ID: 1132771439

View in Genome Browser
Species Human (GRCh38)
Location 16:1565619-1565641
Sequence CCTGGCTCACGCAGGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 10, 3: 25, 4: 288}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132771427_1132771439 3 Left 1132771427 16:1565593-1565615 CCCGTCCTGCTTTCCTGCCCTGC 0: 1
1: 0
2: 8
3: 85
4: 728
Right 1132771439 16:1565619-1565641 CCTGGCTCACGCAGGCTGGGCGG 0: 1
1: 0
2: 10
3: 25
4: 288
1132771432_1132771439 -10 Left 1132771432 16:1565606-1565628 CCTGCCCTGCAGGCCTGGCTCAC 0: 1
1: 0
2: 2
3: 44
4: 523
Right 1132771439 16:1565619-1565641 CCTGGCTCACGCAGGCTGGGCGG 0: 1
1: 0
2: 10
3: 25
4: 288
1132771430_1132771439 -2 Left 1132771430 16:1565598-1565620 CCTGCTTTCCTGCCCTGCAGGCC 0: 1
1: 0
2: 7
3: 52
4: 477
Right 1132771439 16:1565619-1565641 CCTGGCTCACGCAGGCTGGGCGG 0: 1
1: 0
2: 10
3: 25
4: 288
1132771428_1132771439 2 Left 1132771428 16:1565594-1565616 CCGTCCTGCTTTCCTGCCCTGCA 0: 1
1: 0
2: 10
3: 133
4: 1403
Right 1132771439 16:1565619-1565641 CCTGGCTCACGCAGGCTGGGCGG 0: 1
1: 0
2: 10
3: 25
4: 288
1132771426_1132771439 11 Left 1132771426 16:1565585-1565607 CCAGGGTGCCCGTCCTGCTTTCC 0: 1
1: 0
2: 2
3: 18
4: 314
Right 1132771439 16:1565619-1565641 CCTGGCTCACGCAGGCTGGGCGG 0: 1
1: 0
2: 10
3: 25
4: 288
1132771424_1132771439 13 Left 1132771424 16:1565583-1565605 CCCCAGGGTGCCCGTCCTGCTTT 0: 1
1: 0
2: 1
3: 11
4: 144
Right 1132771439 16:1565619-1565641 CCTGGCTCACGCAGGCTGGGCGG 0: 1
1: 0
2: 10
3: 25
4: 288
1132771425_1132771439 12 Left 1132771425 16:1565584-1565606 CCCAGGGTGCCCGTCCTGCTTTC 0: 1
1: 0
2: 2
3: 10
4: 139
Right 1132771439 16:1565619-1565641 CCTGGCTCACGCAGGCTGGGCGG 0: 1
1: 0
2: 10
3: 25
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132771439 Original CRISPR CCTGGCTCACGCAGGCTGGG CGG Intronic
900142974 1:1146215-1146237 CATGGCACTCCCAGGCTGGGGGG - Intergenic
900316789 1:2060941-2060963 CCTGGAGCACGCACCCTGGGAGG + Intronic
900344354 1:2204026-2204048 GCTGGCTCTCCCAGGCTGGAGGG - Intronic
900431644 1:2605667-2605689 CCTGCCTCAGCCAGGCTGCGGGG - Intronic
900604283 1:3516886-3516908 CCTGGCACGTGCAGGCTGTGGGG + Intronic
900614262 1:3557543-3557565 TCTGGCTACCGCAGGCTGGCAGG - Intronic
901023515 1:6267171-6267193 CCTGGCTCCTGTGGGCTGGGTGG - Intronic
902477792 1:16697291-16697313 CCTGGCTCAGCCCGGCTGGGTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
905242484 1:36589832-36589854 CCTGGCTCACCCTGCCTGGATGG + Intergenic
905456621 1:38092526-38092548 CCCAGCTCACAGAGGCTGGGAGG + Intergenic
905504740 1:38468656-38468678 CCTGGCTCTCAAGGGCTGGGAGG - Intergenic
905702182 1:40025802-40025824 CCTGGCTGACTGAGGCTGGAAGG - Intergenic
907410907 1:54282622-54282644 CCGTGCTCACACAGGCGGGGCGG + Intronic
907945972 1:59137086-59137108 CGTGGTTCAGGCAGGCTGAGAGG + Intergenic
908543996 1:65147461-65147483 CGTGGGCCAGGCAGGCTGGGTGG + Intergenic
911076327 1:93879012-93879034 CCGCGCTCAGGCAGGCGGGGCGG - Intronic
912693015 1:111818777-111818799 CCTGGCTCAAGCTGGCTGACAGG + Intronic
913369926 1:118086959-118086981 GATGGCTCCCGCAGACTGGGTGG + Exonic
915586469 1:156846399-156846421 CCTGGCCCACAGAGGCTGGAAGG - Intronic
915828876 1:159106271-159106293 CCTGGCTCCCACAGGCTCTGTGG + Intronic
917105332 1:171485828-171485850 CCTGGCGCCCGGAGGCTAGGGGG + Intronic
919898243 1:202023260-202023282 CCTGGGTCACTGAGGCTGGCAGG - Intergenic
920033108 1:203049001-203049023 CCCGGCCCTCCCAGGCTGGGCGG - Intronic
921295054 1:213693604-213693626 CCTTCCTCAGGCAGGCAGGGTGG - Intergenic
921511284 1:216033804-216033826 CCTGTGTCACCCAGGCTGGATGG - Intronic
922792770 1:228319205-228319227 CCTACCTCAAGAAGGCTGGGAGG + Exonic
922801030 1:228364881-228364903 CCTGCCACAGGCAGGGTGGGTGG - Intronic
923003588 1:230027478-230027500 CCTGGCTCAGGCAGGCCTGGAGG - Intergenic
923327906 1:232897108-232897130 CCAGGCTCACACAGACAGGGAGG + Intergenic
924746228 1:246835827-246835849 ACTGTGTCACCCAGGCTGGGGGG - Intergenic
924823108 1:247513358-247513380 CCTGGGTCACTCAGGCTTGGTGG - Intronic
1063205344 10:3826011-3826033 CGTGGCTCCCCCAGGCTGTGAGG - Intergenic
1063612196 10:7572142-7572164 TCTGTCTCCCGCAGGCTGTGCGG + Intronic
1064042729 10:11982406-11982428 CCTGGTGCAGGCAAGCTGGGAGG - Intronic
1065149783 10:22811062-22811084 CCTGGCCCTGCCAGGCTGGGTGG + Intergenic
1065407793 10:25388809-25388831 CCTTGCCCACACAGGCTTGGAGG + Intronic
1065588382 10:27241523-27241545 CCTGGCTCCCTGGGGCTGGGTGG - Intronic
1066048955 10:31618156-31618178 CCTTGCTCACTCCGACTGGGAGG - Intergenic
1066058362 10:31701640-31701662 CGTGGCTCAGGGAGGCTGGCAGG - Intergenic
1067275408 10:44828948-44828970 CCTGGCTCACACAGGCCTGTGGG + Intergenic
1068544119 10:58327209-58327231 CCTGGCGAACCGAGGCTGGGAGG + Intergenic
1070219272 10:74423444-74423466 ACTGGCTCTTGCTGGCTGGGTGG + Intronic
1070710206 10:78675766-78675788 GCTGGCTCTGGCAGGATGGGTGG - Intergenic
1070756349 10:78995839-78995861 GCAGGCTCAGGCAGGGTGGGTGG - Intergenic
1070800730 10:79243170-79243192 GCGGGCACACGCAGGGTGGGTGG + Intronic
1070829864 10:79411679-79411701 CCTGCCTCTCACAGGCTGTGTGG - Intronic
1070912020 10:80127127-80127149 CCCGGCCCAGCCAGGCTGGGAGG + Intergenic
1075014955 10:118903818-118903840 CCTGGCTCTGGCAGGCTTGCAGG - Intergenic
1075024916 10:118977370-118977392 CCAGGCTCACCCAGGCTTGAGGG + Intergenic
1075647540 10:124106374-124106396 GCTGACTCAGCCAGGCTGGGAGG + Intergenic
1076655349 10:132019926-132019948 CCTGGCTCCCGCCGGCTCTGTGG + Intergenic
1076825364 10:132964593-132964615 CCTGGCCCAGGCTGGGTGGGTGG - Intergenic
1077058261 11:606350-606372 CCTGGCTCCCGCCTGCTGCGGGG + Intronic
1077228872 11:1449886-1449908 CCTGGCACACGCTGACTGGGAGG - Intronic
1077405591 11:2381119-2381141 CCTGGCTCCCCCAGGCTGTCTGG + Intronic
1077436114 11:2539998-2540020 CCGGGCGCAGGCAGGCTTGGGGG + Intronic
1078355377 11:10628495-10628517 CCAGGGTCAGGAAGGCTGGGTGG - Intronic
1078539218 11:12199950-12199972 CCTGGCTCCCCAAGTCTGGGTGG + Intronic
1078758749 11:14234986-14235008 CCTGGCTCAGGTGGGCTGGCTGG - Intronic
1080388505 11:31824286-31824308 CCTAGCACCTGCAGGCTGGGGGG - Intronic
1081854984 11:46297209-46297231 CCTGGCTGTGGCTGGCTGGGTGG + Intronic
1083060750 11:59868378-59868400 CCTAGCTCAAACAGGCTGGCAGG - Intergenic
1083880672 11:65546812-65546834 CCTGGCTACCGCAGCCAGGGGGG - Exonic
1084659888 11:70540471-70540493 CCAGGCTCCCGCGGGCAGGGAGG - Intronic
1084949708 11:72657912-72657934 CCCTGCTCACAGAGGCTGGGTGG - Intronic
1086059015 11:82681521-82681543 CATGGCTTACCAAGGCTGGGGGG - Intergenic
1087563618 11:99823166-99823188 CCTGACCCACGAAGGCTGTGAGG + Intronic
1088826086 11:113495846-113495868 CCTGGCTCACCCTGGCTCTGTGG + Intergenic
1089009427 11:115120572-115120594 CCTGCCTCACCCAATCTGGGAGG + Intergenic
1089216405 11:116837149-116837171 CCTGGCTCCCTGAGGGTGGGAGG + Exonic
1089587479 11:119519688-119519710 CCTGGCTCAGGAGGGCGGGGTGG + Intergenic
1089643014 11:119859956-119859978 CATGGCTCTCCCAGGCAGGGAGG + Intergenic
1089676737 11:120095488-120095510 GCTGGCCCAGGCAGGCTGTGGGG - Intergenic
1090400058 11:126443282-126443304 CCTGGCTGGCGCGGGCTGTGTGG + Intronic
1091820884 12:3474419-3474441 CATGGGTCCCGCATGCTGGGTGG - Intronic
1094587195 12:31788432-31788454 GGTGGCTCACGCATGTTGGGAGG - Intergenic
1095702832 12:45208186-45208208 GCTGGCTCATGCCGCCTGGGAGG - Intergenic
1095969856 12:47894248-47894270 CCTGGCTCAGGGCAGCTGGGGGG - Intronic
1098072315 12:66689076-66689098 CAGGGCTCAGGCAGGCTGGCTGG + Intronic
1098336315 12:69408567-69408589 CCTGGCACCAGCAGGCTGTGAGG + Intergenic
1099682155 12:85843650-85843672 CCTGGCTCCCGCTGGCTCTGTGG - Intergenic
1100103398 12:91138449-91138471 CCTGGTGCAGGCAGCCTGGGTGG - Intergenic
1100671968 12:96823557-96823579 GATGGCTCAGGAAGGCTGGGTGG + Intronic
1100755506 12:97747290-97747312 TCTTGCTCACACAGTCTGGGAGG + Intergenic
1103997169 12:124837866-124837888 ACTGTGTCACCCAGGCTGGGGGG - Intronic
1105483562 13:20803425-20803447 CCTGCCTGACTCAGGCTGAGTGG - Intronic
1106376669 13:29195679-29195701 CCTGACTGGCCCAGGCTGGGTGG - Intronic
1106418780 13:29568409-29568431 GTTGGCTCTCGCAGGCTGAGTGG - Intronic
1113970557 13:114185432-114185454 CCTGGCTCCCACAGGCTCCGTGG - Intergenic
1122152281 14:99731625-99731647 GCTGCCTCCCGCAGGGTGGGGGG - Intergenic
1122517034 14:102316097-102316119 TCTGGGACATGCAGGCTGGGTGG + Intergenic
1124003689 15:25779941-25779963 CCTGCCGCAGGCAGGCCGGGCGG + Intronic
1124179042 15:27456175-27456197 CCAGGCCCAAGCAGGCAGGGAGG - Intronic
1126110131 15:45170071-45170093 CCAGGCTAAGGCAGGCTGGCAGG + Intronic
1128187212 15:65652510-65652532 CCTTCCTCACTCAGGCTGAGGGG + Intronic
1128323308 15:66707063-66707085 CCTGACTCCCACGGGCTGGGAGG - Intronic
1129435722 15:75538651-75538673 GCTGTGTCACCCAGGCTGGGGGG - Intronic
1129538702 15:76334381-76334403 CCAGACACACGCAGGCAGGGTGG + Intergenic
1129798485 15:78395937-78395959 CTGGGATCACACAGGCTGGGAGG + Intergenic
1132359502 15:101200991-101201013 CCTGGCTCAGGCAGGGAAGGGGG - Intronic
1132737442 16:1393908-1393930 CCTGGCCCACGCCGGCGTGGAGG + Intronic
1132771016 16:1563361-1563383 CCCGGCTCACTCCGCCTGGGAGG + Intronic
1132771439 16:1565619-1565641 CCTGGCTCACGCAGGCTGGGCGG + Intronic
1133287428 16:4697136-4697158 CCAGGCTCAGGAGGGCTGGGTGG + Intronic
1133457381 16:5954314-5954336 CCTGTCTAACTCAGGCCGGGTGG + Intergenic
1135137198 16:19893838-19893860 ACTGGGTCACCCAGGCTGGAGGG + Intergenic
1135718265 16:24791538-24791560 CCTGGTACAGGCTGGCTGGGGGG + Exonic
1136136954 16:28262083-28262105 ACTGGCTCCTGCAGCCTGGGCGG - Intergenic
1136713999 16:32262456-32262478 CCTGGCTCACTCAGGCTGGCAGG - Intergenic
1136753906 16:32666963-32666985 CCTGGCTCACTCAGGCTGGCAGG + Intergenic
1136814207 16:33203402-33203424 CCTGGCTCACTCAGGCTGGCAGG - Intronic
1136820683 16:33313482-33313504 CCTGGCTCACTCAGGCTGGCAGG - Intergenic
1136827246 16:33370021-33370043 CCTGGCTCACTCAGGCTGGCAGG - Intergenic
1136832312 16:33468792-33468814 CCTGGCTCACTCAGGCTGGCAGG - Intergenic
1137009780 16:35310992-35311014 CCTGGCCCAATCAGGCTGGCAGG + Intergenic
1137023700 16:35453836-35453858 CCTGGCCCACTCAGGCTGGCAGG + Intergenic
1137672367 16:50286506-50286528 CCTGGCTGAAGCAGGCATGGGGG + Intronic
1138342180 16:56297169-56297191 CTTGCCTCAAGCAAGCTGGGAGG - Intronic
1141032990 16:80606106-80606128 CCTGGCTCCAGCAGACTGGGAGG + Intronic
1141867009 16:86757318-86757340 CCTGGCCCATGGAGGCTGTGTGG - Intergenic
1142000985 16:87664366-87664388 GGTGGCTCACGCAGTTTGGGAGG + Intronic
1142147748 16:88499617-88499639 CCTGAATCCCGCTGGCTGGGTGG + Intronic
1142190574 16:88715461-88715483 CAGGGCTCAGGCAGGCCGGGAGG + Exonic
1202992783 16_KI270728v1_random:26376-26398 CCTGGCTCACTCAGGCTGGCAGG - Intergenic
1203056055 16_KI270728v1_random:927296-927318 CCTGGCTCACTCAGGCTGGCAGG + Intergenic
1142752264 17:1996052-1996074 CCTGGCTCAGGCTGCCTGGCAGG + Intronic
1143076828 17:4351164-4351186 ACTGTCTCACGGGGGCTGGGGGG + Intronic
1143380281 17:6491519-6491541 TCTGGCTGAAGCAGGCTGGGGGG + Intronic
1144805462 17:17963463-17963485 CCTGGCTCAAGTAGGCGGAGCGG - Intronic
1146123564 17:30215395-30215417 CCTGGGCCACTCAGGCTGAGAGG - Intronic
1146633051 17:34484410-34484432 CACGGCTCCCGGAGGCTGGGAGG + Intergenic
1147990179 17:44327761-44327783 TCTGGCTCAGGCACGTTGGGGGG - Intergenic
1148442044 17:47716457-47716479 CTTGGCCCAAGGAGGCTGGGTGG + Intergenic
1148853280 17:50565062-50565084 CCTGGCTGAGGCAGGCAGGGCGG - Intronic
1150328352 17:64274646-64274668 CCTGGTTTCCGGAGGCTGGGAGG + Intergenic
1151612117 17:75182985-75183007 GCTCGCGCACGCAGGGTGGGGGG - Intergenic
1152300947 17:79495168-79495190 CCTGGCTTACGTCGGGTGGGAGG + Intronic
1152568494 17:81111024-81111046 CCTCAGTCACGCAGCCTGGGTGG + Intronic
1152814267 17:82398139-82398161 CCTGGCTCAGGCAAGCACGGTGG - Intronic
1157297114 18:46453854-46453876 ACTGGCTCATGCACTCTGGGAGG + Intronic
1159061147 18:63515149-63515171 ACTGGGTCACGCAGGCTGAGGGG + Intergenic
1159885436 18:73899158-73899180 CCTGGCAGATGCAGGCTGGGTGG - Intergenic
1160010884 18:75106421-75106443 CCTGGCTGAGGCAGGGTGAGGGG + Intergenic
1160720883 19:596464-596486 CTTGGCCCTCGCAGGCAGGGAGG - Intronic
1160911038 19:1473920-1473942 CCTGCCACACACAGCCTGGGAGG - Exonic
1161087468 19:2341625-2341647 GCTGCCTCAGGAAGGCTGGGAGG - Intronic
1161209283 19:3057794-3057816 CCTGGATAACGGAGGGTGGGGGG - Intronic
1161319413 19:3634079-3634101 CCTGGCTCTTGCAGGGTGGGTGG - Intronic
1161395841 19:4044480-4044502 CCTGGGCCCGGCAGGCTGGGGGG + Exonic
1161686645 19:5706020-5706042 CCTGGCTCCGGGAAGCTGGGTGG + Intronic
1161797954 19:6398382-6398404 CCTGTCTCACCCAGGCGCGGTGG + Intergenic
1161801672 19:6419740-6419762 CCTGTCTCACGCAGTCTTGCCGG + Intronic
1162266575 19:9580452-9580474 GCTGGATCACCCAGGCTGGAGGG - Intronic
1162458935 19:10802984-10803006 CCTGCCTGAGGCAGGCCGGGTGG + Intronic
1164147583 19:22521443-22521465 CCTGTCTTGGGCAGGCTGGGGGG + Intronic
1164960891 19:32428535-32428557 CCTGGCTCAACCAGGCTTAGAGG + Intronic
1165931625 19:39362840-39362862 TCTGGCTCATTCAGTCTGGGTGG + Intronic
1166630844 19:44405878-44405900 GCTGGGTCACCCAGGCTGGAGGG - Intergenic
1166822984 19:45591897-45591919 CCTGGCCCACGGGGGCTGTGGGG + Exonic
1167133535 19:47603097-47603119 CCAGGGTCACTCAGGCAGGGTGG + Intergenic
1167321343 19:48799004-48799026 CCTGGGTCTCCCAGGCTGGTGGG - Intronic
1167757425 19:51421488-51421510 CCTGTCTGACCAAGGCTGGGAGG - Intergenic
1168257029 19:55172845-55172867 CCTGCCACACGCTGGCTGTGAGG - Exonic
1168690366 19:58373082-58373104 CCTGTCTCACACAGGCCTGGAGG - Intronic
1202711809 1_KI270714v1_random:23117-23139 CCTGGCTCAGCCCGGCTGGGTGG + Intergenic
925306680 2:2851657-2851679 CCTGGTTCAAGCAGGTGGGGCGG - Intergenic
925360741 2:3278521-3278543 CCTGGCAGGAGCAGGCTGGGAGG + Intronic
927135164 2:20091655-20091677 GCTGGCCCACGCAGGCAGAGGGG + Intergenic
927591802 2:24363085-24363107 CCTGAATCACACAGGGTGGGAGG - Intergenic
927831606 2:26356027-26356049 GCTGGCTCACCCAGGCAAGGTGG - Intronic
928241731 2:29592404-29592426 GCTGGCTCAAGCAGGCTGCTTGG + Intronic
929048758 2:37816326-37816348 CCTGACTAACGCAGGCTTCGGGG - Intergenic
929165575 2:38877830-38877852 GCTGTCTCACCCAGGCTGGAGGG + Intronic
931697037 2:64879103-64879125 GCTGGCTCACTCAGGCTGACAGG + Intergenic
934518877 2:95007005-95007027 CCTGGCTGCAGCAGGCTGGAGGG - Intergenic
937326011 2:120989895-120989917 CCTGGCTCATGGAGGCTGCCAGG - Exonic
937677214 2:124605159-124605181 GCTGGGTCAGCCAGGCTGGGTGG - Intronic
938267503 2:129939040-129939062 CCCGGCCCAGCCAGGCTGGGAGG - Intergenic
942149338 2:173058994-173059016 CCTGCCTCACAAAAGCTGGGGGG + Intergenic
944936559 2:204575652-204575674 CCTGGCTCTCTCTGGCTGTGGGG + Intronic
945080982 2:206085821-206085843 GCTGGGCCGCGCAGGCTGGGCGG - Intronic
946825390 2:223672660-223672682 ACTGTGTCACTCAGGCTGGGTGG + Intergenic
947799743 2:232921325-232921347 CCTGCCTGCTGCAGGCTGGGAGG + Intronic
947914572 2:233823025-233823047 CCTGGCTCCCACAGGGTGGCAGG + Intronic
948599792 2:239101663-239101685 CCTGGTTCAGGGTGGCTGGGAGG + Intronic
1168797384 20:620621-620643 CATGGAGAACGCAGGCTGGGAGG + Intergenic
1170624330 20:18019888-18019910 TCTGGCTCATGCAAGCTGGTGGG - Intronic
1170625027 20:18023740-18023762 GCTGGCTCATGCAGGCTGGTGGG - Intronic
1171412376 20:24956138-24956160 CGTGGCACCCCCAGGCTGGGTGG - Intronic
1172108770 20:32532937-32532959 CCTGGCTCTGGCAGGCTGTTTGG - Intronic
1172119881 20:32592019-32592041 CCAGCCTCACCCAGGCAGGGAGG + Intronic
1172766217 20:37352477-37352499 CCAGGCTCAGGGAGGCTGGATGG - Intronic
1172838128 20:37886174-37886196 CCTGTCTCTCGCTGGCTGTGTGG - Intergenic
1172894527 20:38291237-38291259 GCTGACTCAGGGAGGCTGGGAGG + Intronic
1173154580 20:40596802-40596824 CCTGCCTCACCCAGGCAGGATGG - Intergenic
1173530496 20:43766152-43766174 CCTCTCTCACGCTGGCTGTGTGG - Intergenic
1173575640 20:44111631-44111653 GCTGGCTCAAGGAGGGTGGGTGG - Intergenic
1173705666 20:45108656-45108678 GCTGTGTCACCCAGGCTGGGGGG + Intergenic
1175715477 20:61252330-61252352 CCTGGCTCCCGGAGCCGGGGCGG + Intergenic
1176120886 20:63454109-63454131 CCTGGTCCACGCCTGCTGGGAGG - Intronic
1178453577 21:32727478-32727500 CCGGGCTACCGCCGGCTGGGGGG + Intronic
1179534751 21:42044291-42044313 CCGAGCTGAGGCAGGCTGGGTGG - Intergenic
1179989730 21:44941251-44941273 CCTGGCTCATGCTGGCAGGTAGG + Intronic
1180163890 21:46010482-46010504 CCTGTTTCAAGCTGGCTGGGTGG - Intergenic
1181084068 22:20431250-20431272 CCTGTGCCACGCAGGCTGGTGGG - Exonic
1182423038 22:30257737-30257759 CCTGGGTCACTCAGGCAGGCGGG - Intergenic
1182446663 22:30393659-30393681 CCTGGGTCAGGCAGGCTGGAGGG - Intronic
1183409666 22:37647433-37647455 CCTGGCTCCTTCAGGCTGGGGGG - Exonic
1184550919 22:45203740-45203762 CCATGCACAAGCAGGCTGGGGGG + Intronic
1184661875 22:45969204-45969226 CCTGGCTGTGGCAGGGTGGGGGG - Intronic
1184877770 22:47286349-47286371 TCTGGCTCCTGCAGGCTGGCAGG + Intergenic
1185008435 22:48299511-48299533 CCTGGGACACGGAGCCTGGGGGG - Intergenic
950515884 3:13464892-13464914 CCAAGATCACACAGGCTGGGTGG + Intergenic
952178652 3:30894645-30894667 CGCGGCTCCCGCAGTCTGGGCGG + Exonic
952889683 3:38031552-38031574 CCTGGCTCTCACAGGCTGGGAGG + Intergenic
953680869 3:45036960-45036982 CCAGGCCCACGATGGCTGGGTGG - Intergenic
953913063 3:46902441-46902463 CCTGGGGCTCGCAGGGTGGGGGG + Intronic
954497858 3:50982659-50982681 CCTGGCTCCCGCTGGCTCCGTGG - Intronic
954574475 3:51668193-51668215 CCTGTCTTGGGCAGGCTGGGGGG - Exonic
954819190 3:53310392-53310414 CCTGGCTTACTCAGGCTGAGAGG - Intronic
955055423 3:55450992-55451014 CTTGGCAAAGGCAGGCTGGGAGG - Intergenic
955213287 3:56962009-56962031 CCTCTGTCACCCAGGCTGGGGGG - Intronic
960019334 3:112932130-112932152 CTTGGCTCACAGAGGGTGGGTGG - Intronic
960687282 3:120307065-120307087 CTTGGTTCACGTAGGCTTGGCGG - Intergenic
960991206 3:123312892-123312914 TCTGGATAAAGCAGGCTGGGGGG + Intronic
961645926 3:128392782-128392804 CCTGGCACACACAGGCTGCTCGG + Intronic
962668393 3:137679634-137679656 CCTGGGTCACTCAAGCTTGGTGG + Intergenic
962751066 3:138435113-138435135 CTTGGCTCACCCAGGCTGGCAGG - Exonic
968479894 4:828663-828685 CCTGGCTCACACACCCTGAGTGG - Intergenic
968872503 4:3248889-3248911 CCCGGCTCACGCAGGCCAAGAGG - Exonic
968880966 4:3299921-3299943 CCAGGCTCACTGAGGGTGGGAGG + Intronic
969254445 4:5992727-5992749 CCTGCCTCATGCAGGCTATGTGG - Intergenic
969323419 4:6426711-6426733 CCTGGGAAACGCAGGCTGGATGG + Intronic
969427384 4:7133266-7133288 CCTGTCTGACTCAGGCTGTGGGG + Intergenic
970845641 4:20534694-20534716 CATGGCTCTCACAGGCTGTGCGG - Intronic
971345015 4:25803736-25803758 CCTGCCTCAAGCAGGCAGGCAGG - Intronic
971380066 4:26088484-26088506 CCTGGCGCAGCCAGGCTGGTGGG + Intergenic
971635069 4:29047495-29047517 CCTGGCTCCCTCAGCCTGCGGGG + Intergenic
971671735 4:29567082-29567104 CTTGGCACACACAGCCTGGGTGG - Intergenic
975110978 4:70626280-70626302 TCTGCCTCACCCAGGCTGGAGGG + Intergenic
976129593 4:81870587-81870609 CCTGGCTCCCGCAGGCTCAGAGG + Intronic
976710266 4:88063273-88063295 AGTGGCTCACGCATGTTGGGAGG + Intronic
976792232 4:88891384-88891406 TCTGTCTCACCCAGGCTGGAGGG - Intronic
982610967 4:157574466-157574488 CCTTGCCCCCGCAGGCTCGGAGG + Intergenic
985390738 4:189490141-189490163 GCTGTCTCACCCAGGCTGGAGGG + Intergenic
985540102 5:483863-483885 GCTGGCGCTCCCAGGCTGGGTGG - Intronic
988480000 5:31621605-31621627 CCTGGCACATGGAAGCTGGGTGG - Intergenic
988540888 5:32108331-32108353 CCTGCGTCACCCAGGCCGGGAGG + Exonic
990322535 5:54644087-54644109 CCTGGCTCAAGGATGCTGGCAGG - Intergenic
990988563 5:61662871-61662893 CCTGGCACAGGCAGACTGGGTGG - Intronic
996970333 5:129359405-129359427 CCAGGCTCAGCCATGCTGGGTGG + Intergenic
997353348 5:133246597-133246619 CTTGACTCACGCAGGGAGGGAGG - Intronic
997677000 5:135720468-135720490 CCTGAGTCACACAGGCTGGCTGG - Intergenic
998181899 5:139951809-139951831 CCTGGCTCACCCAGGCAGCCTGG + Intronic
998366940 5:141637827-141637849 CCTGGCTCAGGCCGGCGTGGAGG + Exonic
999942492 5:156559218-156559240 CCTGGCTCTCTCAGACTGGGAGG + Intronic
1001059295 5:168474961-168474983 AGTGGCTCACGCACCCTGGGTGG + Intergenic
1001917769 5:175575900-175575922 CCTGGAACAGGCAGACTGGGAGG + Intergenic
1002293063 5:178212724-178212746 GCCTGCTCAGGCAGGCTGGGTGG + Intronic
1002382256 5:178839288-178839310 CCTGCCTGAGGCAGGCTGGAGGG - Intergenic
1002430360 5:179199711-179199733 CCAGACTCAGGGAGGCTGGGAGG - Intronic
1002648384 5:180673706-180673728 CCTGCCTGAGGCGGGCTGGGGGG + Intergenic
1002662796 5:180802913-180802935 CCTGGCGGACGCCGGCCGGGGGG - Intronic
1002870754 6:1165629-1165651 CCTGGCTCAAGAAGGCTGGGAGG - Intergenic
1006006307 6:31004585-31004607 CTTGGGTCACGCATGCTTGGTGG - Intergenic
1006572150 6:35014616-35014638 CCTGGCTCACACTGCCTGGGTGG - Intronic
1006573175 6:35022131-35022153 CCTGACTTTCTCAGGCTGGGTGG - Intronic
1006626486 6:35401624-35401646 TCTGGCCCAGGCAGGCTGAGTGG - Intronic
1015186648 6:130424700-130424722 CCTGGATCACCAAGGATGGGTGG + Intronic
1017221879 6:151975009-151975031 CCTAGATTACTCAGGCTGGGTGG + Intronic
1017995125 6:159525597-159525619 CCTGGATCAGGCAGGCAGAGAGG - Intergenic
1018417687 6:163615322-163615344 GCTGGCTGACATAGGCTGGGTGG + Intergenic
1018552600 6:165015367-165015389 TCTGGCTCACCCACTCTGGGTGG + Intergenic
1019286990 7:228599-228621 CCTGGCTCACACCGGCTCTGTGG - Exonic
1019406477 7:886789-886811 CCTGGCTCACTGAGACCGGGTGG - Intronic
1019883509 7:3884112-3884134 GCTGTGTCACGCAGGCTGGAGGG + Intronic
1020241171 7:6396291-6396313 GCTGGCTGACCCTGGCTGGGAGG - Intronic
1021538678 7:21732992-21733014 CCTGGCTCCTGCAGGATGTGAGG - Intronic
1021934200 7:25614199-25614221 CCTGGCTCACACAGGCAAGCTGG - Intergenic
1021999138 7:26208220-26208242 TCTGGCGGAGGCAGGCTGGGGGG + Intronic
1022804393 7:33807354-33807376 GCTGGCTCCAGTAGGCTGGGAGG - Intergenic
1023966549 7:44965852-44965874 CCTGGCCCACCCAGGCATGGCGG - Exonic
1026482616 7:70791074-70791096 CATGGCTCACACAGACTGGGGGG + Exonic
1028523636 7:91759374-91759396 CCTGGGACACTCAGGCTTGGTGG + Intronic
1029489527 7:100862772-100862794 CCTGGCGCACGGAGGGTGAGAGG - Exonic
1029977628 7:104849440-104849462 CCTGGCTCCTGGGGGCTGGGTGG + Intronic
1031786420 7:126040272-126040294 CCTGGCTCCCGCTGGCTTTGTGG - Intergenic
1039478047 8:37851570-37851592 TCGGGCACACACAGGCTGGGAGG + Intergenic
1044989629 8:97784155-97784177 CCTGGGTCACGCATGATAGGTGG + Intronic
1047112285 8:121803877-121803899 CTTGGCCCGCCCAGGCTGGGTGG - Intergenic
1048464754 8:134656120-134656142 CAGGACTCACACAGGCTGGGTGG + Intronic
1049415416 8:142492771-142492793 CCTGGGTCATGCAAGCAGGGGGG - Intronic
1049427122 8:142542540-142542562 CCGGGATCCCCCAGGCTGGGGGG - Exonic
1050424914 9:5502637-5502659 CATGGCTCAGGCAGGTTGGGGGG - Intergenic
1052940627 9:34129432-34129454 CAGGGCACACGCAGACTGGGTGG - Intergenic
1059039892 9:110801022-110801044 CCTGGCTCACAGAGTCTGAGAGG - Intronic
1060415819 9:123429519-123429541 GCTGTGTCACCCAGGCTGGGGGG - Intronic
1060554335 9:124500517-124500539 TCAGGCCCATGCAGGCTGGGAGG + Exonic
1060985627 9:127817520-127817542 CCAGGCTCACTCTGGCTGGAGGG + Intronic
1061035163 9:128109435-128109457 CCTGTCTCAGGCAGGGTGCGGGG + Intergenic
1061189340 9:129072473-129072495 CCTGGCTCTCACAGCTTGGGGGG - Intergenic
1062061920 9:134501569-134501591 CCTGGCCCACCCAGGCCAGGCGG + Intergenic
1062419012 9:136470180-136470202 CCTGGCTTGCGCAGGCTCTGGGG - Intronic
1062469589 9:136696748-136696770 CCAGGCTCCGCCAGGCTGGGGGG - Intergenic
1062605771 9:137348284-137348306 CCTGGCTCTCTGAGGCTGTGAGG - Intronic
1185461782 X:336132-336154 GCTGTGTCACGCAGGCTGGAGGG - Intronic
1185845713 X:3435929-3435951 CCTGGGTCCCGCACGCTGGCCGG - Intergenic
1186458195 X:9727447-9727469 CTTGGCCCATGCAAGCTGGGTGG + Intronic
1187426310 X:19180435-19180457 CCTGGTTCAAGGATGCTGGGTGG - Intergenic
1191719715 X:64219369-64219391 CCTGCCTCACACAGTCTGGGTGG - Intergenic
1200684339 Y:6246021-6246043 CCGGGCACACGCGGGCTGCGTGG - Intergenic
1200818715 Y:7560362-7560384 CCTGGGTCCCGCACGCTGGCCGG + Intergenic
1200989861 Y:9337262-9337284 CCGGGCACACGCGGGCTGCGTGG - Intergenic
1200992529 Y:9357595-9357617 CCGGGCACACGCGGGCTGCGTGG - Intergenic
1200995181 Y:9377873-9377895 CCGGGCACACGCGGGCTGCGTGG - Intronic
1200997846 Y:9398219-9398241 CCGGGCACACGCGGGCTGCGTGG - Intergenic
1201000355 Y:9466752-9466774 CCGGGCACACGCGGGCTGCGTGG - Intergenic
1201003017 Y:9487065-9487087 CCGGGCACACGCGGGCTGCGTGG - Intronic
1201005676 Y:9507348-9507370 CCGGGCACACGCGGGCTGCGTGG - Intergenic
1201008336 Y:9527678-9527700 CCGGGCACACGCGGGCTGCGTGG - Intergenic
1201010932 Y:9547860-9547882 CCAGGCACACGCGGGCTGCGTGG - Intergenic
1201048295 Y:9908365-9908387 CCGGGCACACGCGGGCTGCGTGG + Intergenic
1202115759 Y:21467923-21467945 CCAGGCACACGCAGGCTGCGTGG - Intergenic