ID: 1132774487

View in Genome Browser
Species Human (GRCh38)
Location 16:1584977-1584999
Sequence AGCCACTGGAAACGTGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132774487 Original CRISPR AGCCACTGGAAACGTGGTGA AGG Intronic
900798467 1:4723597-4723619 GGCTGCTGGAGACGTGGTGAGGG + Intronic
900920540 1:5667640-5667662 AGCCACTGGAGTGCTGGTGAGGG - Intergenic
900920589 1:5667836-5667858 AGCCACTGGAGTGCTGGTGAGGG - Intergenic
900920621 1:5667968-5667990 AGCCACTGGAGTGCTGGTGAGGG - Intergenic
902127474 1:14228228-14228250 AGCCCCTGGCAAAGTGGTAATGG - Intergenic
902205988 1:14868552-14868574 ACCCAGTGGAAAAGTGGTAATGG - Intronic
905959663 1:42033075-42033097 ATCCACTGGATACATGGTGGAGG + Intronic
907407234 1:54261098-54261120 AGACACAGGGAACGTAGTGACGG - Intronic
908308097 1:62845982-62846004 AGCCACTTAGAAAGTGGTGAGGG + Intronic
910593375 1:88951979-88952001 AGCCACAGGAAATGTGTTGACGG + Intronic
912306069 1:108568801-108568823 AGCCACTGGGAAGGAGGAGAGGG + Intronic
912529377 1:110309276-110309298 AGCCACTGGAGTCCTGATGAAGG - Intergenic
914851775 1:151319984-151320006 AGACACTGGAAGGGTGGTGGTGG - Intronic
915253043 1:154604068-154604090 AGCCACTGGAAAAGAGTTGCAGG - Intronic
918139742 1:181710201-181710223 AGCCAGTGGGAAGGTGGTGGGGG - Intronic
922981165 1:229828134-229828156 AGCCACAGGAAAGATAGTGATGG + Intergenic
1062769487 10:87759-87781 AGCTACTGGAAAGGTGGGAATGG + Intergenic
1063027297 10:2193078-2193100 AGCCACTGGATACCTGGAGATGG + Intergenic
1063122106 10:3112342-3112364 AGCCACTGCAAACGTGCTTAGGG + Intronic
1063193155 10:3717010-3717032 AGCAGCAGGAAACGTGGGGATGG + Intergenic
1065294362 10:24260300-24260322 AGCCTCTGGAAAAGTGGTTTAGG + Intronic
1065882395 10:30047837-30047859 AACCACTGGAACCATGGTGGTGG + Exonic
1069049444 10:63777289-63777311 AGAGACTGGAAATGTGGTGATGG - Intergenic
1076746227 10:132516043-132516065 AGCCACTGGGAAAGTGGTGAGGG + Intergenic
1077353628 11:2104720-2104742 GGCCACTGGAACCGTGAGGAAGG - Intergenic
1083667784 11:64285030-64285052 AGCCAGTGAAAACTTTGTGAAGG + Intronic
1087020568 11:93598655-93598677 AGGCACTGGAAAGGAGGGGAGGG - Intergenic
1087470205 11:98564363-98564385 AGCCTCTGGAATCCTGCTGAAGG - Intergenic
1091786929 12:3248769-3248791 TGTAGCTGGAAACGTGGTGAGGG - Intronic
1092479519 12:8847539-8847561 AGCCAAGGGAAACCTGGGGAAGG - Exonic
1093912460 12:24763232-24763254 AGCCACTGGAATCTGGCTGAAGG + Intergenic
1095257587 12:40057583-40057605 AACCACTGGAAAAATGGTTAAGG - Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1104189032 12:126459992-126460014 AGCCAGTGGAAAGGTCCTGAGGG - Intergenic
1106361158 13:29031802-29031824 AGCCACTGGGATAGTGGTGGGGG - Intronic
1106639250 13:31565796-31565818 AGCTATTGGATATGTGGTGATGG + Intergenic
1112306481 13:98279513-98279535 AGCCACTGGAAATGTGGTTCTGG + Intronic
1114618266 14:24079963-24079985 AGCCAATGGAAATGGGGTGGAGG - Intergenic
1116671285 14:47846145-47846167 AGCCACTGGAGCCATGGTGATGG - Intergenic
1118249814 14:64148599-64148621 AGTCAGTGGGCACGTGGTGAGGG - Intronic
1118258831 14:64228736-64228758 AGCCACTGGTAAACTGGTGGTGG - Intronic
1123427208 15:20182644-20182666 AGCAACTTGAAGCCTGGTGAGGG - Intergenic
1123536440 15:21189169-21189191 AGCAACTTGAAGCCTGGTGAGGG - Intergenic
1124634989 15:31359737-31359759 AGCCCCTGGGAACGTGGACAGGG - Intronic
1125512830 15:40302099-40302121 AGCCCCTGGAAGCCTGGGGAGGG + Intronic
1128330378 15:66751675-66751697 ACCCACTGAAGACGGGGTGAGGG - Intronic
1130220811 15:82018069-82018091 AGCCACTGGAATATGGGTGAAGG - Intergenic
1130353315 15:83109390-83109412 AGCCACTGGGAAGATGGTGATGG + Intronic
1132458622 16:38306-38328 AGCTACTGGAAAGGTGGGAATGG + Intergenic
1132774487 16:1584977-1584999 AGCCACTGGAAACGTGGTGAAGG + Intronic
1132888130 16:2191342-2191364 AGCCACTGGACACAGGGTGCGGG + Intronic
1134535572 16:15024254-15024276 AGCAGCTGGAATGGTGGTGATGG - Intronic
1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG + Intronic
1135328987 16:21545672-21545694 AGCCAGAGGAAACCTGGGGAGGG - Intergenic
1135894275 16:26384528-26384550 AGTCAATGGAAAGGTGGGGAGGG + Intergenic
1136339332 16:29631649-29631671 AGCCAGAGGAAACCTGGGGAGGG - Intergenic
1136543638 16:30943050-30943072 AGCCACTGAGAACGTGCTGGGGG - Intronic
1136857088 16:33667193-33667215 AGCAACTTGAAGCCTGGTGAGGG + Intergenic
1138275378 16:55730403-55730425 AGCCCATGAAAACGTGGTGGTGG + Intergenic
1203118663 16_KI270728v1_random:1515668-1515690 AGCAACTTGAAACCTGGTGAGGG + Intergenic
1151789809 17:76297963-76297985 AGGCACTGGAAACTTGGAGGCGG - Intronic
1153769219 18:8401760-8401782 AGCCACTGCTAGCTTGGTGAGGG - Intronic
1153836791 18:8970685-8970707 AGCCACTGGGCTCGTGGTTATGG + Intergenic
1153966731 18:10189398-10189420 AGCTCCTGGTAACGTGATGAAGG - Intergenic
1159497655 18:69226467-69226489 AGCCACTGGAAGATTGGTGATGG + Intergenic
1162188377 19:8924979-8925001 ATACACTGTAAACTTGGTGAGGG + Intronic
1162967184 19:14161502-14161524 ACCCACTGGGTGCGTGGTGAGGG + Exonic
1164544790 19:29151370-29151392 AGCCACTGGAGGCTTGGTTAGGG - Intergenic
1165952196 19:39480766-39480788 AGCCAATGGAAACGCGGGGGAGG - Exonic
930094397 2:47556006-47556028 AGTCACTGGAAAGGTGGGGCTGG + Intronic
930614024 2:53574669-53574691 AACCACTGGAATCGTGAAGATGG - Intronic
932704311 2:74011360-74011382 AGGCAATGGGAACGGGGTGAAGG - Intronic
938647384 2:133345622-133345644 AGGGACAGGAAAGGTGGTGATGG + Intronic
943123456 2:183767106-183767128 AGGCAATGGAAAAATGGTGAGGG + Intergenic
944863770 2:203840655-203840677 AGCCTCTGGAGAAGAGGTGAGGG + Intergenic
946521085 2:220465538-220465560 AGCCCCTGGAAACCTGAGGAGGG + Intergenic
947140161 2:227013227-227013249 AGAGACTGGAAACCTGGAGAAGG - Intronic
947728704 2:232416601-232416623 AGCTACTGGGGCCGTGGTGAGGG - Intergenic
948500576 2:238390219-238390241 AGACACTGGATCCATGGTGAGGG + Intronic
948774374 2:240275168-240275190 TACCACTGGAAACGTGTAGAAGG + Intergenic
1174777169 20:53354499-53354521 AGCCACTGCAAAGCAGGTGAAGG + Intronic
1176199706 20:63854812-63854834 AGCGACAGGAACCGTGGTGGGGG + Intergenic
1176217333 20:63954434-63954456 AGGCACTGGAACGGTGGTGGAGG + Intronic
1177252308 21:18610121-18610143 GGTCACTGGAAACATGATGAAGG + Intergenic
1182086581 22:27565246-27565268 AGACACTGGAACCATGTTGAAGG - Intergenic
1184385538 22:44172314-44172336 ATTCACTGAAAACGTGGTGCCGG - Intronic
949929010 3:9063932-9063954 AGCACCTGGAAAGCTGGTGAAGG - Intronic
950898059 3:16471528-16471550 AGCCACTGTAAAGGAGGTCAGGG + Intronic
952322848 3:32294409-32294431 AGCCAGAGGGAACGTGGAGAAGG - Intronic
955330243 3:58041406-58041428 AGCCACAGGAAATGTTGTCAGGG + Intronic
955739092 3:62070818-62070840 TGCCAGTGGGAACGTGGTGGTGG - Intronic
956796515 3:72723081-72723103 AGCCAAACAAAACGTGGTGAGGG - Intergenic
968468682 4:766242-766264 ATCCTCTGTAAACGTGGTGCTGG - Exonic
970221750 4:13818888-13818910 ACCCAATGGGAATGTGGTGAAGG - Intergenic
972204071 4:36749573-36749595 AGCCAATGGAAACTTAGTGAGGG + Intergenic
977220482 4:94332262-94332284 AGACACTTGAAAGATGGTGAAGG - Intronic
977691951 4:99922107-99922129 AGCCACTGCCAAAGTGGTGCTGG - Intronic
978280243 4:107003333-107003355 AGCCACAGGAAACTTGGTGGAGG - Intronic
978960668 4:114674184-114674206 AGCCACTAGAAATGTGAGGATGG - Intronic
980101904 4:128550254-128550276 AGCCACAGAAATCGTGGTGGTGG - Intergenic
983909698 4:173224252-173224274 ATCTACTCGAAACGTGGTAAAGG - Intronic
986076185 5:4340376-4340398 AGACACTTGAAAGATGGTGAAGG + Intergenic
986320026 5:6623182-6623204 AGCAACTAGAAACGTGGGGGCGG - Intronic
987292365 5:16520900-16520922 AGCCTCTGGAAACACGGAGAGGG + Intronic
995561478 5:113386484-113386506 AGACCCTGGAAACTTGGGGAAGG - Intronic
995866096 5:116692810-116692832 AGGCAATGGAAACATGGAGATGG + Intergenic
996214644 5:120851819-120851841 AGCTACTGGAAAAGTCCTGAAGG - Intergenic
996227728 5:121021912-121021934 AGCTAATGGAAAAGTAGTGAAGG + Intergenic
999687291 5:154114687-154114709 AGCCCCTGGAAACTTGCTTATGG + Intronic
1001263522 5:170254551-170254573 AGGCACTGGGAACTTGGAGAAGG - Intronic
1002897231 6:1386480-1386502 AGTCACTGTAGACGTGGTGGTGG + Intergenic
1003350411 6:5312546-5312568 AGCCACTGGGAATGTGCTTATGG + Intronic
1006230735 6:32584363-32584385 TGCCACAGGAAACGTGCTGTGGG + Exonic
1006400910 6:33816762-33816784 AGAGACTGGAAAGGTGGGGATGG - Intergenic
1006793782 6:36719858-36719880 AGCCATAGGAAAGGAGGTGAGGG + Intronic
1008836093 6:55832325-55832347 AGCCAACTGAAACATGGTGAGGG - Intronic
1010542235 6:77106055-77106077 AGCTAGTGGAAAAGTGCTGAAGG + Intergenic
1012750183 6:103151873-103151895 AGGAACTGGGAACGTGGTGGTGG + Intergenic
1019921198 7:4164242-4164264 AGCCACTGGAAAAGTGACGAAGG + Intronic
1020141785 7:5615668-5615690 AATCACTGGAAACGTGGGAAGGG + Intergenic
1020564552 7:9778818-9778840 AGCCATTTGAAAGATGGTGAAGG + Intergenic
1032486375 7:132290475-132290497 AGCCAATGGGAAGGAGGTGAGGG - Intronic
1034630074 7:152523962-152523984 AACAACTTGAAACGTGGCGAGGG - Intergenic
1034940408 7:155226829-155226851 AGCCACTGGAGACGTGAGGTGGG - Intergenic
1041794445 8:61731591-61731613 AGGCACTGGAAAGTGGGTGAAGG + Intergenic
1043581720 8:81722301-81722323 AGCCACTGCAAAGGTACTGAAGG + Intronic
1043796474 8:84547846-84547868 AACCACTGGAAACCTGGGTAAGG - Intronic
1046437317 8:114208310-114208332 TGCAAATGTAAACGTGGTGAAGG - Intergenic
1048971261 8:139646053-139646075 AGCCACTGGTCATGGGGTGAGGG - Intronic
1049532384 8:143160779-143160801 AGCCACTGGAAACGGGGAAACGG - Intergenic
1051142572 9:13993675-13993697 AGCCAATGAAGACGGGGTGAGGG - Intergenic
1052525742 9:29616598-29616620 GGCAACTGAAAATGTGGTGATGG + Intergenic
1055544565 9:77355875-77355897 AGCCAGTTGAAAAATGGTGATGG - Intronic
1056403277 9:86248844-86248866 AGCCACTGGAACTGGGGTGATGG - Intronic
1057993629 9:99799163-99799185 AGACCCAGGAAAGGTGGTGATGG + Intergenic
1059920409 9:119154273-119154295 AGTCTCTGGAAATGTTGTGAAGG + Intronic
1062575708 9:137206352-137206374 AGGCAATGAAAACGGGGTGAGGG - Intronic
1187251844 X:17605865-17605887 TTGCCCTGGAAACGTGGTGAAGG + Intronic
1189912560 X:45825711-45825733 ACTCACTGGAAGCGTGGTGTGGG - Intergenic
1190654231 X:52597146-52597168 AGGCACTGGGAGCCTGGTGAGGG - Intergenic
1198157639 X:133977531-133977553 AGCTGATGGAAACATGGTGAAGG - Intronic
1199859676 X:151789977-151789999 AGCCAATGGAAAGGAAGTGAGGG - Intergenic