ID: 1132779330

View in Genome Browser
Species Human (GRCh38)
Location 16:1614276-1614298
Sequence CCCGGCGCGGGCGCGGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 256}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132779330_1132779343 1 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779343 16:1614300-1614322 CTCCCATAGACCCCGGGGCCGGG 0: 1
1: 0
2: 1
3: 16
4: 166
1132779330_1132779348 7 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779348 16:1614306-1614328 TAGACCCCGGGGCCGGGGCCGGG 0: 1
1: 0
2: 2
3: 25
4: 274
1132779330_1132779341 -4 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779341 16:1614295-1614317 CGGGGCTCCCATAGACCCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 94
1132779330_1132779347 6 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779347 16:1614305-1614327 ATAGACCCCGGGGCCGGGGCCGG 0: 1
1: 0
2: 0
3: 15
4: 213
1132779330_1132779360 24 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779360 16:1614323-1614345 GCCGGGGCCGGGGCCGGGCAGGG 0: 1
1: 11
2: 141
3: 429
4: 2125
1132779330_1132779344 2 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779344 16:1614301-1614323 TCCCATAGACCCCGGGGCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1132779330_1132779359 23 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779359 16:1614322-1614344 GGCCGGGGCCGGGGCCGGGCAGG 0: 4
1: 25
2: 125
3: 636
4: 3151
1132779330_1132779358 19 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779358 16:1614318-1614340 CCGGGGCCGGGGCCGGGGCCGGG 0: 84
1: 114
2: 261
3: 819
4: 3593
1132779330_1132779340 -5 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779340 16:1614294-1614316 CCGGGGCTCCCATAGACCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 169
1132779330_1132779355 14 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779355 16:1614313-1614335 CGGGGCCGGGGCCGGGGCCGGGG 0: 79
1: 138
2: 262
3: 934
4: 3910
1132779330_1132779356 18 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779356 16:1614317-1614339 GCCGGGGCCGGGGCCGGGGCCGG 0: 88
1: 131
2: 309
3: 1459
4: 4385
1132779330_1132779338 -6 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779338 16:1614293-1614315 GCCGGGGCTCCCATAGACCCCGG 0: 1
1: 0
2: 0
3: 14
4: 154
1132779330_1132779352 12 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779352 16:1614311-1614333 CCCGGGGCCGGGGCCGGGGCCGG 0: 3
1: 109
2: 197
3: 693
4: 3231
1132779330_1132779342 0 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779342 16:1614299-1614321 GCTCCCATAGACCCCGGGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 135
1132779330_1132779349 8 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779349 16:1614307-1614329 AGACCCCGGGGCCGGGGCCGGGG 0: 1
1: 2
2: 5
3: 80
4: 704
1132779330_1132779354 13 Left 1132779330 16:1614276-1614298 CCCAGACCCGCGCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1132779354 16:1614312-1614334 CCGGGGCCGGGGCCGGGGCCGGG 0: 84
1: 114
2: 261
3: 819
4: 3593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132779330 Original CRISPR CCCGGCGCGGGCGCGGGTCT GGG (reversed) Intronic