ID: 1132783926

View in Genome Browser
Species Human (GRCh38)
Location 16:1643926-1643948
Sequence AATCTTGCCATCCTGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132783926_1132783929 12 Left 1132783926 16:1643926-1643948 CCTGTCAGCAGGATGGCAAGATT 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1132783929 16:1643961-1643983 TCTTAAGGAAGCTAGTGTTGAGG 0: 1
1: 0
2: 1
3: 11
4: 137
1132783926_1132783930 24 Left 1132783926 16:1643926-1643948 CCTGTCAGCAGGATGGCAAGATT 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1132783930 16:1643973-1643995 TAGTGTTGAGGTAGCTCACCTGG 0: 1
1: 0
2: 0
3: 4
4: 57
1132783926_1132783927 -3 Left 1132783926 16:1643926-1643948 CCTGTCAGCAGGATGGCAAGATT 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1132783927 16:1643946-1643968 ATTGATTGTCCTTTTTCTTAAGG 0: 1
1: 0
2: 0
3: 43
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132783926 Original CRISPR AATCTTGCCATCCTGCTGAC AGG (reversed) Intronic
901732305 1:11288975-11288997 AATCTGGCCTGACTGCTGACTGG - Intronic
901761111 1:11472147-11472169 AGTCATGCCATCCTGCAAACTGG - Intergenic
907728269 1:57040866-57040888 AATCCTGTCATCCTGCTGATGGG - Intronic
912544843 1:110443238-110443260 GTTCTTCCCATCCTCCTGACAGG - Intergenic
922280187 1:224115594-224115616 AAATTTTCCATCCTGCAGACTGG - Intronic
923067084 1:230527719-230527741 CATCTTGCCAGCCTCCTCACTGG + Intergenic
924161786 1:241240314-241240336 AGTCTAGGCACCCTGCTGACGGG + Intronic
1062824229 10:556632-556654 AATGTTGCCACCCTGCCCACTGG + Intronic
1066267305 10:33788735-33788757 CCTCTTGCCAGCCTTCTGACAGG - Intergenic
1071521941 10:86336991-86337013 AAACTAGCCATCCTGGTGGCGGG - Intronic
1071966272 10:90856542-90856564 TATCTTGCGAGCTTGCTGACTGG - Intronic
1074448694 10:113541295-113541317 AAGATTGACATCCTGCAGACTGG + Intergenic
1079082785 11:17425472-17425494 AAGCTTGCCCTTCTGCTGATTGG + Intronic
1081152296 11:39647715-39647737 AATATTGGCATCCTGCTTTCTGG + Intergenic
1086870742 11:92033692-92033714 AATCTAGCCATTCGGTTGACTGG + Intergenic
1096562209 12:52444261-52444283 AATCATGGCTCCCTGCTGACTGG - Intergenic
1100502354 12:95186010-95186032 CCTCTTGCCATTCTGCTTACTGG - Intronic
1100927467 12:99565891-99565913 TATCTTGGCTTCCTGCTGAGAGG + Intronic
1106453544 13:29906883-29906905 AACCCTGCCATCCTGTTGAAGGG - Intergenic
1107382159 13:39868393-39868415 AATCTTGCCTTTCAGCTGAATGG - Intergenic
1107447638 13:40482724-40482746 AAACTTACAATCCTGGTGACAGG + Intergenic
1107998265 13:45882988-45883010 GATCCTGCCATTCTGCAGACAGG - Intergenic
1110806887 13:79765219-79765241 CACCTTGCCAACCTGCTCACAGG + Intergenic
1116792636 14:49356358-49356380 AATCTGGCAACCCTACTGACAGG + Intergenic
1122618902 14:103041896-103041918 AAACTGGCCACCCAGCTGACAGG + Intronic
1123789730 15:23708874-23708896 AATATAGCCATCCTTTTGACAGG + Intergenic
1127597142 15:60496957-60496979 TTTCATGCCATCCTGCGGACTGG + Intronic
1127597471 15:60500617-60500639 AATCTTGTTATCCTGGAGACTGG + Intronic
1127951552 15:63812154-63812176 AAACTTGTCATCTTGCTGTCTGG - Intronic
1129686689 15:77690124-77690146 AATCTTAGGATCCTGCTGACAGG - Intronic
1130972854 15:88747651-88747673 AGTCATGGCATCCTGCTGAGAGG + Intergenic
1131408830 15:92188936-92188958 AATTTTGCCATCCTTCAGAACGG + Intergenic
1132235648 15:100218600-100218622 AATCTTCCTACACTGCTGACAGG + Intronic
1132783926 16:1643926-1643948 AATCTTGCCATCCTGCTGACAGG - Intronic
1137945975 16:52733558-52733580 AATTTTGGCATCCTGTTGAAAGG - Intergenic
1140181882 16:72728696-72728718 ACGCTGGCCATGCTGCTGACTGG - Intergenic
1140812074 16:78588089-78588111 ACCCTTGCCTTCCTGCTGGCGGG + Intronic
1141350812 16:83293965-83293987 AATCTTCTCCTCCTGCTCACAGG - Intronic
1142347359 16:89562347-89562369 AAACTGGCCACCCAGCTGACCGG + Exonic
1144708132 17:17383558-17383580 AAACTGGCCACCCAGCTGACCGG - Intergenic
1145730282 17:27176699-27176721 ATTGTTTCCATCCTGCTGAATGG - Intergenic
1150612187 17:66742511-66742533 AATATTGCCATTGAGCTGACAGG + Intronic
1153022353 18:641390-641412 AATCTGGCCATACTGCTGATTGG - Exonic
1155628231 18:27861108-27861130 CATCTTGCCTTCCTGCTTGCTGG + Intergenic
1157020226 18:43772653-43772675 AATCTTACCATCCTACTTGCAGG + Intergenic
1158146627 18:54321880-54321902 TATCTTTCCATCCTCCTCACAGG + Intergenic
1158622028 18:59041134-59041156 CATCTTTCCATCCTAGTGACAGG - Intergenic
1160199060 18:76781129-76781151 AACCTTGCCATGCTGCTGAGTGG - Intergenic
1166642749 19:44508240-44508262 AATCTGGCTGTCCTGATGACAGG + Intronic
926052142 2:9752082-9752104 ACTCTTGCCCTCCAGCAGACTGG + Intergenic
927065733 2:19469163-19469185 AATCTTGCCACCATGCTGTGAGG - Intergenic
930722487 2:54650977-54650999 AAACTTGCCATCATAGTGACAGG - Intronic
931579225 2:63754759-63754781 AGTATTGCCATCCAGCTGACTGG + Intronic
933576792 2:84078703-84078725 ATTTTTTCCATCCTGCTGTCTGG + Intergenic
934527123 2:95058846-95058868 AATATTCCCATTCTGCAGACAGG - Intergenic
937196575 2:120162829-120162851 CATCTTCCCACCCTGCTGCCTGG - Intronic
943676730 2:190722927-190722949 ACTCTTTCCCTCCTGCTGCCTGG + Intergenic
944864615 2:203848288-203848310 ATTCTTGCCATAGTGCTGAAGGG - Intergenic
946657268 2:221961808-221961830 ATTCCAGCCATCCTGCTGGCGGG - Intergenic
1169287941 20:4325248-4325270 AGACTTGCCATCCTACTTACAGG - Intergenic
1170340446 20:15321093-15321115 ATGCATGCCATCCTGATGACAGG + Intronic
1170512678 20:17094967-17094989 AGTCTTGGGATCATGCTGACAGG + Intergenic
1173669661 20:44789919-44789941 AATCTCCCCATTCTGTTGACAGG - Intronic
1182081627 22:27533382-27533404 GATCTTCCCATTCAGCTGACGGG + Intergenic
1183014101 22:34971819-34971841 AATCTTGCCATGCTTCTGAATGG + Intergenic
1184104116 22:42357578-42357600 AATCTTGCCATCCCCCAGGCAGG - Intergenic
950413668 3:12855827-12855849 GATGTTCCTATCCTGCTGACGGG + Intronic
950847837 3:16031934-16031956 GAACTTGCCATCCAGCTGTCAGG + Intergenic
954462183 3:50633648-50633670 AGCCTTGCCATCCTGCAGCCAGG + Intronic
955770787 3:62383073-62383095 AATTGTCACATCCTGCTGACTGG - Intergenic
957278214 3:78116205-78116227 ATTCCAGCCAGCCTGCTGACAGG + Intergenic
957873889 3:86120140-86120162 AATCCTGCCAGCCTTCAGACTGG + Intergenic
958804940 3:98799202-98799224 AATCTTGCCATCTTGCTTTAAGG - Exonic
959971734 3:112417148-112417170 ATTCTTGCCATTCAGGTGACAGG + Intergenic
962164735 3:133037696-133037718 AATCATGCCAACTTGGTGACTGG - Intergenic
967627746 3:191705259-191705281 AATCTTGCCATAAGTCTGACGGG - Intergenic
969270864 4:6099959-6099981 AATTTAGCCATCCTGGTGCCTGG + Intronic
972098065 4:35373994-35374016 GATCTTGCCAATCTGCTGAGGGG - Intergenic
976077775 4:81319341-81319363 AATCTTTCCTTCTTGCTGTCAGG - Intergenic
981048839 4:140291451-140291473 AATGATGACATCATGCTGACTGG - Intronic
986072343 5:4297550-4297572 AATCTCTCCATCCTGCTCAGAGG + Intergenic
991955728 5:71994496-71994518 CATCTTGCCATCCTGGTGGAAGG + Intergenic
992979032 5:82147794-82147816 ACTCTTGCCATCTTTCTGACTGG - Intronic
997864510 5:137449139-137449161 ACTCTTTCCAGCCTGCTGGCTGG + Intronic
1002294926 5:178224898-178224920 ATTCTTGCAAGACTGCTGACTGG + Intronic
1006838890 6:37015624-37015646 ACTCTGGCCAGCCTGCTCACAGG - Intronic
1015322422 6:131891221-131891243 AATATTCCTATCCTGCTCACTGG + Exonic
1016966571 6:149723482-149723504 AATCTTGCCATCCTGTTAATAGG - Intergenic
1017725105 6:157271586-157271608 CATTTTGCAATGCTGCTGACCGG - Intergenic
1019397890 7:832788-832810 AATCTGTTCATCCTGGTGACTGG + Intronic
1022322116 7:29297379-29297401 CATCTTAGCCTCCTGCTGACAGG + Intronic
1026309170 7:69168805-69168827 AATATAACCAGCCTGCTGACAGG - Intergenic
1026335813 7:69393632-69393654 AATCTTACCATCCTAATGAGAGG + Intergenic
1026654357 7:72244009-72244031 AATTCTCCCATCCTGCTGAATGG + Intronic
1026907633 7:74071669-74071691 AATCTTGCCATGTTGCAGCCAGG + Intergenic
1032518845 7:132527326-132527348 AATCTTGCCATCCACCTCTCAGG + Intronic
1033543338 7:142376856-142376878 GATCTTTCCCTCCTGCTAACGGG - Intergenic
1033548261 7:142422044-142422066 AATCTTCCCCTCCTGCTAATGGG - Intergenic
1038855987 8:31334123-31334145 ACTCTAGCCATCCTGCCAACAGG - Intergenic
1040896043 8:52369386-52369408 ACTCTCTCCTTCCTGCTGACTGG + Intronic
1042570289 8:70156626-70156648 AAGCTTCCCATCTTGCTGAGTGG + Exonic
1042718915 8:71806000-71806022 AATCTTGAGATCCTGGTGACTGG + Intergenic
1045491732 8:102675326-102675348 AAGCTTGTCATCCTTCTGAAAGG - Intergenic
1047924968 8:129673923-129673945 AATCTTGTCATCCTGCAAAAAGG + Intergenic
1048039129 8:130708020-130708042 AATCTTACCATCATGGTGAAAGG + Intergenic
1048793652 8:138128542-138128564 AATCTTCCCATCCTGATGGAGGG - Intergenic
1048900849 8:139036414-139036436 ACTCTTGACATCCTGCCCACAGG + Intergenic
1052071582 9:24088513-24088535 AATCTTCCCTTCCAGCTGATCGG - Intergenic
1052381167 9:27772560-27772582 CTTCTTGCCATCTTGCTGACTGG - Intergenic
1058270964 9:102971140-102971162 AATCTGGCCAAGCTGCTGGCTGG + Intergenic
1058861103 9:109118893-109118915 CAACTTGCCATCCTGCAGATAGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1187455476 X:19437612-19437634 AATCTTCCCATCCTACTTACTGG + Intronic
1187625436 X:21107306-21107328 CATCTTTTCATCCTCCTGACAGG + Intergenic
1189612269 X:42749986-42750008 AATCTAGCAATCCTGCTGCTAGG + Intergenic