ID: 1132764040

View in Genome Browser
Species Human (GRCh38)
Location 16:1525475-1525497
Sequence ACACGTGGCCAGGGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132764030_1132764040 6 Left 1132764030 16:1525446-1525468 CCTGGCCTGCAGCTCTGCAGACC 0: 1
1: 0
2: 5
3: 49
4: 437
Right 1132764040 16:1525475-1525497 ACACGTGGCCAGGGGGCAGTGGG 0: 1
1: 0
2: 2
3: 19
4: 186
1132764029_1132764040 22 Left 1132764029 16:1525430-1525452 CCTCGGGGTGTGTGCTCCTGGCC 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1132764040 16:1525475-1525497 ACACGTGGCCAGGGGGCAGTGGG 0: 1
1: 0
2: 2
3: 19
4: 186
1132764031_1132764040 1 Left 1132764031 16:1525451-1525473 CCTGCAGCTCTGCAGACCCTGAG 0: 1
1: 0
2: 2
3: 55
4: 393
Right 1132764040 16:1525475-1525497 ACACGTGGCCAGGGGGCAGTGGG 0: 1
1: 0
2: 2
3: 19
4: 186
1132764028_1132764040 23 Left 1132764028 16:1525429-1525451 CCCTCGGGGTGTGTGCTCCTGGC 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1132764040 16:1525475-1525497 ACACGTGGCCAGGGGGCAGTGGG 0: 1
1: 0
2: 2
3: 19
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132764040 Original CRISPR ACACGTGGCCAGGGGGCAGT GGG Intronic
900465774 1:2824823-2824845 ACACCTGGACATGGGGCAGAGGG - Intergenic
900645467 1:3706858-3706880 ACCCCGGGCCAGGGGGCAGCAGG + Intronic
901734210 1:11302049-11302071 ACACTGGGGCAGGGGGCAGGGGG - Intergenic
903575479 1:24337178-24337200 ACACCTGGGCAGTGGGCAGGAGG + Intronic
903669134 1:25025206-25025228 GCACGGGGCCTGGGGGGAGTGGG + Intergenic
904508878 1:30984918-30984940 GCCGGTGGCCAGGGGGGAGTGGG - Intronic
906208750 1:44000715-44000737 ACACATGGCCAAGGGGCAGCGGG + Intronic
906724011 1:48030504-48030526 AGAGGTGGGCAGGGGGCAGAGGG - Intergenic
907468008 1:54652313-54652335 ACATGTGGCCAGCTGGAAGTGGG + Intronic
910378695 1:86601757-86601779 ATAGTTGGGCAGGGGGCAGTGGG - Intergenic
913085471 1:115432661-115432683 ACCCGTGACTAGTGGGCAGTTGG - Intergenic
914666960 1:149840381-149840403 GCACGAGGCCAGGGGTCACTAGG - Exonic
914668807 1:149853409-149853431 GCACGAGGCCAGGGGTCACTAGG + Exonic
916743533 1:167666802-167666824 ACATGTGGCCAATGGGCCGTGGG - Intronic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
1065665823 10:28059159-28059181 AAACCTGGGCAGGGGGCACTGGG + Intronic
1070552930 10:77505138-77505160 GCACGTAGCAAGGGGGCAGCAGG - Intronic
1071081789 10:81821526-81821548 CTACGTGGCCAGGAGGAAGTGGG - Intergenic
1075060827 10:119255678-119255700 ACACCAGGACAGGGGGCAGCAGG - Intronic
1076258104 10:129044846-129044868 CCAGGAGGCCAGTGGGCAGTCGG + Intergenic
1076477833 10:130764906-130764928 ACACGGGGCCAGGTGGGAGATGG - Intergenic
1076756621 10:132575985-132576007 GGATGTGGGCAGGGGGCAGTGGG - Intronic
1077176499 11:1193507-1193529 ACAGGTGGCCTCGGAGCAGTTGG - Intronic
1077445757 11:2589939-2589961 ATCCGTGGCCAGTGGGCAGGAGG - Intronic
1078094264 11:8286974-8286996 AGACAAGGCCAGGGGGCAGGTGG - Intergenic
1078582942 11:12553096-12553118 ACACGTGGAAAGGAGGCAGGGGG - Intergenic
1081869112 11:46375298-46375320 ACCCCTGGCCAGAGGGCAGAGGG - Intronic
1083808776 11:65090673-65090695 ACAGTTGGGCAGGAGGCAGTGGG - Intronic
1084548046 11:69824149-69824171 ACACTTGGACAGTGGGCAGGAGG + Intergenic
1087700816 11:101434475-101434497 ACATGTGGCCAGTGGGCTGTGGG - Intergenic
1088625421 11:111727133-111727155 AGAGGTGGCGAGGGGGCAGCTGG - Exonic
1089698819 11:120232005-120232027 ACATGTGGGCAGGGGGTGGTGGG + Intergenic
1091242128 11:134060245-134060267 GTACGTTGCCAGGGAGCAGTGGG + Intergenic
1091740825 12:2959427-2959449 ACTCGAGGCCAGGGGGCGGGAGG + Exonic
1096454205 12:51771717-51771739 ACAAGTGGCCCAGGGGCAGGCGG - Intronic
1096623409 12:52878782-52878804 ACACGCAGGCAGGGGGCTGTGGG - Intergenic
1097280356 12:57841698-57841720 ACAGGTGGCCGGGGGTCAGAGGG - Intronic
1101966715 12:109287137-109287159 CCACGTGGCCTTGGGGAAGTGGG - Intronic
1102498105 12:113333297-113333319 ACATGTGGGAAGTGGGCAGTGGG + Intronic
1103936123 12:124477813-124477835 ACAAGTTGCCAGGGGGCAGTGGG + Intronic
1103940051 12:124496511-124496533 ACACGAGGTCAGGGGTCAGGAGG + Intronic
1104570927 12:129924995-129925017 ACCGGTGGCCAGAGAGCAGTGGG + Intergenic
1106132644 13:26952641-26952663 ACACGTGGGAAGGGTGGAGTGGG + Intergenic
1107714843 13:43189897-43189919 ACATGTGTCCAGTGGGCATTGGG - Intergenic
1108326484 13:49337450-49337472 CCATGTGGCCAGGGGGAGGTGGG - Intronic
1112302040 13:98239646-98239668 CCAAGTGGCCTGGGGGCAGTGGG + Intronic
1113521240 13:110942785-110942807 TCATGTGGCCAGTGGTCAGTGGG - Intergenic
1114267588 14:21081882-21081904 ACATGGGGCCAGGGAGCAATGGG - Exonic
1117028955 14:51650845-51650867 ACCCGTGGCCAGGGGTCATTGGG + Intronic
1121328381 14:93034779-93034801 ACACACGGGCAGTGGGCAGTGGG + Intronic
1122428522 14:101625446-101625468 ATAGTTGGCCAGGGGGAAGTTGG - Intergenic
1122558481 14:102593603-102593625 ACACCTGGCCTGGGGGCGCTGGG + Intronic
1122581467 14:102774445-102774467 ACACGTGGCCTGGGGGTGGGGGG - Intergenic
1122871367 14:104640534-104640556 ACACGTGCCCAGGGGTGTGTAGG - Intergenic
1122969824 14:105147982-105148004 ACCCGGGGGCAGGGGGCAGGGGG + Intronic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1126832006 15:52617240-52617262 ACATGTGGCCTGGGGGAGGTGGG - Intronic
1127251647 15:57244748-57244770 ACATGTGGGCCGGGCGCAGTGGG - Intronic
1128565419 15:68697836-68697858 ACAAGAGGCCTGGGGTCAGTGGG + Intronic
1128764250 15:70241446-70241468 ACAGGTGGCGAGGGGGGAGTGGG + Intergenic
1128798261 15:70480219-70480241 GCACGCGGCCAGTGGGGAGTGGG + Intergenic
1129388995 15:75211175-75211197 ACTCGTGGCCCCGGGGCAGCTGG - Exonic
1132154171 15:99484088-99484110 TCATGGGGCCGGGGGGCAGTGGG - Intergenic
1132372620 15:101308922-101308944 AGCCGTGGCCTGGGGGCACTGGG - Intronic
1132764040 16:1525475-1525497 ACACGTGGCCAGGGGGCAGTGGG + Intronic
1133161712 16:3916163-3916185 ATACGTAGCCAGGGAGCAGGAGG + Intergenic
1134818585 16:17227189-17227211 ACACCTGGTCATGGGGCAATGGG + Intronic
1137014645 16:35362938-35362960 ACCCATGGGCAGGGGGAAGTTGG + Intergenic
1137305103 16:47191307-47191329 ACATGTGGCCTGCGGGCAGTGGG - Intronic
1138024476 16:53511888-53511910 ACACATGGACAGAGGGCAGCAGG + Intergenic
1138459243 16:57138304-57138326 ACCTGTGGCCATGGGGAAGTGGG - Intronic
1139421058 16:66849793-66849815 ACAGGGGTCTAGGGGGCAGTGGG + Intronic
1141420833 16:83914468-83914490 ACAGCTGGCCAGTGGGGAGTGGG - Intronic
1141669455 16:85484201-85484223 AGACGTGGCCAGGGGCCAGTGGG + Intergenic
1142228525 16:88888786-88888808 ACCCGGGGCCCGGGGCCAGTGGG - Intronic
1142904566 17:3033471-3033493 GCACGTGGCCATGGGGCAGCAGG - Exonic
1144835386 17:18154078-18154100 AAGCAAGGCCAGGGGGCAGTCGG + Intronic
1146948684 17:36891037-36891059 TTATGTGGCCAGGGGGCAGGGGG + Intergenic
1148729986 17:49828197-49828219 ACCTGTGGGCAGTGGGCAGTGGG + Exonic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151319593 17:73344423-73344445 GCACGAGGCCAGGCTGCAGTAGG + Intronic
1151636899 17:75355696-75355718 ACATGTGGCCTGCGGGCTGTGGG + Intronic
1152182043 17:78828540-78828562 ACATGTGGGCTGGGGTCAGTGGG - Intronic
1152735764 17:81996141-81996163 ACACGTGGCAAGTGGGGAGTAGG + Intronic
1152811064 17:82383065-82383087 ACACGGTGCCAGGGGCCGGTCGG + Intergenic
1154099550 18:11457739-11457761 ACACGTGGTCAGGGTGCTCTGGG - Intergenic
1155169689 18:23258183-23258205 ACACGTGGCGGGGTGGCAGACGG - Exonic
1159357762 18:67358841-67358863 ACACGTGGCCTTGGGCCTGTGGG + Intergenic
1160807458 19:998696-998718 ACACCTGGCCAGGGGGCTGGAGG + Intergenic
1160907885 19:1460316-1460338 ACAAGGTGCCCGGGGGCAGTGGG + Exonic
1161000712 19:1909432-1909454 ACAGGTGGACATGAGGCAGTAGG - Intronic
1161008323 19:1947652-1947674 GCACGTGGCCAGGGCCCAGCTGG - Intronic
1163843623 19:19626843-19626865 CCACGCGGCCACGGGGCAGGCGG + Exonic
1165805781 19:38579951-38579973 ACACAGGGCCAGGGGTCAGGGGG - Intronic
1166566234 19:43767214-43767236 CCCCGAGGCCAGGGGGCAGGAGG + Intronic
1167049692 19:47070867-47070889 ACACGGTGCCGTGGGGCAGTGGG - Intronic
926560048 2:14406827-14406849 GTGCGTGGCCAGGGGGCAGGGGG + Intergenic
927317888 2:21706803-21706825 ACATGTGGCCAGAGGGCCATGGG + Intergenic
927427107 2:22993851-22993873 ACACTGGGCCAGGGGTCAGAAGG + Intergenic
930766877 2:55093641-55093663 CCACGAGGCCAGGGGGGATTAGG + Intronic
931177730 2:59870546-59870568 ACACGAGGCCAGGGGGGTCTGGG + Intergenic
931639545 2:64369830-64369852 ACATGTGGCCTGGGGCCTGTGGG + Intergenic
932093034 2:68823641-68823663 ACAGGAGGCCAGGACGCAGTAGG + Intronic
934503225 2:94874585-94874607 AGTTGTGGCCAGGGGGCACTCGG + Intronic
934790471 2:97055593-97055615 CATCGTGTCCAGGGGGCAGTGGG - Intergenic
934815998 2:97326939-97326961 CATCGTGTCCAGGGGGCAGTGGG + Intergenic
934821698 2:97381545-97381567 CATCGTGTCCAGGGGGCAGTGGG - Intergenic
935306761 2:101744390-101744412 ACATGTGGCTAGTGGGCACTTGG - Intronic
938105437 2:128526799-128526821 ACATGTGCACAGGAGGCAGTGGG + Intergenic
938118099 2:128615771-128615793 GCACGAGGCCAAGGGGCAGCAGG - Intergenic
938236497 2:129710389-129710411 AGACATGGCCAGAGGGCAGAGGG + Intergenic
938606168 2:132894893-132894915 ACAGGAGGACAGGGTGCAGTAGG + Intronic
940259619 2:151766334-151766356 CCACATGACCAGGGAGCAGTGGG + Intergenic
944933725 2:204545817-204545839 CCACCTGGCCAGGCGGCAGGTGG - Intronic
945501432 2:210580573-210580595 ACATGTGGGCTGGGTGCAGTGGG + Intronic
1173555632 20:43963471-43963493 TCACGTGGCTTGGAGGCAGTGGG + Intronic
1174455418 20:50645427-50645449 ACACGTAGCCAGGGCGAGGTGGG + Intronic
1174463788 20:50701645-50701667 ACACATGGGATGGGGGCAGTGGG - Intergenic
1175779546 20:61673583-61673605 ACACGTGTCCAGGGCCCAGAAGG + Intronic
1175864014 20:62165004-62165026 ACAGGTGGGCAGGTGGCAGCAGG + Intronic
1176062587 20:63178853-63178875 ACACGTGGCCGGGGGCCGGCTGG - Intergenic
1176134986 20:63518606-63518628 AGCCATGGCCAGGGGCCAGTCGG + Intergenic
1176240925 20:64075510-64075532 GGGGGTGGCCAGGGGGCAGTCGG - Intronic
1176284592 21:5012712-5012734 TCACGTGGGCAGGGGTCAGAGGG - Intergenic
1178525858 21:33328010-33328032 GCACGCGGCCAGTGGGCTGTGGG - Intronic
1178951489 21:36989788-36989810 GCACGCGGCCAGGGGCCCGTGGG + Intronic
1179712318 21:43270409-43270431 ACGCCCGGCCTGGGGGCAGTGGG - Intergenic
1179802027 21:43815539-43815561 GCCCGAGGCCAGGGTGCAGTGGG + Intergenic
1179872589 21:44250763-44250785 TCACGTGGGCAGGGGTCAGAGGG + Intronic
1181349573 22:22245308-22245330 ACACGTGTCCTGGCTGCAGTGGG - Exonic
1182080667 22:27526596-27526618 ACTCATGGCCAGCGGGCAGAAGG + Intergenic
1183009272 22:34931623-34931645 ACACCTGGGCTAGGGGCAGTTGG - Intergenic
1183830795 22:40417517-40417539 ACCAGTGGCCAGGGGGCTGGGGG + Intronic
1184580475 22:45413378-45413400 ACACGTGGCCTGTGGGGTGTGGG - Intronic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
1185195734 22:49468172-49468194 ACACGTGTGCTGGGCGCAGTGGG + Intronic
949597019 3:5558739-5558761 AGACATGGCAGGGGGGCAGTTGG - Intergenic
950680916 3:14584573-14584595 ACACGTGTCCAGTGGGAGGTAGG + Intergenic
953923093 3:46965678-46965700 AAACTTGGCCAGGAGGCGGTGGG + Intronic
953931018 3:47005676-47005698 TGGAGTGGCCAGGGGGCAGTCGG + Intronic
955342982 3:58140012-58140034 AGCAGTGGTCAGGGGGCAGTGGG - Intronic
957301444 3:78397002-78397024 ACTCTTGGGCAGGGGGCAGCAGG + Intergenic
961529805 3:127533530-127533552 ACACTGGCCCAGGTGGCAGTTGG - Intergenic
961552430 3:127676953-127676975 CCAGGCGGCCTGGGGGCAGTGGG - Exonic
962814617 3:138987202-138987224 AGAGGTGGCCAGGGTGCATTTGG - Intergenic
965750114 3:171966915-171966937 ACATGAGGCCAGAGGGCAATAGG + Intergenic
966730881 3:183150463-183150485 TCACATGGGCAGTGGGCAGTGGG + Intronic
968555350 4:1244122-1244144 ACATGTGGCCAGGAGGCTCTGGG - Intronic
968626798 4:1629458-1629480 AGGCCTGGCCAGGGGGCAGTAGG + Intronic
968974544 4:3814363-3814385 TGAGGTGGCCAGGGGGCAGTGGG - Intergenic
969618076 4:8265307-8265329 ACACCTGGTCAGGGAGCAGTGGG + Intergenic
979059836 4:116043794-116043816 GCACGTGGACAGGGTGAAGTTGG + Intergenic
983722835 4:170878681-170878703 ACACGTGGCCTGCGGGCAACAGG - Intergenic
985610700 5:886406-886428 GCACGTGGCCGGTGGGCAGGAGG + Intronic
986580914 5:9264889-9264911 ACATGGGGCGAGGGTGCAGTGGG + Intronic
986776243 5:11016618-11016640 GCAAGTGGCCAGGGGGCTGCAGG + Intronic
1001644337 5:173269116-173269138 ACACCCGGCAAGGTGGCAGTTGG + Intergenic
1001911023 5:175517869-175517891 ACACCTGGCCCTGGGGCAGTGGG - Intronic
1001961869 5:175884429-175884451 GCACGTGGCCCGTGGGGAGTAGG - Intergenic
1002026028 5:176396868-176396890 ACAGGGGGCCAGGGAGCGGTGGG - Intronic
1002103403 5:176868430-176868452 CCAGGTGGCCAGGGGGCCATGGG - Intronic
1002295062 5:178225906-178225928 ACTGGTGCCCAGGGGGCTGTGGG - Intronic
1002842167 6:915590-915612 GCAGGTGGCCAAGGGGCAGCAGG - Intergenic
1002847011 6:955785-955807 ACACAGGGCCAGGGGGCTCTGGG + Intergenic
1003367173 6:5485867-5485889 ACATGTGGCTAGTGGGCACTTGG - Intronic
1004294467 6:14397597-14397619 ACAAGTGGCCAGCGGGTACTGGG + Intergenic
1006457492 6:34140298-34140320 CAACGTGACCAGGGGGCAGTGGG + Intronic
1006841106 6:37028285-37028307 ACACGTGGCCTGGGCGCAGATGG - Exonic
1007075859 6:39065706-39065728 ACACGTGGCCCTGCGGCACTGGG - Exonic
1013222458 6:108091009-108091031 ATATGTTGCCAGGGAGCAGTGGG + Intronic
1014591512 6:123277491-123277513 AGATGTGGTCATGGGGCAGTAGG + Intronic
1014817889 6:125954880-125954902 TTTCGTGGGCAGGGGGCAGTTGG + Intergenic
1016961355 6:149675485-149675507 AGACAAGGCCAGGAGGCAGTAGG + Intronic
1018238411 6:161748975-161748997 ACCCGCCGCCAGGGGGCAGCTGG + Intronic
1019194048 6:170271095-170271117 GCAGATGGCCAGGGGGCAGGCGG + Intergenic
1019368947 7:650796-650818 TCACGTGGCCAGCAGGCAGCAGG + Intronic
1019701152 7:2475594-2475616 ACAGGGGGCCAGTGGGCAGCGGG - Intronic
1020091773 7:5345867-5345889 ACTCTGGGCCAGGGGGCGGTGGG - Intronic
1023979814 7:45062444-45062466 ACACATGGCCATGAGGCACTTGG - Intronic
1033903870 7:146176940-146176962 ACAAGCAGCCAGGAGGCAGTAGG + Intronic
1034458068 7:151182254-151182276 ACACATGGAAATGGGGCAGTGGG + Intronic
1034627338 7:152503627-152503649 CCAGGTGGCCAGGTGGGAGTGGG + Intergenic
1035185574 7:157123310-157123332 GCAAGTGTCCAGGGGGCAGCAGG - Intergenic
1043531525 8:81156540-81156562 ACAACTGGACAGGGGGCAGCTGG + Intergenic
1044011009 8:86994402-86994424 CCACCTGGCCAGGAGACAGTGGG - Intronic
1048048723 8:130797136-130797158 ACATGTGGCCAGTGGGCCGCAGG - Intronic
1048352365 8:133626492-133626514 CCACGTGGCCAGAGGGGAGTAGG + Intergenic
1048442177 8:134468182-134468204 ACACCTGGCCAGGGGCCACCAGG - Intergenic
1049266338 8:141669873-141669895 AGCCGAGGCCAGGGAGCAGTGGG - Intergenic
1049351766 8:142168288-142168310 ACATGTGGCCAGCGTGCAGGTGG + Intergenic
1049622474 8:143604885-143604907 ACAAGTGGCCAGGTGGCTCTGGG - Exonic
1049658282 8:143808497-143808519 CCGGGTGGCCAGGGGCCAGTGGG + Intronic
1050201748 9:3152135-3152157 ACACGGGGCCAGGGGGTGGATGG + Intergenic
1051634112 9:19166137-19166159 ACAGGGGGCCAGGGGGCAGGTGG - Intergenic
1052049191 9:23825555-23825577 AAATGTGGCCAGGGGGGAGTAGG - Intronic
1053055535 9:34991286-34991308 ACACGTGGCCTGTGGGTAGGGGG + Intronic
1056576595 9:87859662-87859684 ACACCTGGCCACGGAGAAGTGGG - Intergenic
1059943070 9:119376808-119376830 CTACATGGCCAGGGGGCATTAGG - Intergenic
1060602885 9:124889744-124889766 ACTGTTGGCCAGGGGGCAGTGGG - Intronic
1060943555 9:127557124-127557146 ACGGGTGGCCAAGGGGCTGTGGG + Intronic
1061049116 9:128183649-128183671 ACAAGGAGCCAGGGGGCTGTGGG + Intronic
1061995680 9:134181580-134181602 ACCCGTGGGCAGGTGGCAGCTGG - Intergenic
1062285240 9:135769933-135769955 CCACGTGGTCTGCGGGCAGTGGG - Exonic
1062453982 9:136627158-136627180 ACACCTGGACTGGGGGCAGGGGG + Intergenic
1185791662 X:2932018-2932040 AAATGGGGCCTGGGGGCAGTAGG + Intergenic
1187670086 X:21658325-21658347 ACAACTGGTCACGGGGCAGTGGG + Exonic
1187980389 X:24750343-24750365 ACAAGTGGCCAGTGAGCACTTGG + Intronic
1189984949 X:46545463-46545485 TCACGTTCCCAGGGGGCTGTGGG - Intergenic