ID: 1132775677

View in Genome Browser
Species Human (GRCh38)
Location 16:1592598-1592620
Sequence CTGTCCTAACACGTGGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132775677_1132775689 18 Left 1132775677 16:1592598-1592620 CCCAACACCACGTGTTAGGACAG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1132775689 16:1592639-1592661 TGGTGGAGGGACAGGTGTCCTGG 0: 5
1: 6
2: 5
3: 33
4: 342
1132775677_1132775690 30 Left 1132775677 16:1592598-1592620 CCCAACACCACGTGTTAGGACAG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1132775690 16:1592651-1592673 AGGTGTCCTGGCAGAGCGACTGG 0: 1
1: 7
2: 6
3: 12
4: 137
1132775677_1132775685 4 Left 1132775677 16:1592598-1592620 CCCAACACCACGTGTTAGGACAG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1132775685 16:1592625-1592647 CCCGGCAGAGCGACTGGTGGAGG 0: 2
1: 6
2: 4
3: 10
4: 105
1132775677_1132775683 1 Left 1132775677 16:1592598-1592620 CCCAACACCACGTGTTAGGACAG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1132775683 16:1592622-1592644 TGTCCCGGCAGAGCGACTGGTGG 0: 2
1: 4
2: 6
3: 7
4: 103
1132775677_1132775682 -2 Left 1132775677 16:1592598-1592620 CCCAACACCACGTGTTAGGACAG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1132775682 16:1592619-1592641 AGGTGTCCCGGCAGAGCGACTGG 0: 2
1: 4
2: 6
3: 11
4: 87
1132775677_1132775688 10 Left 1132775677 16:1592598-1592620 CCCAACACCACGTGTTAGGACAG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1132775688 16:1592631-1592653 AGAGCGACTGGTGGAGGGACAGG 0: 2
1: 6
2: 4
3: 23
4: 275
1132775677_1132775687 5 Left 1132775677 16:1592598-1592620 CCCAACACCACGTGTTAGGACAG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1132775687 16:1592626-1592648 CCGGCAGAGCGACTGGTGGAGGG 0: 2
1: 3
2: 6
3: 4
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132775677 Original CRISPR CTGTCCTAACACGTGGTGTT GGG (reversed) Intronic
903240737 1:21981045-21981067 CGGACCTACCAGGTGGTGTTGGG + Exonic
903244475 1:22005669-22005691 CTGACCTACCAGGTGGTGTTGGG + Exonic
912183816 1:107250439-107250461 CTGTGAAAACATGTGGTGTTTGG + Intronic
1063094929 10:2900705-2900727 CTCTCCTGACACCTGCTGTTGGG - Intergenic
1068979684 10:63049120-63049142 CAGTCTTAACAAATGGTGTTGGG + Intergenic
1070799648 10:79237816-79237838 CTTTCCTAGGACCTGGTGTTAGG + Intronic
1073943119 10:108720128-108720150 CTGCCCTGACAGGGGGTGTTGGG - Intergenic
1075693980 10:124419823-124419845 ATTTCCTAAAACGTGGTGGTGGG + Intergenic
1077761953 11:5111142-5111164 ATGTCAGAACATGTGGTGTTTGG + Intergenic
1081077430 11:38694035-38694057 AAGTGATAACACGTGGTGTTTGG - Intergenic
1089897725 11:121948661-121948683 CTGTACTAACACGTGGTTCCAGG - Intergenic
1090256406 11:125287610-125287632 CTGGAGCAACACGTGGTGTTGGG + Intronic
1090268060 11:125366963-125366985 CTCTCCCCACATGTGGTGTTGGG - Intronic
1111814598 13:93134975-93134997 CTCTCCTCACACGTGGTGCATGG - Intergenic
1114371286 14:22091709-22091731 GAGTCAGAACACGTGGTGTTTGG - Intergenic
1115726506 14:36223135-36223157 CTGTCCTGAGAAGTGGTGTATGG + Intergenic
1116408883 14:44600103-44600125 CTGTTCTAAGACTTGCTGTTTGG - Intergenic
1119621835 14:76137298-76137320 CAGACCTGACACCTGGTGTTTGG - Intergenic
1121416587 14:93783498-93783520 TTGTCCCAACACCTGGCGTTTGG + Intronic
1122235580 14:100329182-100329204 CTGTCCTGACTCTTGGTGTTGGG - Intronic
1122469352 14:101955849-101955871 CTGTCCTGGCACGTGGGGCTGGG - Intergenic
1130538413 15:84803139-84803161 CTTTCCTGACAGGTGGGGTTGGG + Exonic
1132775677 16:1592598-1592620 CTGTCCTAACACGTGGTGTTGGG - Intronic
1146557635 17:33840262-33840284 CTCCCCTAACACTTGGTGTGTGG - Intronic
1150437884 17:65168169-65168191 CTGGCCTTACACGTGGCTTTTGG + Intronic
1152368735 17:79871863-79871885 CTGGCTTAACACCTGGTGTCTGG + Intergenic
1153299649 18:3581504-3581526 CTTTCCTGACAGGTGGGGTTGGG + Intronic
1157366711 18:47071590-47071612 CTGTCATGAAAAGTGGTGTTTGG + Intronic
1157724314 18:49952123-49952145 CTGTTCTATCACGTGGTGAGGGG - Intronic
933442538 2:82331627-82331649 GTATCCTAACTCGTGGGGTTTGG + Intergenic
936784270 2:116074387-116074409 CTGTGAGAACATGTGGTGTTTGG - Intergenic
937019440 2:118636725-118636747 CAGTCAGAACATGTGGTGTTTGG + Intergenic
939690648 2:145255900-145255922 CTGTCATAAGACATTGTGTTTGG + Intergenic
943014397 2:182493833-182493855 CCAGCCTAACATGTGGTGTTTGG - Intronic
945598216 2:211822840-211822862 CTTTCCTATCACTTGGTTTTAGG + Intronic
1171024039 20:21612551-21612573 CTGTTCTAACACGTGCCATTTGG + Intergenic
950832088 3:15885083-15885105 CTGTCCTAAGAAGTTGTGGTAGG + Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955666165 3:61351048-61351070 CTGTCCTGACATGTGGTGGCAGG - Intergenic
956861630 3:73329763-73329785 CTTTCTTCACACGAGGTGTTGGG - Intergenic
972799386 4:42458327-42458349 CTGTCCCAGCAAGTGGTGCTGGG - Intronic
983985478 4:174054282-174054304 CTGGCCTATCACGTGAGGTTAGG - Intergenic
984167381 4:176319568-176319590 CTGTCCTGACGGGTGGCGTTTGG - Intergenic
984692681 4:182745874-182745896 TTGTACTAACTCCTGGTGTTTGG + Intronic
990480102 5:56202052-56202074 CAGTGAGAACACGTGGTGTTTGG - Intronic
993783303 5:92097074-92097096 GTGTTCTAACACGTGTTGTGAGG + Intergenic
994333245 5:98532847-98532869 CAGTGATAACATGTGGTGTTTGG + Intergenic
994885698 5:105558556-105558578 GTGACCTAATAGGTGGTGTTTGG + Intergenic
995329178 5:110927749-110927771 CAGTGAGAACACGTGGTGTTTGG + Intergenic
1004565102 6:16788936-16788958 ATGTCCTCACACATGGTGTGAGG + Intergenic
1007593592 6:43038082-43038104 CTGTCCTAGCAGCTGGTGGTTGG - Intronic
1025753373 7:64312300-64312322 CTGTGCTATCAGGTGGTGATGGG + Intronic
1028221746 7:88204829-88204851 GTGTCCTAGCACCTGCTGTTTGG - Intergenic
1034963491 7:155376947-155376969 CTGTCCAGACACGTTGTGTTTGG - Intergenic
1043429738 8:80183256-80183278 ATGTCCTAACACGTGGGGACTGG - Intronic
1044112892 8:88298257-88298279 CTATCCTAACATGGGGTGTTTGG - Intronic
1046817145 8:118597232-118597254 CTGTCCTATCAGCTGCTGTTTGG + Intronic
1046980500 8:120331307-120331329 CTATAGTAACAGGTGGTGTTTGG + Intronic
1050136155 9:2467039-2467061 CTTTCCCAAAACGTTGTGTTTGG + Intergenic
1058565398 9:106279042-106279064 CTTTCCTAACAGTTGGTGTCAGG + Intergenic
1060241944 9:121911694-121911716 CCGTGAGAACACGTGGTGTTTGG - Intronic
1060534958 9:124378317-124378339 CTGTGCTCACACGATGTGTTTGG + Intronic
1189491604 X:41474861-41474883 GTGGCCCAGCACGTGGTGTTTGG + Exonic
1192079041 X:68030148-68030170 CTGGCCTAACACATGCTTTTTGG + Intergenic
1192231405 X:69267632-69267654 CTGTCCTAATCTGTGGTGTTGGG - Intergenic
1194022922 X:88715965-88715987 CTCCCCTAACATGTGGTGTTTGG - Intergenic
1199677653 X:150201290-150201312 CTGTCCTAATACTGGGTGCTCGG + Intergenic