ID: 1132764811

View in Genome Browser
Species Human (GRCh38)
Location 16:1528982-1529004
Sequence CCTGCCCGGGGCTACCATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 118}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132764811_1132764817 4 Left 1132764811 16:1528982-1529004 CCGAGATGGTAGCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1132764817 16:1529009-1529031 GTGCACTTGTGTCTGAGTCTAGG 0: 1
1: 0
2: 1
3: 17
4: 246
1132764811_1132764819 6 Left 1132764811 16:1528982-1529004 CCGAGATGGTAGCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1132764819 16:1529011-1529033 GCACTTGTGTCTGAGTCTAGGGG 0: 1
1: 0
2: 1
3: 13
4: 106
1132764811_1132764825 30 Left 1132764811 16:1528982-1529004 CCGAGATGGTAGCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1132764825 16:1529035-1529057 TGGACGCAGGTTCCTGGGATGGG 0: 1
1: 0
2: 0
3: 14
4: 135
1132764811_1132764820 10 Left 1132764811 16:1528982-1529004 CCGAGATGGTAGCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1132764820 16:1529015-1529037 TTGTGTCTGAGTCTAGGGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 208
1132764811_1132764821 17 Left 1132764811 16:1528982-1529004 CCGAGATGGTAGCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1132764821 16:1529022-1529044 TGAGTCTAGGGGCTGGACGCAGG 0: 1
1: 0
2: 0
3: 15
4: 149
1132764811_1132764818 5 Left 1132764811 16:1528982-1529004 CCGAGATGGTAGCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1132764818 16:1529010-1529032 TGCACTTGTGTCTGAGTCTAGGG 0: 1
1: 0
2: 2
3: 13
4: 172
1132764811_1132764824 29 Left 1132764811 16:1528982-1529004 CCGAGATGGTAGCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1132764824 16:1529034-1529056 CTGGACGCAGGTTCCTGGGATGG 0: 1
1: 0
2: 1
3: 18
4: 184
1132764811_1132764822 24 Left 1132764811 16:1528982-1529004 CCGAGATGGTAGCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1132764822 16:1529029-1529051 AGGGGCTGGACGCAGGTTCCTGG 0: 1
1: 0
2: 3
3: 29
4: 258
1132764811_1132764823 25 Left 1132764811 16:1528982-1529004 CCGAGATGGTAGCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1132764823 16:1529030-1529052 GGGGCTGGACGCAGGTTCCTGGG 0: 1
1: 0
2: 1
3: 31
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132764811 Original CRISPR CCTGCCCGGGGCTACCATCT CGG (reversed) Intronic
900351870 1:2238851-2238873 CCTGCCCCAGGCTGCCTTCTGGG + Intronic
900612887 1:3551821-3551843 CCTGCCCGAGGCCACCCTCTGGG + Intronic
902172762 1:14626499-14626521 CTTGCCCGGGGTTACCATCCCGG + Intronic
904664337 1:32108369-32108391 CCTGCCCGAGGCCACCATGTGGG - Intronic
905174796 1:36128447-36128469 CCTGCCAGGGGCTTCCACCTTGG + Intergenic
912530465 1:110317308-110317330 ACTGCCCGGAGCCACCATCAAGG - Intergenic
912549788 1:110477838-110477860 ACTTCCCGGGGCTACCACCAGGG + Intergenic
913159637 1:116133360-116133382 CCAGGCCGGGGCAACCATCAGGG - Exonic
915552606 1:156644084-156644106 ACTGCACGGGGCTACCCTCTTGG + Intronic
919520836 1:198584418-198584440 TCTGCCCGGCGCCCCCATCTGGG - Intergenic
922580761 1:226696052-226696074 CTTGCCCGGGGCACCCAGCTTGG + Intronic
1064164439 10:12974254-12974276 CCTGCCTGGAGTTTCCATCTAGG + Intronic
1065092933 10:22252783-22252805 CCTGCGCGGGGCCACTCTCTGGG + Intergenic
1068902994 10:62290874-62290896 CCTGCCTGGGGCCACTAACTAGG - Intergenic
1069314756 10:67083361-67083383 CTTTCTTGGGGCTACCATCTAGG + Intronic
1070518451 10:77229583-77229605 CCTGCCCAAGGCTACCTTCCTGG + Intronic
1070646048 10:78203209-78203231 CCTGCTCCGGCCTCCCATCTTGG - Intergenic
1071574676 10:86716585-86716607 CTTGCCCGGGGCAAACTTCTGGG - Exonic
1074703130 10:116109749-116109771 CCTGGCCGGGACGACCATCATGG + Intronic
1075283303 10:121160162-121160184 CCTGGATGAGGCTACCATCTTGG - Intergenic
1075420671 10:122298247-122298269 CCTGCCCAGGGGAACCAGCTGGG + Intronic
1076833444 10:133008296-133008318 CCGGCACTGGGCCACCATCTGGG + Intergenic
1077036215 11:495729-495751 CCTGCCAGGGGACACCATCCTGG - Intronic
1077200089 11:1302394-1302416 CCTCCACGGGGCTCCCCTCTTGG - Intronic
1077243353 11:1523670-1523692 CCTGCCCTGGGCTAACACCAGGG - Intergenic
1083186246 11:61019523-61019545 CCTCCCTGGGGCTGCTATCTGGG - Exonic
1083764762 11:64836465-64836487 CCTGACCTGGGCTACCAGCTGGG + Exonic
1083826031 11:65204672-65204694 CCTGCCCGCAGCCACCTTCTGGG + Exonic
1087426809 11:97998845-97998867 CCTGCCTCAGGCTACCAACTAGG + Intergenic
1088836236 11:113580014-113580036 CCTGCCTGAAGCTACCAGCTGGG - Intergenic
1090183178 11:124718501-124718523 CCTGCCCGGGGCGAGGCTCTGGG - Intergenic
1092769063 12:11880472-11880494 CCTGCACTGGGCTGCCATGTTGG - Intronic
1103339967 12:120215999-120216021 ACTGCCCCGGGCTCCCATCGAGG - Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1103901192 12:124304352-124304374 CCTGCCCAGCGCTTCCAGCTTGG + Intronic
1110326690 13:74224283-74224305 CAGGCCCTGGGCTACCTTCTGGG + Intergenic
1113530391 13:111020338-111020360 CCTGCACGGGGCTTCCTCCTAGG + Intergenic
1119692723 14:76689983-76690005 CCTGCCCTGGGCTTCTTTCTGGG + Intergenic
1122157579 14:99759443-99759465 CCGGCCCGGGGCTGCCCTCCAGG - Intronic
1123113168 14:105882360-105882382 CCTGCCTGGGGCTCCCACCGTGG - Intergenic
1123115518 14:105892512-105892534 CCTGCCTGGGGCTCCCACCGTGG - Intergenic
1125028769 15:35055816-35055838 TTTGCCCTGGGCTACCATCCTGG - Intergenic
1125210289 15:37206902-37206924 CCTGGCCAGGTTTACCATCTAGG + Intergenic
1127704823 15:61536342-61536364 CATGCCTAAGGCTACCATCTAGG + Intergenic
1129450131 15:75647112-75647134 CCTGCCCTGGGCGACTAGCTTGG - Intronic
1129661810 15:77556961-77556983 CCTCTCCTGGGCTCCCATCTTGG - Intergenic
1132764811 16:1528982-1529004 CCTGCCCGGGGCTACCATCTCGG - Intronic
1134254928 16:12602964-12602986 CCAGCCCAGGGCTCCCATGTAGG + Intergenic
1135149603 16:19993949-19993971 CCTGCGCGTGACTATCATCTGGG - Intergenic
1135716993 16:24779914-24779936 CCAGCCCTGGGCTGCCATTTTGG + Intronic
1136105193 16:28025328-28025350 CCTGCCCAGAGTTGCCATCTGGG - Intronic
1138530096 16:57630183-57630205 GCTGCCCGGGGCTATCCTCTGGG - Intronic
1141590095 16:85062755-85062777 CCAGCCCGGTGCTACCATTTGGG - Intronic
1141665991 16:85465370-85465392 CCAGGCCTGGGCTCCCATCTGGG + Intergenic
1142260931 16:89042120-89042142 CCTCCCCGGGCCTCCCATCCTGG + Intergenic
1143010713 17:3864897-3864919 CCTGTCCGGGACCACCATGTTGG - Intronic
1144958088 17:19029688-19029710 CCAGACTGGGGCTACCCTCTGGG + Intronic
1144977070 17:19144832-19144854 CCAGACTGGGGCTACCCTCTGGG - Intronic
1145236408 17:21211369-21211391 CCGGCCTGTGGCTACCATATTGG - Intronic
1145303676 17:21657371-21657393 CCTGCCGAGGGCAATCATCTCGG - Intergenic
1145346368 17:22044478-22044500 CCTGCCGAGGGCGATCATCTCGG + Intergenic
1146951914 17:36912783-36912805 CCTGGCTGGGTCTGCCATCTGGG + Intergenic
1152388197 17:79987645-79987667 CCAGCCAGGGGCTACCTTCATGG - Intronic
1155589109 18:27404696-27404718 CCTGCCCTGGTCTCCAATCTGGG + Intergenic
1158233963 18:55291717-55291739 CCTGCCCGGGGCAAACTTTTAGG + Intronic
1159001322 18:62978057-62978079 CCTGCCCAGGCCTACTACCTGGG + Intronic
1160404781 18:78638004-78638026 CCTGACCGTGGCCACCCTCTCGG + Intergenic
1161510912 19:4670458-4670480 ACCGCCCGGGGCCACCATCTTGG + Intergenic
1163516025 19:17764366-17764388 CCTCCCCAGGGCCACCATCGAGG + Exonic
1164137604 19:22428193-22428215 CCTGGGCCGGGCTACCAGCTGGG + Intronic
1164616121 19:29667659-29667681 ACTTTCCAGGGCTACCATCTTGG + Intronic
1167687213 19:50963802-50963824 CTTTCCCACGGCTACCATCTTGG + Intronic
1168177275 19:54634440-54634462 CCTGCCCGGGGCCCCCAGCCAGG - Intronic
1168516426 19:57013351-57013373 CCTTCCAGGGGATACCATCCAGG + Intergenic
928081671 2:28317538-28317560 GCTGCCCTGGGCTTCCATGTGGG - Intronic
932747936 2:74350026-74350048 CGTGCCTTGGGCTGCCATCTTGG - Intronic
934166163 2:89296228-89296250 CCTGCCCGGGGCTAAGACCCAGG + Intergenic
934201112 2:89886228-89886250 CCTGCCCGGGGCTAAGACCCAGG - Intergenic
939909496 2:147962870-147962892 CCTGCCAGGGGTAACCTTCTGGG - Intronic
945215976 2:207434464-207434486 GCTGCCCGGGGCTGGAATCTTGG - Intergenic
946024084 2:216661460-216661482 CCTGCCCAGCTCTGCCATCTTGG + Intronic
948534384 2:238635177-238635199 CCTTGCTGAGGCTACCATCTTGG + Intergenic
1171521198 20:25775056-25775078 CCTGCCCAGGGCAATCTTCTGGG - Exonic
1173900370 20:46583388-46583410 CCTGTCCTGGACTACCACCTGGG + Intronic
1176103106 20:63373403-63373425 CCGGCACGGGGCTTCCCTCTGGG - Intronic
1179902628 21:44401925-44401947 CCAGCCCGGGGCCACCCACTTGG + Intronic
1182910001 22:33975326-33975348 CCTACTGGGGGCTACCATTTTGG - Intergenic
1184370422 22:44078427-44078449 CCTGGCCAGGGTTACCATGTCGG + Intronic
1184473351 22:44707941-44707963 CCTGCACGAGGCTGGCATCTTGG - Intronic
1184824897 22:46943210-46943232 CCTCCCCGCGGCATCCATCTCGG + Intronic
1184858147 22:47157769-47157791 ACTGTCCTGGGCCACCATCTGGG - Intronic
950017056 3:9761668-9761690 ACTGCCCGGGTCCTCCATCTTGG + Exonic
950466818 3:13160748-13160770 CCTGCCCAGGGCTCCCAGCAAGG + Intergenic
954648440 3:52145295-52145317 CCTTCCAAGGGCTACCATCCTGG + Intronic
961059612 3:123817429-123817451 CCTGCCCAGGGTTCCCCTCTGGG + Intronic
964034239 3:152176837-152176859 CCTGCCCTGGGATAAAATCTTGG + Intergenic
968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG + Intronic
978822993 4:112987354-112987376 CCTGCCCGTGTCTCCCAGCTGGG - Intronic
984070865 4:175110168-175110190 CCTGCCTGGGTCCACCATGTTGG + Intergenic
985827367 5:2202675-2202697 CCTGCCCTGGGCACCCATCAGGG - Intergenic
990597949 5:57330047-57330069 CATGCAAGGGGCTACGATCTGGG - Intergenic
998583905 5:143405452-143405474 CGTCCCCGCGGCCACCATCTTGG + Intronic
1003080155 6:3015268-3015290 CCTGCCCAGGGCCAGCATCAGGG + Intronic
1005051741 6:21690657-21690679 GCTGCCAGTGGCTACCATATTGG + Intergenic
1013927194 6:115487643-115487665 CGTGCCCTGGGGTACCATCAAGG - Intergenic
1017085630 6:150710385-150710407 CCTGCCCGGCATTTCCATCTGGG - Intronic
1019162279 6:170076593-170076615 CCTGCCCTGGGCTCCCTGCTGGG + Intergenic
1019260575 7:79706-79728 CCTCACCGGGCTTACCATCTAGG + Intergenic
1019340967 7:508774-508796 CCTCCCTGGGGCTCCCATCTGGG - Intronic
1019472336 7:1227566-1227588 GAGGCCTGGGGCTACCATCTTGG + Intergenic
1019724416 7:2593275-2593297 CCAGCCCGGGACTAACCTCTTGG + Intronic
1020073559 7:5243119-5243141 CCTGCCCTGTGCCACCAGCTGGG - Intergenic
1023640636 7:42253465-42253487 CCAGCCTGAGGCTACCAGCTTGG + Intergenic
1029375294 7:100173834-100173856 CCTGACTGGGGCAACTATCTGGG - Exonic
1036003320 8:4633092-4633114 CCTGCCCCAGGCTCCCCTCTCGG - Intronic
1037327111 8:17703515-17703537 CCTGCCTGGGACTACTAACTGGG - Intronic
1037947152 8:22996753-22996775 CCTGCCGGGTGCTAACAGCTGGG + Intronic
1041244992 8:55880636-55880658 CCTGCCCGGGGCCACCAGGGAGG - Intronic
1047581851 8:126224405-126224427 CCTGACCTGGGCTACCATCGGGG + Intergenic
1048833440 8:138497314-138497336 CCCGCCCCGGGCTCCCATCAGGG - Intergenic
1056312941 9:85359366-85359388 CCTGCCCCCGTCCACCATCTTGG + Intergenic
1056466062 9:86856392-86856414 TCTGCCCCAGGCTGCCATCTTGG + Intergenic
1057200931 9:93139676-93139698 CATGCCCCGGGCAACCACCTGGG - Intergenic
1060051974 9:120384248-120384270 CCTGCCCAGTGCTGCCCTCTCGG + Intergenic
1060735848 9:126066225-126066247 CCAGCCAGGGGGCACCATCTGGG + Intergenic
1061873752 9:133534044-133534066 CCTGCCAGGGGCTGCCAAGTTGG + Intronic
1062057884 9:134478013-134478035 CCTGCACGGGGCTCCCATGGGGG + Intergenic
1062491399 9:136806860-136806882 CCAGCCCGGGGCTACCTCCTCGG - Exonic
1062681901 9:137786703-137786725 TCTCCCCTGGGCTCCCATCTTGG + Intronic
1062744111 9:138200684-138200706 CCTCACCGGGCTTACCATCTAGG - Intergenic
1191791381 X:64975866-64975888 GCTGCCAGGGGCTGCCAACTGGG - Intronic