ID: 1132774685

View in Genome Browser
Species Human (GRCh38)
Location 16:1586487-1586509
Sequence CAGCTTTCCTAGAGGCCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132774681_1132774685 10 Left 1132774681 16:1586454-1586476 CCAGTGCGGGGGTGGTGGGGGAT 0: 1
1: 0
2: 0
3: 30
4: 285
Right 1132774685 16:1586487-1586509 CAGCTTTCCTAGAGGCCAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 172
1132774669_1132774685 26 Left 1132774669 16:1586438-1586460 CCCTGACCTCACAGTGCCAGTGC 0: 1
1: 0
2: 3
3: 20
4: 196
Right 1132774685 16:1586487-1586509 CAGCTTTCCTAGAGGCCAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 172
1132774675_1132774685 20 Left 1132774675 16:1586444-1586466 CCTCACAGTGCCAGTGCGGGGGT 0: 1
1: 0
2: 4
3: 9
4: 109
Right 1132774685 16:1586487-1586509 CAGCTTTCCTAGAGGCCAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 172
1132774670_1132774685 25 Left 1132774670 16:1586439-1586461 CCTGACCTCACAGTGCCAGTGCG 0: 1
1: 0
2: 0
3: 3
4: 123
Right 1132774685 16:1586487-1586509 CAGCTTTCCTAGAGGCCAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132774685 Original CRISPR CAGCTTTCCTAGAGGCCAGT TGG Intronic
900656404 1:3760874-3760896 AAGCTTCCCTAGGGGCCTGTCGG - Intronic
900659333 1:3774887-3774909 CAGCCTCCCCAGAGGCCAGAAGG + Intronic
902372013 1:16013208-16013230 CAGCTTCCCAAGTGGTCAGTGGG - Intergenic
902732424 1:18378039-18378061 CAGATTTCCTAGAGGCCATGAGG - Intronic
902951659 1:19888310-19888332 CAGATCTCCTAGAGGCCCTTTGG + Intronic
904551916 1:31325718-31325740 CAGCTTTGCTTGGGGCCACTAGG - Intronic
911048664 1:93650894-93650916 CAGTTATCATAGATGCCAGTGGG + Intronic
912456645 1:109802663-109802685 CAGCTGCCCTGGAGCCCAGTGGG + Intergenic
913241729 1:116835729-116835751 AGGCTGCCCTAGAGGCCAGTGGG + Intergenic
918203033 1:182285062-182285084 CAGCTTTGCTACAGGCCTGGAGG + Intergenic
918918929 1:190679840-190679862 GAGATTTCCTAGAGAGCAGTGGG - Intergenic
919356326 1:196527114-196527136 CAGTTTTCCCATAGACCAGTGGG - Intronic
920983065 1:210856423-210856445 AAGCTGTCCTAGAAGTCAGTGGG - Intronic
921329928 1:214025344-214025366 CAGCTTTTCTAGAGGCCTAATGG - Intronic
922980108 1:229818530-229818552 CAGCCTTCCCAGAGGTCAGAAGG + Intergenic
924957596 1:248944587-248944609 CAGTTGTCCTAGTCGCCAGTAGG + Intergenic
1062811642 10:470855-470877 CAGTTCTCACAGAGGCCAGTGGG - Intronic
1065640776 10:27780076-27780098 TTGCTTTCACAGAGGCCAGTAGG + Intergenic
1065973428 10:30822795-30822817 CAGCAATCCTAGAGGCTACTGGG - Intronic
1067093960 10:43286220-43286242 CAGCCCTCCTTGAGGGCAGTGGG + Intergenic
1069880752 10:71591430-71591452 CAGCTCTCCTTGTGTCCAGTGGG - Intronic
1070494087 10:77005528-77005550 CTGCTTTCCTAGAGTTAAGTTGG - Intronic
1070895426 10:79980031-79980053 CTTCTTTCCTTGAGGGCAGTGGG - Intronic
1073473094 10:103735958-103735980 CACCTTTCCTGGAGGGCAGGAGG + Intronic
1074866505 10:117547117-117547139 CAGCTTTCCTAGGGGGCCGTGGG + Intronic
1076149835 10:128153145-128153167 CAGTTTTCTGAGAGCCCAGTTGG + Intergenic
1077413473 11:2414031-2414053 CAGCTCTCCTCGAGGACAGCTGG + Intronic
1078176347 11:8974192-8974214 CAGGTTTCATAAAGACCAGTTGG - Intergenic
1083326286 11:61874582-61874604 CAGCTTTCCAAGATGCAAGCCGG + Intronic
1083778287 11:64905405-64905427 CCGCCTTTCTAGAGGGCAGTTGG - Intronic
1083902286 11:65649505-65649527 CCGCTTTCCCAGAGGCCTGGAGG - Intronic
1084173171 11:67410219-67410241 CACCTTCCCCAGCGGCCAGTGGG - Intronic
1087108991 11:94442407-94442429 AAGCTTTCCTTGACTCCAGTGGG - Intronic
1091630520 12:2156898-2156920 CAGCTTTCCCAGCTGCCACTGGG - Intronic
1092527152 12:9316193-9316215 CAGCTGGCCTAGAGGCTACTGGG + Intergenic
1092540120 12:9415580-9415602 CAGCTGGCCTAGAGGCTACTGGG - Intergenic
1094512920 12:31106876-31106898 CAGCTGGCCTAGAGGCTACTGGG + Intergenic
1095984180 12:47988718-47988740 GAGGATTACTAGAGGCCAGTGGG - Intronic
1096570606 12:52520989-52521011 CAGCTATCCCAGAGCCCACTGGG + Intergenic
1097432054 12:59521845-59521867 CAACTTTTCTAAAGGTCAGTGGG - Intergenic
1098504985 12:71238908-71238930 CACCTTTTCTATAGGTCAGTGGG + Intronic
1098860820 12:75708115-75708137 CTGCTTTCCTAGAGGTTTGTGGG - Intergenic
1100156940 12:91810717-91810739 CCACTGTCCTAGAGGCAAGTCGG - Intergenic
1101512521 12:105405972-105405994 CACCTGGCTTAGAGGCCAGTGGG + Intergenic
1102652852 12:114455030-114455052 CAGGTTTTCTGCAGGCCAGTGGG - Intergenic
1105753467 13:23443585-23443607 CAGCTCTGCTAGAGGCGAGCTGG + Intergenic
1106435736 13:29721614-29721636 CAGCCTTCCTGGAGGCATGTGGG + Intergenic
1107414320 13:40187188-40187210 GAGCCTTCATAGGGGCCAGTGGG - Intergenic
1109586021 13:64406026-64406048 CAGCTTCCCTAGAGGAGTGTTGG + Intergenic
1110411335 13:75206526-75206548 GAGCTCTCCAAGAGGGCAGTTGG + Intergenic
1113994674 14:16056327-16056349 CAGCGTTCCGACAGGGCAGTGGG - Intergenic
1114112824 14:19488615-19488637 CACTTTTCCCAGAGGCCACTAGG + Intergenic
1114599008 14:23939134-23939156 CAGCTTTTCTAGAGGGCAATAGG + Intergenic
1117767025 14:59093823-59093845 CTGCTTTCTTAGAGCACAGTAGG + Intergenic
1118827215 14:69394869-69394891 CAGCCTACCAAGAGGCCAGAAGG - Exonic
1122739376 14:103862566-103862588 CAGGTTTCCTATTGGCCACTTGG + Intergenic
1125143704 15:36440709-36440731 GAGCTTTCCTAGGGGCCACGTGG - Intergenic
1128658355 15:69479061-69479083 CAGGTTTGCTGGAGGTCAGTGGG + Intergenic
1129679289 15:77648943-77648965 CAGGATTCCTGGAGGCCACTGGG - Intronic
1131034079 15:89209813-89209835 CAGCCTGCCTAGAGGCCACCAGG + Intergenic
1131439064 15:92444935-92444957 CGGCCTCCCTACAGGCCAGTAGG + Intronic
1132151782 15:99467306-99467328 CAGCTTGGCTGGAGGCCTGTGGG + Intergenic
1132774685 16:1586487-1586509 CAGCTTTCCTAGAGGCCAGTTGG + Intronic
1132891763 16:2208195-2208217 CAGTTTCCCTAGAGGTCAGGAGG - Exonic
1133116710 16:3581707-3581729 CAGCTGTCCCAGGGGGCAGTGGG - Exonic
1137581552 16:49636592-49636614 CAGCTTTCTTGGTGGCCATTGGG + Exonic
1138140814 16:54567035-54567057 CATCATTACTTGAGGCCAGTGGG - Intergenic
1138726553 16:59146829-59146851 CAGATATTCTAGAGGGCAGTGGG - Intergenic
1143732032 17:8886786-8886808 AAGCCTCCCTGGAGGCCAGTGGG - Intronic
1145904443 17:28508462-28508484 TTGCTTTCTTAGAGGCCAGATGG - Intronic
1146949343 17:36894843-36894865 CAGCTTGGCCAGTGGCCAGTGGG + Intergenic
1148079038 17:44957442-44957464 CACCTTTCCCAGAGGCCACTGGG - Intergenic
1151160501 17:72161107-72161129 TAGCTATGTTAGAGGCCAGTGGG + Intergenic
1157505339 18:48222227-48222249 ATGCTTTCCTAGAGGCAAGAGGG - Intronic
1157999316 18:52597690-52597712 CAGCTCTCCTACAGGCACGTTGG + Intronic
1160364506 18:78312927-78312949 CTGCTTTCCTCTAGGCCAGTGGG + Intergenic
1161175145 19:2837693-2837715 CAGCTTTCCAAGAGAACATTTGG - Intergenic
1162976664 19:14210236-14210258 CTGTTTTCCTAGAGCCCATTCGG + Intergenic
1164906679 19:31973818-31973840 CATCTTGCCCAGAGGACAGTGGG + Intergenic
1165085995 19:33347873-33347895 CAGCTTCCACAGAGGCCAGGGGG - Intergenic
1166543081 19:43618500-43618522 CTGCTCTCCTAGGGGCTAGTAGG - Intronic
1167768406 19:51499381-51499403 CGGGATTCCTTGAGGCCAGTTGG - Intronic
1168728577 19:58606554-58606576 CAGTTGTCCTAGTCGCCAGTAGG + Intergenic
928330459 2:30354275-30354297 CAGCTGTGCTAGAAGACAGTTGG - Intergenic
929789025 2:45010402-45010424 CAGCTTCCATAGAGGCCACACGG - Intergenic
938245875 2:129777394-129777416 CAGGTTTCTTTGTGGCCAGTCGG - Intergenic
938374698 2:130797848-130797870 CCGCTTTCCTAGAGGCTGGGAGG + Intergenic
938807455 2:134819664-134819686 CATTTTTCCTGGATGCCAGTAGG + Intergenic
939273265 2:139967307-139967329 GGGCTTTCCTTGATGCCAGTGGG - Intergenic
940052957 2:149483136-149483158 CATCCTGCCTGGAGGCCAGTGGG - Intergenic
941771687 2:169352080-169352102 CAGCTTCTCTAGAAGCCAGTGGG + Intronic
947678846 2:232011164-232011186 CACCTTTTCTAGGGACCAGTGGG + Intronic
948973651 2:241448865-241448887 CAGCTTTCCCAAGGGCCATTTGG - Intronic
949088836 2:242182196-242182218 CAGTTGTCCTAGTCGCCAGTAGG + Intergenic
1168768407 20:397692-397714 CAGATTACCTGGAGCCCAGTGGG + Intergenic
1170590148 20:17765451-17765473 CAGCCTCCGGAGAGGCCAGTAGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1172106399 20:32519656-32519678 CAGATTTCCTGGAGGCCTCTGGG + Intronic
1173395931 20:42679398-42679420 CAGCTTTCCTTGGTGCAAGTTGG - Intronic
1175124377 20:56740531-56740553 CGGCCATCCTAGAGGCCACTTGG - Intergenic
1175391230 20:58628647-58628669 CAGCTTGCCTAGAAGTCAGAGGG - Intergenic
1178263559 21:31121749-31121771 CTGGCTTCCTAGAGGGCAGTAGG - Intronic
1180264058 21:46698478-46698500 CAGTTGTCCTAGTCGCCAGTAGG + Intergenic
1180312418 22:11251082-11251104 CAGCGTTCCGACAGGGCAGTGGG + Intergenic
1181275140 22:21683334-21683356 CCGCTTTCCTGGAGGTCAGGGGG + Intronic
1182275936 22:29188653-29188675 CAGCTGCCCAGGAGGCCAGTGGG + Intergenic
1182483271 22:30623469-30623491 CAGCCTTCCTAGAGCCCAAGTGG + Intronic
1183255629 22:36759877-36759899 TACCTTTCCTCGAGGCCAGCTGG + Intronic
1183442202 22:37829672-37829694 CAGCCTGCCTAGGGGACAGTGGG + Intergenic
1185430291 22:50806835-50806857 CAGTTGTCCTAGTCGCCAGTAGG + Intergenic
950160611 3:10757971-10757993 CAGCTCTCACAGAGGCAAGTTGG - Intergenic
950572789 3:13812302-13812324 CTGCTTGCCCAGGGGCCAGTGGG - Intergenic
953909690 3:46885552-46885574 CAGCTTCCCTGGAGAGCAGTGGG - Intronic
954333056 3:49901067-49901089 CAGCTTGCCTAGTGGTCAGTGGG - Intronic
955107891 3:55917189-55917211 CTGATTTACTAGAAGCCAGTGGG - Intronic
955434614 3:58889349-58889371 AAGCTTTCCTATTGGCCACTGGG - Intronic
957524921 3:81367620-81367642 CTGCTTTCATAGCTGCCAGTTGG + Intergenic
958987703 3:100801651-100801673 CAATTTTCCTAGAGGCAAGATGG - Intronic
961372498 3:126440139-126440161 CAGCTTGCCTACGGGCCAGCTGG + Intronic
961503447 3:127354428-127354450 CAGCTTTTCCAGAGGACCGTTGG + Intergenic
962285670 3:134084095-134084117 CAGCTTCCCAGGAGGCCAGGAGG - Intronic
963078621 3:141370859-141370881 GAGCTTTCCTATAGACCACTGGG - Intronic
963810026 3:149767201-149767223 CATCTTTCTTAGAGCACAGTGGG - Exonic
971437052 4:26638759-26638781 TACCTTTTCCAGAGGCCAGTTGG + Exonic
971462978 4:26922684-26922706 CAGTTTTCCTGGAGGTCAGTGGG + Intronic
971583272 4:28370936-28370958 CAGCTTTCCCACAGATCAGTTGG + Intronic
972176517 4:36413888-36413910 CAGTTTTCTTAAAGGCCAGAAGG + Intergenic
974450314 4:62047825-62047847 CAGAATTCCTTGAGGCCAATAGG + Intronic
975450995 4:74526682-74526704 AAGCTTTCCTAGAAGCTAGTGGG + Intergenic
977007561 4:91590022-91590044 CAGTTTTCCCAGAAGCCACTAGG - Intronic
982714619 4:158793793-158793815 AAGCTTTCCTATTGGCCACTGGG + Intronic
985466665 4:190203403-190203425 CAGTTGTCCTAGTCGCCAGTAGG + Intergenic
986932925 5:12850057-12850079 CACCTTTCTTAGAGGGCAGGAGG - Intergenic
988103987 5:26719177-26719199 CAGCTTTCCTGGTGGCAAGGAGG + Intergenic
988262553 5:28907560-28907582 CAGCTTTCGTACAGACCAATTGG - Intergenic
992160787 5:73999165-73999187 CAGGTATCCTAGAGGACAATGGG - Intergenic
992438139 5:76774752-76774774 CAGTTTGCCTAGTGGACAGTAGG - Intergenic
992984165 5:82210634-82210656 CAGCTTTCCTAGTTCCTAGTGGG + Intronic
995115466 5:108473187-108473209 CAGCTCTCCTGCAGGCCAGCAGG - Intergenic
1001159737 5:169302053-169302075 GAGCTTTTCCAGATGCCAGTGGG + Intergenic
1001304045 5:170558569-170558591 CAGCTTCCAGAGAGCCCAGTAGG - Intronic
1002837237 6:875147-875169 CACCTTTTCTAGAGTGCAGTGGG - Intergenic
1003690879 6:8352470-8352492 CAGCTGTCCTGGAGGCCCGGTGG + Intergenic
1004954400 6:20712156-20712178 CATCTTGAGTAGAGGCCAGTAGG + Intronic
1005525496 6:26643651-26643673 CAGCTTACCTAGAATCCAGATGG + Exonic
1005527162 6:26662158-26662180 CTTGTTTCCTAGAAGCCAGTAGG + Intergenic
1006730904 6:36235612-36235634 CAGCTTCAGTAGAGGCCAGAAGG - Intergenic
1007849726 6:44791625-44791647 CAGCTTTCCTAGTGGCCCAAGGG + Intergenic
1012982433 6:105844343-105844365 CAGCTTTCCTAGGAGCAAGGAGG + Intergenic
1013365418 6:109433982-109434004 CCAATTTCCTAGAGTCCAGTGGG + Intronic
1013583549 6:111559262-111559284 CAGGTTTCCTGGGGGCCAGAGGG + Exonic
1015616851 6:135086195-135086217 TATCTTTCCTTGAGGCCAGCAGG + Intronic
1020705415 7:11537895-11537917 CAGCATTACTAGAAGCCAGCCGG + Intronic
1021377595 7:19927125-19927147 CAGGTTTACTAGAGGCAAGTAGG + Intergenic
1021810236 7:24395794-24395816 CGGCTTTCCTTCAGGCCTGTGGG + Intergenic
1023480358 7:40627336-40627358 GAGCTTTCCTATTGGCCATTTGG + Intronic
1024013177 7:45287960-45287982 CCTCCTTCCCAGAGGCCAGTGGG + Intergenic
1024724322 7:52175550-52175572 CAGCTTTGGTAGACACCAGTTGG - Intergenic
1025904909 7:65775947-65775969 CAGCCTGCCTAGGGGACAGTGGG + Intergenic
1027432014 7:78124241-78124263 CAGCTTCCCTATAAGCCAGAAGG - Intronic
1028206411 7:88022268-88022290 CTGCTTTCTTAGAGTTCAGTAGG + Intronic
1029526229 7:101095654-101095676 CAGCTTCCCGAGAAGCCACTTGG - Intergenic
1029841559 7:103369939-103369961 CAGCTTTCTCAAAGGCCAGGTGG + Intronic
1033284270 7:140026981-140027003 CTGCCTTCCTGGAGACCAGTGGG - Intronic
1033554273 7:142474785-142474807 AAGCACTCCTAGAGGGCAGTGGG - Intergenic
1033556542 7:142492890-142492912 GAGCCCTCCTAGAGGGCAGTGGG - Intergenic
1037284070 8:17277519-17277541 CAGCTTTCTTGGAGGGCTGTAGG + Intronic
1044802650 8:95973056-95973078 CAGCCTTCCTAGAGTACAGAAGG + Intergenic
1044870448 8:96614706-96614728 AAACTTTCCCAGAGGCCAGTTGG - Intergenic
1046641168 8:116733353-116733375 CCTCTTTCCCAGAGGTCAGTGGG + Intronic
1048347120 8:133584512-133584534 CAGGTTCCATAGAGGCTAGTTGG - Intergenic
1048714217 8:137249704-137249726 CAGCTTTGCCAAAGGTCAGTTGG - Intergenic
1050676762 9:8064243-8064265 CAGTTTTCCTGAAGCCCAGTGGG - Intergenic
1051009013 9:12387258-12387280 CAGTTTGACCAGAGGCCAGTGGG - Intergenic
1053472612 9:38357721-38357743 CAGCTTACCTAGAGGTCACAAGG + Intergenic
1056417081 9:86387314-86387336 CATAGTTCCTAGAGGCCAGTAGG - Intergenic
1057294829 9:93828732-93828754 CAGCTCTCCGAGAGGCCACCCGG - Intergenic
1059315237 9:113419355-113419377 CAGAAATCCTAGAAGCCAGTGGG + Intronic
1060134727 9:121142323-121142345 CAGCTGACCTAGTTGCCAGTGGG - Intronic
1060818852 9:126650308-126650330 CATCTTTTCTAGGGGCCAGAGGG + Intronic
1186119155 X:6339830-6339852 CTGGTTTCATAGAGTCCAGTGGG + Intergenic
1188779323 X:34260838-34260860 CAGCATTCATGGAGACCAGTAGG - Intergenic
1194379527 X:93176559-93176581 CAGCTCTCCTAGTGGCCATCTGG + Intergenic
1195535841 X:106008482-106008504 CAAGTTTCCAAGAAGCCAGTTGG - Intergenic
1197824671 X:130575993-130576015 CAGCGTTCCTAGTGGCCAACAGG - Intergenic