ID: 1132782469

View in Genome Browser
Species Human (GRCh38)
Location 16:1635317-1635339
Sequence CACACGCAAGGCCCCCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132782469_1132782471 2 Left 1132782469 16:1635317-1635339 CCAGCTTGGGGGCCTTGCGTGTG 0: 1
1: 1
2: 1
3: 11
4: 106
Right 1132782471 16:1635342-1635364 TTCGTCTTACTAATCTCCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132782469 Original CRISPR CACACGCAAGGCCCCCAAGC TGG (reversed) Intronic
900316853 1:2061273-2061295 CAGACCCCAGGCCCCCAGGCAGG - Intronic
900323184 1:2095047-2095069 CACACCCCAGGCCCCGTAGCAGG + Intronic
900586933 1:3437120-3437142 CACACCCCAGGGCCCCAGGCAGG - Exonic
900620084 1:3582717-3582739 CTCATGGGAGGCCCCCAAGCAGG - Intronic
900908098 1:5575019-5575041 CACATGCAAGTGCCCCCAGCTGG - Intergenic
900922318 1:5681049-5681071 CTCCAGCAAGGCCTCCAAGCAGG - Intergenic
901426135 1:9183143-9183165 CCCACGCAAGGTCCCCAGCCTGG - Intergenic
902617431 1:17631383-17631405 CACACCCCAGGCATCCAAGCAGG - Intronic
902633554 1:17720081-17720103 CTCACCCAAGGCCCCACAGCTGG - Intergenic
904044572 1:27602168-27602190 CAGCCCCAGGGCCCCCAAGCTGG + Intronic
917886865 1:179394810-179394832 GACATGCAAGGCCGCCATGCTGG - Intronic
918158262 1:181872263-181872285 CTCTCGCAGGGTCCCCAAGCAGG + Intergenic
919714514 1:200761847-200761869 CACACAGAAGGCCTCTAAGCTGG + Intronic
919849408 1:201662504-201662526 CACACGCATGACTCCAAAGCTGG - Intronic
920234441 1:204493667-204493689 CACAAGCAAGGCTGCCAAGCTGG - Intronic
921856323 1:219989434-219989456 CACAGGCAAAGGGCCCAAGCTGG + Intronic
922632111 1:227126027-227126049 CACACCCAAGGGGCTCAAGCAGG + Intronic
922649532 1:227325567-227325589 AATAAGAAAGGCCCCCAAGCCGG + Intergenic
1062950161 10:1492968-1492990 CACACGAAATGCTCCCAAGAAGG + Intronic
1066457594 10:35585445-35585467 CACATGCAATGCCCTAAAGCTGG - Intergenic
1073136374 10:101222806-101222828 CGCTCGCCAGGCCACCAAGCCGG + Intergenic
1073631776 10:105156655-105156677 CAGATGCCAGGCCTCCAAGCTGG + Intronic
1075297346 10:121289710-121289732 CACACACAAAGCCCCCAGGAAGG + Intergenic
1079182346 11:18204717-18204739 CAATCCCAAGGCCCCCAGGCAGG - Intronic
1083624960 11:64067636-64067658 CACACACAGGGTCCCCAAGCAGG + Intronic
1095431184 12:42136801-42136823 CACACACAAGTCGCCCAGGCTGG + Intronic
1096070510 12:48773107-48773129 CCCAGGCAAAGCCCCCAAGCAGG + Intronic
1103834060 12:123804957-123804979 CACAGGCAAGGCCCCCAAGCTGG + Exonic
1105293777 13:19071311-19071333 CACAAGCAAGGGCCCCTTGCGGG + Intergenic
1107553967 13:41501477-41501499 CACACAAAAGGCACCAAAGCAGG - Intergenic
1107908732 13:45085552-45085574 CACATGCAAGGCCTCCTAGATGG - Intergenic
1110190839 13:72727461-72727483 CAGAGCCAAGGCCCCCAGGCGGG - Intronic
1112570545 13:100589225-100589247 CACCACCAAGGCCCCCCAGCTGG + Intronic
1118726860 14:68634810-68634832 CACACCAAAGCCCCCCAAGCTGG - Intronic
1122482177 14:102054366-102054388 CACACCGAAGGCCGCCAAGGTGG + Intergenic
1132240337 15:100252951-100252973 CACATCCAAGGCCACCCAGCTGG + Intronic
1132782469 16:1635317-1635339 CACACGCAAGGCCCCCAAGCTGG - Intronic
1136297610 16:29312602-29312624 CACACCCCAGTCCCCCAAGATGG - Intergenic
1137568781 16:49551111-49551133 CCCACGGAAGGCCCTCAAGCTGG + Intronic
1140272550 16:73479861-73479883 CACCCTCAAGGTCCCCAAGGAGG - Intergenic
1142059162 16:88018680-88018702 CACACCCCAGTCCCCCAAGGCGG - Intronic
1142205674 16:88781902-88781924 CACACCCACGGCCGGCAAGCTGG - Intronic
1149955370 17:61043508-61043530 CACAGGCAATGGCCCCAGGCAGG - Intronic
1150656549 17:67043534-67043556 CACCCGCCTGGCCCCCAGGCTGG - Intergenic
1152197881 17:78928273-78928295 AACACGCAAGGCCCCAAGGTTGG + Intergenic
1152243870 17:79175311-79175333 CTCACGCTAGGCCACCAGGCTGG + Intronic
1155438077 18:25833735-25833757 CACAGGAAAGGCCCCCAGGAGGG + Intergenic
1161466231 19:4432167-4432189 GACGCCCAAGGCCTCCAAGCGGG + Exonic
1161601918 19:5189417-5189439 CTCAAGCCAGGCCCACAAGCCGG - Intronic
1164812773 19:31171166-31171188 CCCAGGCAAGGCTACCAAGCGGG - Intergenic
1166376195 19:42328516-42328538 GACAGGAATGGCCCCCAAGCTGG - Intronic
1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG + Intergenic
929313250 2:40450087-40450109 CACTCACAAGGCCCCAAAGATGG + Intronic
930754433 2:54960508-54960530 CACACCCAAGGTCACCCAGCTGG - Intronic
933759986 2:85666481-85666503 CACACACACAGCACCCAAGCCGG - Intronic
935730992 2:106065210-106065232 CAGAAGCAAGGCCCCCAAGCAGG + Intronic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
1168793951 20:598675-598697 CAAACGCCAGCCCCCCCAGCCGG + Intergenic
1168969407 20:1920517-1920539 CAGACACAGGGCGCCCAAGCAGG - Intronic
1172315219 20:33948750-33948772 CACTCACAAGGCCAGCAAGCTGG - Intergenic
1173499371 20:43540990-43541012 AGCACACAAGGTCCCCAAGCTGG - Exonic
1173573799 20:44096897-44096919 CACACTCAAGGCCCTCCATCTGG - Intergenic
1173926085 20:46782436-46782458 CCCGCTCAAGGCCTCCAAGCTGG + Intergenic
1174286652 20:49478928-49478950 GACAAGCAAGGCATCCAAGCTGG + Intronic
1175163376 20:57025143-57025165 CAGAAGCAGGGCCTCCAAGCTGG + Intergenic
1175171231 20:57082748-57082770 CACATGCAAGGCCCTCAGGCAGG + Intergenic
1176153607 20:63606786-63606808 GAAACGCAAAGGCCCCAAGCAGG + Intronic
1176370350 21:6058539-6058561 CAGATGCAAGGCCCCCAAAGTGG - Intergenic
1179114242 21:38475528-38475550 CAAAGGCAAGGACCCCAAGGCGG - Intronic
1179753169 21:43480002-43480024 CAGATGCAAGGCCCCCAAAGTGG + Intergenic
1179836333 21:44036375-44036397 CTCACGCAAGGCCCTCAGGGTGG - Intronic
1182702603 22:32252733-32252755 CATATGCAAAGACCCCAAGCTGG + Intronic
950365824 3:12483447-12483469 CAGAGGCAAGTCACCCAAGCAGG + Intergenic
956782972 3:72618991-72619013 CACACGCAAGGCCCCTCTGGAGG - Intergenic
961518344 3:127452506-127452528 CCCAGGCAAGGCCCCCTGGCAGG - Intergenic
966362975 3:179149073-179149095 CAAACGCAGGGCCGCCAGGCTGG - Intronic
969105994 4:4807458-4807480 CTCACACAAGGCCCTGAAGCTGG - Intergenic
969643342 4:8412257-8412279 CACTCCCAAGGCCCCACAGCAGG + Intronic
973249439 4:48046280-48046302 CACAGGGCAGGCTCCCAAGCAGG - Intergenic
974057018 4:56993479-56993501 GACACTCAAGTCTCCCAAGCTGG - Intronic
985704678 5:1393576-1393598 CGCATGCAGGGCCCCCATGCAGG - Exonic
989004162 5:36791235-36791257 CCCACTCAATGCCCTCAAGCAGG + Intergenic
994509297 5:100683982-100684004 CCCATGCAAGGCCCAAAAGCTGG - Intergenic
997584963 5:135038701-135038723 CAAAGGCAGGGCCCCAAAGCCGG - Intronic
998705782 5:144758494-144758516 CACACGTTAGGCCACAAAGCAGG - Intergenic
999119409 5:149197757-149197779 CTCACGCAAGGCCACACAGCTGG - Intronic
1000432696 5:161168806-161168828 AACACGCAAGGCCACAGAGCTGG - Intergenic
1001966133 5:175911136-175911158 CCCATGCAGGCCCCCCAAGCAGG + Intergenic
1002250812 5:177928066-177928088 CCCATGCAGGCCCCCCAAGCAGG - Intergenic
1006060106 6:31412988-31413010 CACAGGCAGGGCCCCCAGGCTGG - Intronic
1006337210 6:33426988-33427010 CCCACCCAAGGTCCCCAAACCGG - Intronic
1016378962 6:143453463-143453485 CACACCCAAACCCCCCAAACTGG - Intronic
1018380819 6:163256614-163256636 CACATGCAAAGGCCCCAAGAAGG + Intronic
1019571812 7:1716369-1716391 CACATGCCAGGGCCCCAAGAGGG - Intronic
1021016826 7:15546475-15546497 CCCATGCAAGGCACACAAGCAGG - Intronic
1021578621 7:22128782-22128804 CACACGCAAGCCCGTCAGGCAGG - Intronic
1026977158 7:74505795-74505817 CGCATGCAAGACCCTCAAGCGGG + Intronic
1032080715 7:128857154-128857176 GACAGACAAGGCCCCCGAGCCGG - Exonic
1033418066 7:141181923-141181945 CACAGGCAAGGGATCCAAGCTGG - Intronic
1035201917 7:157273108-157273130 CACATCCCAGGGCCCCAAGCCGG - Intergenic
1035594348 8:843452-843474 CCCAAGCCAGGCCCCAAAGCCGG - Intergenic
1035649627 8:1255002-1255024 CACACACACAGCGCCCAAGCAGG - Intergenic
1035649768 8:1255848-1255870 CACACACACGGCACCCAGGCAGG - Intergenic
1035649867 8:1256414-1256436 CAGACGCACAGCGCCCAAGCAGG - Intergenic
1038384843 8:27133906-27133928 CAAACAAAAGGCCCCAAAGCAGG - Intergenic
1040415267 8:47189376-47189398 CCCACGCAGGACCCCCAAGCGGG + Intergenic
1054885380 9:70192080-70192102 AACAGGCAAGTCCCCCAAGGTGG + Intronic
1056771709 9:89482239-89482261 CACCAGCAAGGCCACCAAGCAGG + Intronic
1057883325 9:98809065-98809087 CCCACCCAAGGCCCCTCAGCTGG + Intronic
1062026052 9:134341335-134341357 CACACGCCAGAACCCCAGGCTGG - Intronic
1062289031 9:135786367-135786389 GAGCCGCAAGGCGCCCAAGCAGG + Exonic
1062347745 9:136123182-136123204 CCGACGCAGAGCCCCCAAGCTGG + Intergenic
1062585230 9:137246242-137246264 CACACGCAGGGCCCACCAGGAGG + Intronic
1203745541 Un_GL000218v1:39056-39078 CACACCCAACACCCCCAAGCTGG - Intergenic
1203613866 Un_KI270749v1:35029-35051 CACTGGCAATGCCTCCAAGCAGG - Intergenic
1187610604 X:20939182-20939204 CTCACCCAAGGCCCTCAACCTGG + Intergenic
1188005821 X:25015256-25015278 CACACCCAAGGCCACCAAAAGGG + Intronic
1190333751 X:49250644-49250666 CACACGCACAGCCCCCCAGTGGG - Exonic
1190399085 X:50013790-50013812 CATAGGCAAGGCTCACAAGCTGG - Intronic
1190431993 X:50386963-50386985 CACACACCAAGCACCCAAGCAGG - Intronic