: 775
Right 1132763251 16:1521391-1521413 TATATATTTTTTTCTGAGGTGGG 0: 1
1: 0
2: 22
3: 226
4: 2219
1132763244_1132763250 16 Left 1132763244 16:1521351-1521373 CCACCGTGCCGGCCTGATTTTCC 0: 1
1: 0
2: 3
3: 50
4: 775
Right 1132763250 16:1521390-1521412 ATATATATTTTTTTCTGAGGTGG 0: 1
1: 6
2: 100
3: 602
4: 3784

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132763244 Original CRISPR GGAAAATCAGGCCGGCACGG TGG (reversed) Intronic