ID: 1132765524

View in Genome Browser
Species Human (GRCh38)
Location 16:1532453-1532475
Sequence GTATATCCACAGGTGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132765524_1132765531 23 Left 1132765524 16:1532453-1532475 CCTTGCTTCACCTGTGGATATAC 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1132765531 16:1532499-1532521 TGGAGACTGGTCCCAGGAAGTGG 0: 1
1: 0
2: 2
3: 28
4: 345
1132765524_1132765526 3 Left 1132765524 16:1532453-1532475 CCTTGCTTCACCTGTGGATATAC 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1132765526 16:1532479-1532501 GCCACATGCCAACGTGTGAATGG 0: 1
1: 0
2: 0
3: 6
4: 76
1132765524_1132765528 10 Left 1132765524 16:1532453-1532475 CCTTGCTTCACCTGTGGATATAC 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1132765528 16:1532486-1532508 GCCAACGTGTGAATGGAGACTGG 0: 1
1: 0
2: 1
3: 5
4: 140
1132765524_1132765530 17 Left 1132765524 16:1532453-1532475 CCTTGCTTCACCTGTGGATATAC 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1132765530 16:1532493-1532515 TGTGAATGGAGACTGGTCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132765524 Original CRISPR GTATATCCACAGGTGAAGCA AGG (reversed) Intronic
904951648 1:34245982-34246004 GGACATCAAAAGGTGAAGCAGGG - Intergenic
908102808 1:60808718-60808740 CTAAATCCACAGGTGGGGCAAGG + Intergenic
913229863 1:116732815-116732837 ATATGTCAAAAGGTGAAGCAGGG + Intergenic
915658985 1:157385975-157385997 GTATATTCACAGATGCAGAAAGG + Intergenic
919005778 1:191897502-191897524 ATATATCGAAAGGTAAAGCAGGG + Intergenic
920422287 1:205843290-205843312 GTATATCCATATGGAAAGCAAGG - Intronic
921342264 1:214145979-214146001 GTATATTCAAAAGTGAATCAAGG + Intergenic
921671447 1:217928243-217928265 GGATTTACACAGGTGAAGGAAGG + Intergenic
922707833 1:227799179-227799201 AGATATCAAAAGGTGAAGCAGGG - Intergenic
923306973 1:232697341-232697363 GTGTGTCCACAGCTGAAGTACGG + Intergenic
924418063 1:243880127-243880149 GTATTTCCACAGGTTAAAAATGG - Intergenic
1063991421 10:11568465-11568487 ATATATCCTAAGGTGAAACACGG - Intronic
1064341434 10:14489131-14489153 ATACATCAAAAGGTGAAGCAGGG - Intergenic
1066705380 10:38172209-38172231 GTATATCAAAAAGTGAAACACGG - Intergenic
1069309621 10:67018060-67018082 ATATATCCACAGGCCAGGCATGG - Intronic
1074286569 10:112103357-112103379 GAATCTCCACAGGTGAGGGATGG + Intergenic
1076133036 10:128026884-128026906 GTATATTCACACTTGAAGCTTGG + Intronic
1078233003 11:9459995-9460017 GTATATCCAAAGGTTTAGAAAGG + Intergenic
1081256243 11:40899230-40899252 GTAGATGCACAGCTGAAGAAAGG - Intronic
1081953084 11:47062978-47063000 GAATGTCAGCAGGTGAAGCAGGG - Intronic
1084022831 11:66428013-66428035 GTTTCTCCACAAGTGAAGCAGGG + Intergenic
1085251419 11:75146454-75146476 ATACATCAAAAGGTGAAGCAAGG - Intronic
1085819936 11:79781405-79781427 GTATAGCAAAATGTGAAGCATGG - Intergenic
1085940151 11:81198548-81198570 GAATGTTCACAGGTGAAGAAAGG + Intergenic
1085965032 11:81513165-81513187 TTTTAGCCACAGCTGAAGCAGGG - Intergenic
1090629767 11:128635987-128636009 GCGGAGCCACAGGTGAAGCAGGG + Intergenic
1094206169 12:27843268-27843290 GAATAACCGTAGGTGAAGCATGG + Intergenic
1097321824 12:58234070-58234092 GTATATCAACAGGTGGAGGTGGG - Intergenic
1098114058 12:67155817-67155839 ATATGTCCAAAGGGGAAGCAGGG + Intergenic
1098796335 12:74893062-74893084 TTATTTCACCAGGTGAAGCAGGG + Intergenic
1100436232 12:94573827-94573849 GGAGATCCACGGGTGAAGAAGGG - Intronic
1100763986 12:97843287-97843309 TTATACCCAAGGGTGAAGCAAGG + Intergenic
1107403108 13:40088216-40088238 GAAAATCTACAGGTGAAGGACGG + Intergenic
1107683693 13:42875814-42875836 ATATGTCAAAAGGTGAAGCAGGG + Intergenic
1112215414 13:97425885-97425907 ATATGTCAAAAGGTGAAGCAGGG - Intergenic
1112243514 13:97705976-97705998 ATATGTCAAAAGGTGAAGCAGGG - Intergenic
1114752861 14:25225142-25225164 GTAAATCAACAGGTTAAGTAAGG + Intergenic
1115402376 14:32976867-32976889 GTCTATTCACAGCTGAAGCGAGG - Intronic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1120098559 14:80418084-80418106 TTATATCCACACTTGAAGCCAGG - Intergenic
1120792097 14:88593634-88593656 GTTTTTCCACAGGTGATGCTGGG + Intronic
1120910149 14:89658935-89658957 GTATATCCACCAGTGGGGCAGGG + Intergenic
1127615146 15:60677222-60677244 GTATATCCGCAGGGCAGGCATGG - Intronic
1132765524 16:1532453-1532475 GTATATCCACAGGTGAAGCAAGG - Intronic
1137748370 16:50840402-50840424 GTATCTCCCTAGGGGAAGCAGGG + Intergenic
1138218403 16:55226285-55226307 GCATTTCCTCATGTGAAGCAAGG + Intergenic
1144388311 17:14770545-14770567 GTAGATCAACAGGTAAAGAAAGG - Intergenic
1150711318 17:67532939-67532961 GTATCTCAACAGGTGAGTCATGG + Exonic
1153043331 18:834191-834213 ATACATCAAAAGGTGAAGCAGGG + Intergenic
1153422941 18:4928744-4928766 ATATATTCACAGGGGAAACATGG - Intergenic
1157253762 18:46119369-46119391 GTATAAGCACTGGGGAAGCAGGG + Intronic
1158927193 18:62279733-62279755 GGGTATTCACAGGTGATGCACGG - Intronic
1159822530 18:73164350-73164372 GTACATCAAAGGGTGAAGCAGGG + Intronic
1159854581 18:73569518-73569540 ATACATCAAAAGGTGAAGCAGGG - Intergenic
1164201725 19:23024654-23024676 GCATATCCAGAGTTCAAGCAGGG + Intergenic
1167779055 19:51584171-51584193 GTGTATCAACATGGGAAGCATGG + Intronic
927398187 2:22680162-22680184 GTAGATTCACAGGCGAAGCAGGG - Intergenic
928940962 2:36726999-36727021 GTATATCAATAGGTGAAGAAGGG - Intronic
929941268 2:46335818-46335840 GGATATCCAGAGGTGACGCTGGG + Intronic
930357028 2:50333993-50334015 GGACATCCACAAGTGAAGGATGG + Intronic
932851665 2:75193535-75193557 GTGAATTCACAGGTGAATCAGGG - Intronic
935619210 2:105113946-105113968 ATATGTCAAAAGGTGAAGCAGGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936591571 2:113809380-113809402 TTATGTCAAAAGGTGAAGCACGG - Intergenic
944006950 2:194921120-194921142 CTACATCAAAAGGTGAAGCAGGG - Intergenic
946033299 2:216722215-216722237 TTAAAACCACAGGTTAAGCAGGG - Intergenic
946831078 2:223728618-223728640 GTAAATCCCCAGATGAAGCATGG + Intergenic
946964528 2:225023646-225023668 GTATTTCTAAAGTTGAAGCAGGG + Intronic
948681689 2:239639488-239639510 GTACATCCAAAGGTGAAGCAGGG - Intergenic
1172386679 20:34538890-34538912 GTAAATCCACAGGTGGAGTGGGG - Intronic
1175790336 20:61736690-61736712 GGATATGCACAGCTGAAGAAGGG - Intronic
1178431700 21:32523400-32523422 GAATTTCCAAAGGTGAAGGAAGG + Intergenic
1179529284 21:42007992-42008014 GTATATCCTCAGGTCCAGCATGG + Intronic
1180041055 21:45280352-45280374 GTAGATCCACAGCTGAAGATGGG - Intronic
1180162644 21:46005247-46005269 CTCTGTCCACAGGTGCAGCATGG - Intergenic
949144556 3:681839-681861 GGATATTCACAGTTGAAACAGGG - Intergenic
949821878 3:8124503-8124525 ATACATCAAAAGGTGAAGCAGGG + Intergenic
952950839 3:38523656-38523678 ATATAACCCCAGGTGAGGCACGG - Intronic
953028207 3:39157385-39157407 GTATATACCCAGGAGAAACAAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
958076138 3:88681115-88681137 ATATATCTAGAGATGAAGCAAGG + Intergenic
958145599 3:89620583-89620605 CTGTATTCACAGGTGTAGCAAGG - Intergenic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
962180500 3:133201167-133201189 GTATATCCACAGCTTAAGCCTGG + Intronic
965239422 3:166175961-166175983 ATATTTCCACAGGTGAAACAAGG + Intergenic
966394499 3:179488244-179488266 GTATGTCAAAAGATGAAGCAGGG - Intergenic
967240984 3:187439415-187439437 GTAAGTACACAGGTCAAGCAAGG - Intergenic
967749495 3:193097703-193097725 CTATATCCAAGGATGAAGCAGGG - Intergenic
969435536 4:7187072-7187094 GTGTATCCACATGTGGAGGAAGG - Intergenic
970045423 4:11847558-11847580 GTATATCCACAGGAACAGGAGGG + Intergenic
978106767 4:104912024-104912046 GTATATACAGTGGTGGAGCAGGG + Intergenic
979826986 4:125249933-125249955 GGATTTCTACAGGTAAAGCATGG + Intergenic
981330134 4:143498747-143498769 GTCTATCCTCAGGTGAAGGAAGG + Intergenic
983290844 4:165802602-165802624 TTATCTACACATGTGAAGCATGG + Intergenic
986086282 5:4453493-4453515 GTATATCCAGGAGTGCAGCAAGG - Intergenic
987035250 5:14012807-14012829 GTTTTTCCACAGGTGGGGCAGGG + Intergenic
987159018 5:15120727-15120749 GTATATCCACAGTTTAAGGCAGG - Intergenic
991724970 5:69526974-69526996 GTACATCAAAAGGTGAAGCAGGG + Intronic
992142726 5:73815733-73815755 TTAAATCCAAAGTTGAAGCATGG + Intronic
994685844 5:102950778-102950800 GTGTATTCACTGGTGAAGGAAGG + Exonic
995682058 5:114731278-114731300 GCATTTCAACACGTGAAGCAGGG + Intergenic
999016639 5:148113496-148113518 ATATAACCACAGGTAAAGCAAGG - Intronic
1002342417 5:178525838-178525860 ATGTATCCACAGGCAAAGCACGG + Intronic
1003455459 6:6277726-6277748 ATACATCAAAAGGTGAAGCAGGG - Intronic
1005591013 6:27327337-27327359 ATATGTCAAAAGGTGAAGCAGGG - Intergenic
1006726622 6:36203745-36203767 GGTTATCCACAGGGTAAGCAAGG - Intronic
1008393368 6:50978826-50978848 GTGTATCAATAGGTGAAGCTGGG + Intergenic
1008674196 6:53802190-53802212 GTCTATGCAGAGGTGAAGTATGG + Intronic
1009941691 6:70296938-70296960 GTATATCTATAGTTGAAGCCTGG - Intronic
1011090113 6:83588536-83588558 GTATATGGACAGGTCCAGCAGGG - Intronic
1011165630 6:84442782-84442804 GAAAATCCATAGGAGAAGCACGG + Intergenic
1014620221 6:123658481-123658503 GTAGATCCACAGGGGAAGAATGG + Intergenic
1014758177 6:125325030-125325052 AAATCTCCACGGGTGAAGCAAGG + Intergenic
1018583906 6:165334786-165334808 TTATATCCACAGGAGCAGGAAGG + Intronic
1022326965 7:29341208-29341230 GTACCTCCACACGTGAAGGAGGG - Intronic
1023338647 7:39196198-39196220 GTAGATCTACAGCTGAAGAAAGG + Intronic
1023674620 7:42616855-42616877 GTGGGGCCACAGGTGAAGCAGGG + Intergenic
1024358403 7:48442787-48442809 GTATCTCCAGATGTGATGCATGG - Intronic
1027738453 7:81966500-81966522 GTATATCTCCAAGGGAAGCAGGG - Intronic
1030313296 7:108089367-108089389 GTATAGTCACAGGTACAGCAGGG - Intronic
1031073483 7:117189560-117189582 GTATATCCTCAGGTAATGTAAGG + Intronic
1032285367 7:130535410-130535432 GGACAGCCACAGGTGAAGCGAGG + Intronic
1032668430 7:134061709-134061731 GTAGATGCACAGGTGATGGAGGG - Intronic
1039759512 8:40559279-40559301 GTATGTGAAGAGGTGAAGCAGGG - Intronic
1043110429 8:76172921-76172943 GTGTAGCCACAGGAGAGGCAGGG - Intergenic
1043881118 8:85544332-85544354 GTATATTCACAGGTGCTGAAGGG + Intergenic
1044938746 8:97319104-97319126 GTGTATCCACATGTGAGCCAGGG + Intergenic
1044938864 8:97320024-97320046 GTGTATCCACATGTGAGCCAGGG + Intergenic
1047483579 8:125308008-125308030 CTGTTTCCACAGGGGAAGCAGGG - Intronic
1047954530 8:129963382-129963404 GGCTATACACAGATGAAGCAAGG + Intronic
1057455638 9:95207443-95207465 TTATTTGCACAGGTTAAGCAAGG + Intronic
1057644738 9:96862550-96862572 GTATATTTACAAGTGAAGCGAGG + Intronic
1059708169 9:116842909-116842931 GTGTAGGCAGAGGTGAAGCAGGG - Intronic
1186346967 X:8703595-8703617 GAAAAGCCACAGGTGAAGAAAGG + Intronic
1187077448 X:15949035-15949057 TTATAGCCACTGATGAAGCAGGG + Intergenic
1192815383 X:74585120-74585142 GTATATATACAGGGCAAGCAAGG + Intergenic
1201419933 Y:13787408-13787430 GTAAAGCCACAGGTGAAGAAAGG - Intergenic
1202278634 Y:23152536-23152558 CTATATCCACAAATGAAGAAGGG + Intronic
1202286104 Y:23249073-23249095 CTATATCCACAAATGAAGAAGGG - Intronic
1202286569 Y:23256228-23256250 CTATATCCACAAATGAAGAAGGG - Intronic
1202431458 Y:24783876-24783898 CTATATCCACAAATGAAGAAGGG + Intronic
1202431761 Y:24788633-24788655 CTATATCCACAAATGAAGAAGGG + Intronic
1202432064 Y:24793389-24793411 CTATATCCACAAATGAAGAAGGG + Intronic
1202438204 Y:24869529-24869551 CTATATCCACAAATGAAGAAGGG - Intronic
1202438507 Y:24874286-24874308 CTATATCCACAAATGAAGAAGGG - Intronic