ID: 1132782702

View in Genome Browser
Species Human (GRCh38)
Location 16:1636850-1636872
Sequence CAGTGGCTCTTGAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 267}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132782697_1132782702 -4 Left 1132782697 16:1636831-1636853 CCTTGGTGACAGCTCCAGGCAGT 0: 1
1: 0
2: 1
3: 27
4: 232
Right 1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG 0: 1
1: 0
2: 1
3: 31
4: 267
1132782693_1132782702 17 Left 1132782693 16:1636810-1636832 CCCATTCTTGTGCTTGGCTGTCC 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG 0: 1
1: 0
2: 1
3: 31
4: 267
1132782692_1132782702 20 Left 1132782692 16:1636807-1636829 CCTCCCATTCTTGTGCTTGGCTG 0: 1
1: 0
2: 0
3: 18
4: 180
Right 1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG 0: 1
1: 0
2: 1
3: 31
4: 267
1132782689_1132782702 28 Left 1132782689 16:1636799-1636821 CCCAGGTGCCTCCCATTCTTGTG 0: 1
1: 0
2: 0
3: 22
4: 604
Right 1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG 0: 1
1: 0
2: 1
3: 31
4: 267
1132782690_1132782702 27 Left 1132782690 16:1636800-1636822 CCAGGTGCCTCCCATTCTTGTGC 0: 1
1: 0
2: 0
3: 36
4: 1064
Right 1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG 0: 1
1: 0
2: 1
3: 31
4: 267
1132782694_1132782702 16 Left 1132782694 16:1636811-1636833 CCATTCTTGTGCTTGGCTGTCCT 0: 1
1: 0
2: 0
3: 35
4: 249
Right 1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG 0: 1
1: 0
2: 1
3: 31
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132782702 Original CRISPR CAGTGGCTCTTGAGGAAAGA GGG Intronic
900213187 1:1467457-1467479 CAGTGGCTCTTGGTGAGGGATGG + Intronic
900220751 1:1508278-1508300 CAGTGGCTCTTGGCGAGGGATGG + Intergenic
901784162 1:11613566-11613588 CAGTGGACTTTGAGGAAAGCAGG - Intergenic
902996647 1:20230533-20230555 CAGTGGCACTTCAGGCAGGAAGG + Intergenic
907645182 1:56235242-56235264 CAGCGGCTCCTGAGGCAAGGAGG + Intergenic
908050727 1:60227043-60227065 CAGCAGCTACTGAGGAAAGAAGG + Intergenic
914406341 1:147377494-147377516 CTGTGGCTCTTGGAGGAAGAAGG - Intergenic
915250947 1:154588082-154588104 CAGAGCCTTTTGAGGAAAGGAGG + Intronic
915562021 1:156693062-156693084 CAGTCGCACCTGAGGAAAAAGGG - Intergenic
916186898 1:162142237-162142259 CAGTGGCTCTGTAAGGAAGATGG + Intronic
919351454 1:196459953-196459975 CACTGGCTTTTGAGAAAAGAAGG - Intronic
920069014 1:203289331-203289353 CACTGGCTCCTGAGGAAGGAAGG + Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1062821189 10:535660-535682 CATTGCATCTTGAGAAAAGATGG - Intronic
1063103255 10:2969990-2970012 CAGTGGCTCTTGAGGAAAACAGG + Intergenic
1063113935 10:3060093-3060115 CAGTGGCTGGCAAGGAAAGAAGG + Intergenic
1063202848 10:3801598-3801620 CAAGGGCTCTGGGGGAAAGATGG + Intergenic
1065860143 10:29865699-29865721 CAGGGGCTTCTGAGAAAAGAGGG + Intergenic
1067404652 10:46010614-46010636 AAGTGGCTTCTGAAGAAAGAAGG - Exonic
1067673122 10:48344345-48344367 CAGTAGCTCTTTAGGAATAAAGG - Intronic
1067784158 10:49230266-49230288 CAGGGGCCCGGGAGGAAAGATGG + Intergenic
1069194996 10:65540298-65540320 CACTTACTCTTGAGCAAAGAAGG + Intergenic
1069624968 10:69861966-69861988 AAGTGGCTCTTGGGGTAAGGTGG + Intronic
1069681170 10:70286480-70286502 ATGTGGCTGCTGAGGAAAGAAGG - Intergenic
1070279395 10:75037794-75037816 CAGAGGCACTTGGGGACAGAGGG - Intergenic
1072571905 10:96665752-96665774 CAGAGGTTACTGAGGAAAGAAGG + Intronic
1074507972 10:114087973-114087995 GAGTGTCTATTGTGGAAAGATGG + Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076579981 10:131500914-131500936 AAGTAGCTCTTGAGAAAAAAAGG + Intergenic
1076863750 10:133157133-133157155 CTGTGGCTCTGGCGGAAACACGG - Intergenic
1077440323 11:2565873-2565895 CACTGGGTCTGGAGGAAGGAGGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078637339 11:13064309-13064331 CAGGGGCTGCTGAGCAAAGATGG + Intergenic
1081837267 11:46166192-46166214 CAGAGGCCCTTGAGGACAGCAGG + Intergenic
1082914609 11:58418802-58418824 CAGTGGCGCTAGAGGAATTAAGG - Intergenic
1082932097 11:58618729-58618751 CAGTGGCTTTTAAAGAAAGCTGG + Exonic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1085462176 11:76700792-76700814 GGGTGGCTCTGGAGGCAAGAGGG + Intergenic
1085713344 11:78850553-78850575 CAGGGACTCTTGGGGAAAGCGGG + Intronic
1086094167 11:83033976-83033998 GACTTGCTCTTGAGGACAGATGG - Intronic
1086175024 11:83880845-83880867 CAGTGGCTACTGTGGACAGATGG - Intronic
1086965560 11:93024298-93024320 AAGTGGCTGATGAGGAAAGTTGG + Intergenic
1087339210 11:96881229-96881251 ATGTGTCTCATGAGGAAAGAAGG - Intergenic
1089529470 11:119116921-119116943 CAGTGGCTCTGTGGGAAGGAGGG + Exonic
1091032659 11:132204873-132204895 CAGTGGCCCTTGGGAAAAGATGG + Intronic
1091714211 12:2765525-2765547 CAGTGACTGAGGAGGAAAGAGGG + Intergenic
1092107067 12:5928987-5929009 AAGTGACTAATGAGGAAAGAAGG - Intronic
1092107073 12:5929061-5929083 AAGTGACTAATGAGGAAAGAAGG - Intronic
1092350096 12:7749224-7749246 CCTTGGCTCTTGAGGGAGGATGG + Exonic
1092805807 12:12221062-12221084 CATTGGTTCTTAAGGAGAGAGGG - Intronic
1093022855 12:14219325-14219347 CGGTGGCTCTGAAAGAAAGAAGG + Intergenic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1095310403 12:40691924-40691946 CAGTTTTTCTTGAGAAAAGACGG - Intergenic
1097200825 12:57277169-57277191 CACTGGCTCTTGATGACAAAAGG + Intronic
1098052699 12:66471131-66471153 AAGTGGCTCTGGAGGTAAAAAGG + Intronic
1098422063 12:70308607-70308629 CAGTGACTCTTGAGAAAATCTGG + Intronic
1100385014 12:94098058-94098080 CCGAGGCTATTCAGGAAAGAGGG - Intergenic
1104786408 12:131452449-131452471 CAGTGGGTCATGAGGAACAAGGG + Intergenic
1105672920 13:22640814-22640836 CTGTGACTATTGAGGAAAGACGG - Intergenic
1105766417 13:23564516-23564538 CAGGGGCTCTAGGGGAAGGAGGG + Intergenic
1106499965 13:30318465-30318487 CAGTGGCAGTTCAGGAAAAAGGG - Intergenic
1108576912 13:51798805-51798827 CAGAGCCTCTTCAGGAAAAATGG - Intronic
1109531996 13:63662221-63662243 CAGGGATTCTTGAGAAAAGAGGG - Intergenic
1109720148 13:66265553-66265575 CAGTGACTCCTGATGGAAGAAGG + Intergenic
1109838705 13:67893532-67893554 CATTGGCACTGGAGGAATGAAGG + Intergenic
1109896530 13:68698801-68698823 CAGTTCCTCTTTAGGAAAAATGG + Intergenic
1110397300 13:75045925-75045947 CATTAGCTGTTGTGGAAAGATGG - Intergenic
1110662056 13:78067924-78067946 CAGTGTTTCTTCAGGAAAGCAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1114769892 14:25417078-25417100 CAGTGCCACCTGAGGAAGGAAGG - Intergenic
1118448981 14:65880109-65880131 AAGTGGCTTCTGAAGAAAGAAGG - Intergenic
1118452582 14:65917600-65917622 CTGTGGTTCCTGAGAAAAGAGGG - Intergenic
1118740680 14:68737295-68737317 CAGTGGCTTATATGGAAAGAGGG + Intergenic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1119965824 14:78914520-78914542 AGGTGGCATTTGAGGAAAGATGG + Intronic
1120154397 14:81076623-81076645 AAGTGGGTGATGAGGAAAGAAGG - Intronic
1120212459 14:81646989-81647011 CTGTGGCACTTCAGGAAAGTGGG - Intergenic
1120270378 14:82306366-82306388 CAGATGATCCTGAGGAAAGATGG - Intergenic
1120381175 14:83781713-83781735 GAGTGGCTCTAGAAGAGAGAGGG + Intergenic
1121058029 14:90876946-90876968 CACTGGCTCTTCAGAAAAGATGG + Intronic
1123932379 15:25178098-25178120 CAGTGCACCTTGAGGAAAGGAGG + Intergenic
1125509704 15:40286371-40286393 TGGTGACACTTGAGGAAAGAAGG - Intronic
1126420166 15:48464187-48464209 GTGTGCCTTTTGAGGAAAGAGGG + Intronic
1127065556 15:55234153-55234175 CAGTTGCAGATGAGGAAAGATGG - Intronic
1129389852 15:75215022-75215044 CAGAGGCTCTTGAAGAAGCAAGG - Intergenic
1129968006 15:79753998-79754020 CAGTCTGTCTTAAGGAAAGAGGG - Intergenic
1130000048 15:80038408-80038430 CAGTGGATTTTGAGTAAAGTTGG - Intergenic
1130098931 15:80877292-80877314 CTGTGTCTCTTGAGCAAAGAAGG - Intronic
1130760001 15:86809343-86809365 CAGGGGCTTTTGAGGGTAGAAGG - Intronic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1134095043 16:11413467-11413489 CTGTGGCTCTTGGAGAAGGAGGG + Intronic
1135496604 16:22956912-22956934 CTGTGGCTCCTGGGGAGAGAGGG + Intergenic
1137323025 16:47405475-47405497 CATTGGCTCTTAAACAAAGAAGG - Intronic
1138029666 16:53550473-53550495 GAGTGGCTTTTGTGAAAAGAAGG - Intergenic
1139172413 16:64647923-64647945 AAGTGGCTGCTGAGGAAAGGGGG + Intergenic
1139872989 16:70122612-70122634 CAGTGCCCTTTGAGGAGAGATGG + Intronic
1140362788 16:74358697-74358719 CAGTGCCCTTTGAGGAGAGATGG - Intergenic
1141139719 16:81489505-81489527 CAGCGGCACTTTTGGAAAGAGGG - Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142886078 17:2912741-2912763 CAGTGGCTCCTGAGGAGATGGGG - Intronic
1143691787 17:8573619-8573641 CAACCTCTCTTGAGGAAAGAGGG + Intronic
1143912916 17:10266815-10266837 TATTGGCTCTTCAGGAAAGAGGG + Intergenic
1144410259 17:14993957-14993979 CAGAGGTTCTTGGGGAAGGATGG - Intergenic
1148577712 17:48723195-48723217 CAGTCGCTCTCCAGGGAAGAGGG - Intronic
1150435784 17:65153155-65153177 GGGTGGCTTTTAAGGAAAGATGG - Intronic
1150525443 17:65917694-65917716 CTGTGCCTCGTGAGAAAAGAAGG - Intronic
1151345212 17:73497263-73497285 CAGTGTCTTGGGAGGAAAGAGGG - Intronic
1151459840 17:74248083-74248105 CAGTGGCTCCTGAAGGAGGACGG + Intronic
1151790527 17:76302826-76302848 CAGTGCCTCGGGAGGAAAAAGGG - Intronic
1153165931 18:2262434-2262456 CATAGTCTCTTGAGGAAAGCAGG + Intergenic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1156164649 18:34403627-34403649 TAGTGACTCTTGAGGGAAGAAGG - Intergenic
1157088212 18:44604229-44604251 CATTGGCTCTTCAGGACTGAGGG + Intergenic
1157671233 18:49530513-49530535 CAGTGGCGCTAGAGGAATTAAGG + Intergenic
1157954179 18:52077693-52077715 CAGTACCTCTAGGGGAAAGATGG - Intergenic
1159246140 18:65807883-65807905 AAGGGGAACTTGAGGAAAGAAGG - Intronic
1159550574 18:69891846-69891868 CATTAGTTCTTGAGCAAAGATGG - Intronic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1163340507 19:16703469-16703491 CAGTTTCTGTTGAGGAAACATGG - Intergenic
1167324087 19:48813343-48813365 CAGTGGCTGGGGAGAAAAGAGGG + Exonic
1167780876 19:51598101-51598123 CAGAGACTCTTAAGGACAGAGGG - Intergenic
927770118 2:25853319-25853341 CAGAGCCTTTGGAGGAAAGAGGG + Intronic
928598589 2:32881369-32881391 CAGTGGCTCATTATTAAAGAAGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
931979252 2:67677010-67677032 CATTGGGTGGTGAGGAAAGAGGG - Intergenic
932143090 2:69296831-69296853 CTGTGGCTGGTGTGGAAAGAGGG - Intergenic
932280377 2:70486251-70486273 CAGTGGCCCTTAAGGGACGAAGG + Intronic
932310184 2:70733552-70733574 CATTGCCTGTTGAGGAAGGAAGG + Intronic
932466179 2:71925781-71925803 CAGTGGCTCTTCAGGGTGGATGG + Intergenic
933315942 2:80715205-80715227 CAGTGGCATTTGAGGAAAGCAGG + Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935263534 2:101375449-101375471 CAAAGGCTCTTAATGAAAGATGG - Intronic
937754277 2:125516553-125516575 CATAGGCTCTTCAGGAAACATGG + Intergenic
937758468 2:125570006-125570028 GATTGGCTATTGAGGAAAGGAGG + Intergenic
937792250 2:125974189-125974211 CCCTGGCTCATGAGGAAAAAAGG + Intergenic
938068666 2:128295123-128295145 CAGTAGCCCTTCAGGACAGAGGG - Intronic
938686427 2:133742417-133742439 CAGAGGCCCTGGAGGAAAAAGGG - Intergenic
939093804 2:137809401-137809423 CAGTTGCTTTTGAGGACTGATGG + Intergenic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
941092742 2:161197080-161197102 CAGTTACCCTTGAGGAAAAATGG + Intronic
942959445 2:181812424-181812446 CAGTTGCTGTTCAGGCAAGAGGG - Intergenic
944480451 2:200152462-200152484 CAGTGGCGCTAGAGGAATTAAGG - Intergenic
945060601 2:205905553-205905575 CAGTGGATCTTGGGGAAGCACGG - Intergenic
946174702 2:217915429-217915451 CAGTGCTTCTTGAAGACAGACGG - Intronic
946349391 2:219139408-219139430 CACTGGCTCTGGAGGAAACCAGG + Intronic
1169260109 20:4131498-4131520 CAGGGGCTCTGGAGGAGGGAGGG + Intronic
1169553725 20:6727607-6727629 CTGTGGCTGATGAGGAATGAGGG + Intergenic
1170768977 20:19315696-19315718 CAGTGGCTCTTCTGGTAGGAGGG + Intronic
1170898525 20:20437689-20437711 CAGTGCCTCCTGAGAAAAGCTGG - Intronic
1171200978 20:23242047-23242069 CGGTGGCTCCTAAGGAATGATGG - Intergenic
1171254087 20:23673202-23673224 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1171260588 20:23728469-23728491 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1171269705 20:23804314-23804336 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175836700 20:62000714-62000736 CATCGTCCCTTGAGGAAAGAAGG + Exonic
1175991788 20:62793510-62793532 CTGTGCCTATTGAGAAAAGATGG - Intergenic
1176375171 21:6083418-6083440 CAGTGGCCCTTGTGGAAAGGGGG + Intergenic
1177400566 21:20598378-20598400 CAGTGGTTCATTATGAAAGAGGG + Intergenic
1179030401 21:37714975-37714997 CAGAGGTACGTGAGGAAAGACGG - Exonic
1179748303 21:43454826-43454848 CAGTGGCCCTTGTGGAAAGGGGG - Intergenic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1181638886 22:24186722-24186744 CAGTGGCTTTTGAGGACTGAGGG - Intronic
1181724911 22:24805038-24805060 CAGGGGCTCTTGATGGAACAAGG + Intergenic
1184087562 22:42274350-42274372 CAGGGGCTCCTGTGGAATGAGGG - Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
949741485 3:7239350-7239372 CCGTGGGCTTTGAGGAAAGACGG + Intronic
951089520 3:18556043-18556065 CAGGGGATTTGGAGGAAAGATGG - Intergenic
951750632 3:26031259-26031281 CCTTGGGTCTTGGGGAAAGATGG + Intergenic
953493202 3:43366623-43366645 CAGTGGCTCTGCAGCAAAGTTGG + Exonic
954398009 3:50303236-50303258 CAGTGGCTCATGGGGAAGCAGGG - Exonic
954638602 3:52085008-52085030 CAGTGGCTGATGGGGCAAGATGG + Intronic
956662416 3:71612425-71612447 CATTGGCTGTTGAAGAGAGAGGG - Intergenic
957115996 3:76027477-76027499 TGGTTGCTCTTTAGGAAAGAGGG - Intronic
957223343 3:77412455-77412477 CAGTAGATCTTGAGGACAGAGGG - Intronic
960620138 3:119629336-119629358 CAGTGGCTGGTGAGGAGACAGGG - Intronic
961745024 3:129059279-129059301 CAGAGGCTCAAGAGGAAGGAGGG + Intergenic
961801597 3:129454643-129454665 TAGTGGCTGTTGAGGAATGTGGG + Intronic
962309256 3:134313709-134313731 CAGTCGCGCTGGAGGAAAGGAGG + Intergenic
963275305 3:143324186-143324208 CAGTGGCTCTTGTTCAAGGAAGG - Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964695468 3:159503011-159503033 CAGTGTCTCCTGGGGAGAGAAGG - Intronic
965814856 3:172625800-172625822 CAATGGCACTTCAGGGAAGAAGG + Intergenic
966424290 3:179764470-179764492 TTGTGGCCCTAGAGGAAAGAGGG + Intronic
966555726 3:181258194-181258216 CAGTGGAACTTGGTGAAAGATGG + Intergenic
966597539 3:181738020-181738042 CAGTGGCTCTCTAGGGAAGGAGG - Intergenic
967011467 3:185438789-185438811 AAGTGGCTTTAGAGGAAAGAAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968991469 4:3916177-3916199 CAGATGCCTTTGAGGAAAGATGG + Intergenic
969352583 4:6606315-6606337 CAGTGGCTCCTGAGGGAAAGTGG + Intronic
969409477 4:7018628-7018650 CAGTGGCTCATGAGGAGTCAGGG + Intronic
969893467 4:10280735-10280757 GGTTGGCTCTTGAGGAAAGATGG + Intergenic
975912446 4:79282993-79283015 GAGAGGCTTTTGAGGACAGAAGG + Intronic
978164049 4:105585698-105585720 GAGGGGCTATTTAGGAAAGAAGG - Intronic
979675294 4:123402755-123402777 CAGAGGCTCTTGTTGAAAGTGGG - Exonic
981113399 4:140960695-140960717 CCCTGACTCTTGAGTAAAGATGG + Intronic
982090600 4:151876816-151876838 CAGAGTTTCTGGAGGAAAGATGG - Intergenic
982513252 4:156311081-156311103 AAGTGGCACTTTATGAAAGAGGG + Intergenic
984023101 4:174510210-174510232 CAGTAGCTCTTGAACAAAAAAGG + Intronic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
985888366 5:2697442-2697464 GTGTGGCTCCCGAGGAAAGAAGG - Intergenic
986358296 5:6950240-6950262 CCGTACATCTTGAGGAAAGAAGG + Intergenic
987503513 5:18743195-18743217 CAGTGGCTCTGAAAGAAAGAAGG - Intergenic
988149228 5:27354280-27354302 CAGTGGCTGCTGAGGCTAGAAGG + Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989548045 5:42697476-42697498 CAGTGGCATTTGAATAAAGAAGG + Intronic
991284694 5:64959482-64959504 CAGTAGCTCCTCAGGAGAGATGG + Intronic
991399664 5:66239696-66239718 GAGAGCCTTTTGAGGAAAGAGGG + Intergenic
992304170 5:75418805-75418827 CAGTGGCTATTCAGGAATGGGGG + Intronic
992378379 5:76212277-76212299 CAGTGGCTCTGGAGCAATGATGG - Intronic
994152961 5:96470805-96470827 CAGTGACTCTTAAGGTAAGCTGG - Intergenic
998110199 5:139495557-139495579 AAGTGGCTTCTGAAGAAAGAAGG + Intergenic
998764252 5:145467382-145467404 TAGTGGCTCTCCAGGAAATAGGG + Intergenic
998861551 5:146448412-146448434 CAGTGGTTTTTGAGGAAAAGAGG + Intronic
999178681 5:149652905-149652927 AAGTAGGTCTTGTGGAAAGAGGG - Intergenic
1000866276 5:166518674-166518696 AAGTGGCTATTGATGAAAAAGGG + Intergenic
1001535108 5:172492621-172492643 CAGTGGTTCTTCAGGAGGGAAGG - Intergenic
1002460661 5:179372013-179372035 CAGTGGCTCCTGAGTCAAGCTGG - Intergenic
1003317329 6:5024466-5024488 CAGAGGCTCTGGAGGAGAGAGGG + Intergenic
1003508427 6:6759217-6759239 AAGCGGCTCTTGAGGAGAGCTGG - Intergenic
1004662418 6:17722017-17722039 CAGTCCCTCTAGAGGAAACAAGG + Intergenic
1006380324 6:33693495-33693517 CAGTGGCTCTTGAAGGCTGATGG + Intronic
1007477666 6:42129741-42129763 ATGTGGCTCATGAGCAAAGAGGG + Intronic
1008346918 6:50438897-50438919 GAGTGGCTAATGAGGAAAGAGGG + Intergenic
1008679377 6:53856307-53856329 CAGTGGCTCTTGAGGGATTTAGG + Intronic
1009574523 6:65434945-65434967 CATAGGCTCTTGGGGACAGAAGG + Intronic
1009960538 6:70515590-70515612 CAGGGGCTCTGGGGGACAGAGGG + Intronic
1012659477 6:101869665-101869687 CACTGGCTTTTGAGGAAAAAAGG + Intronic
1013233159 6:108175077-108175099 CAGCGGCTCCTGCTGAAAGACGG - Intronic
1013277134 6:108596218-108596240 CAGTGGTTTTTGAGGAATAATGG + Intronic
1014081097 6:117286726-117286748 CAGTGTCTCTTGCAGTAAGAAGG - Intergenic
1014781824 6:125573593-125573615 CGGTGGTGCTTGAGGAAAGGGGG - Intergenic
1015371326 6:132456898-132456920 CAGTGGCCTCTGAGGAAAGATGG - Exonic
1015726623 6:136306046-136306068 CACTGGCTCCAAAGGAAAGAGGG - Intergenic
1016378627 6:143450369-143450391 CAGTGGCTCTGGGCGAAGGAAGG - Intronic
1017496852 6:154991112-154991134 GAGTGGATGTTGAGGAAAGTGGG + Intronic
1017826251 6:158084185-158084207 CTGAGGCTCCTGAGAAAAGAAGG - Intronic
1019742105 7:2680164-2680186 CAGTGGCACTTGAAGAAGGAGGG + Intronic
1019834708 7:3371241-3371263 TAGTGGATCTTGAGGAAACTAGG + Intronic
1020408359 7:7863669-7863691 CATTGGCTCTTGATGCAAGAAGG - Intronic
1020529324 7:9311234-9311256 GTGTGTCTGTTGAGGAAAGAAGG - Intergenic
1021401163 7:20210848-20210870 CAGTAGCTCTTTAGAAAATATGG - Intronic
1022199633 7:28103896-28103918 CAGTGGCCCTTGAGAAGAGGAGG - Intronic
1023367159 7:39475425-39475447 GAGGGGCTTTTGAGGGAAGATGG + Intronic
1023863423 7:44228130-44228152 AAGTGGCCCTTGAGGAACGCTGG + Intronic
1025823228 7:64991047-64991069 TAGAGGCTCTTGTGGACAGACGG - Exonic
1027034692 7:74916559-74916581 CAGTGAATCCTCAGGAAAGAAGG + Intergenic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030977032 7:116139429-116139451 CAGTGGCTCTTGAACGGAGAAGG - Intronic
1031413866 7:121472517-121472539 CAATGGCATTTGAGCAAAGAAGG - Intergenic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1034517533 7:151592247-151592269 GTGTGGCTCTTGAGGACAGTGGG + Intronic
1035587426 8:786607-786629 CAGCGGCTCTTCGGGAGAGACGG + Intergenic
1036630831 8:10513716-10513738 CAGTGACATTTGAGGAAAGATGG + Intergenic
1039546303 8:38413694-38413716 CAGCGGCTCATGAGAGAAGACGG + Exonic
1039900818 8:41751497-41751519 CAGTGGCTGTTGAGCTGAGATGG + Intronic
1042103842 8:65302694-65302716 CACTGGCTTTTGAGAAAAGAAGG - Intergenic
1042246633 8:66714589-66714611 AAGTGTCTCTTGAAGCAAGAAGG + Intronic
1044792542 8:95863034-95863056 CAGTGCCTCTTGGGTAAACAAGG - Intergenic
1044919501 8:97153820-97153842 CAGTGGCCCTTGATGACACAAGG + Intergenic
1045952414 8:107866360-107866382 CAGGGGCCCTTGGGGAAGGAAGG - Intergenic
1048251514 8:132869985-132870007 CAGTGGCCCTGCAGGAAATAGGG - Intronic
1049054262 8:140222541-140222563 CAGAGTCTCCTGAGGAAAGGGGG + Intronic
1049254006 8:141604510-141604532 CAGTGGCTCTCGGGGAAGGGGGG - Intergenic
1049409919 8:142468353-142468375 CCGTTGGTCTTGTGGAAAGACGG + Intronic
1049702443 8:144021300-144021322 CAGAGGGTCATGAGGGAAGAGGG - Intronic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1051217611 9:14815496-14815518 TAGTGGCTCTTCAGGGAACATGG + Intronic
1052173012 9:25425516-25425538 CAGAGGCCCCAGAGGAAAGAAGG + Intergenic
1052445933 9:28561079-28561101 AAGTGGCAAGTGAGGAAAGAAGG + Intronic
1055746471 9:79451238-79451260 CAGTGGCTTGATAGGAAAGAGGG - Intergenic
1056362248 9:85870290-85870312 CAGTGCCTCCTGAGGGAAAAAGG - Intergenic
1056925642 9:90832136-90832158 CAGTTGCTCCTGGGGAAATATGG - Intronic
1057836445 9:98449237-98449259 CAAGGCCTCTGGAGGAAAGACGG - Intronic
1058908404 9:109499119-109499141 CAGTGGAGTTTGGGGAAAGAGGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059120181 9:111634570-111634592 CAGTGGCTCTGGAATAAAAACGG + Intronic
1060042097 9:120308638-120308660 CTGTGCCTCTTGAGGGAGGAAGG + Intergenic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060730692 9:126034973-126034995 GAGTGGCTCTTGAGGGGTGATGG + Intergenic
1061315479 9:129792938-129792960 CAGTGGCTCTTCATGAAAGTGGG + Intergenic
1187659817 X:21531004-21531026 CAATGTTTCTTGAGGAGAGAAGG - Intronic
1189940733 X:46117899-46117921 CAGTGGCTGTGGAGCACAGAGGG - Intergenic
1192185626 X:68945003-68945025 CAGTGGCTGTGGAGTAAAGACGG + Intergenic
1193552329 X:82911270-82911292 GTGTGTCTTTTGAGGAAAGAAGG - Intergenic
1193882511 X:86940889-86940911 CAATGTTTTTTGAGGAAAGATGG + Intergenic
1194286619 X:92019228-92019250 CAGAGGCTCTTGACAAAAGCAGG - Intronic
1197029121 X:121792343-121792365 CAGAGCCTCTTGAGGAAATGTGG - Intergenic
1200037019 X:153338040-153338062 CAGTGGATCTTGGGGAATCAAGG - Intronic
1200053473 X:153446614-153446636 CAGTGGCTGCTGGGGAAGGAAGG + Intronic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200604163 Y:5243788-5243810 CAGAGGCTCTTGACAAAAGCAGG - Intronic
1200916510 Y:8575994-8576016 CAGTGGCTCTCTGGGAAAGCTGG - Intergenic
1201489119 Y:14523018-14523040 CAGTGGCTCTCCAGCAAAGGAGG + Intronic