ID: 1132793506

View in Genome Browser
Species Human (GRCh38)
Location 16:1706754-1706776
Sequence GGTCCCGCGGTCCGGGGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132793506_1132793519 13 Left 1132793506 16:1706754-1706776 CCGGCACCCCGGACCGCGGGACC 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1132793519 16:1706790-1706812 ACCCCGCCCCGAGACCCGCCTGG 0: 1
1: 0
2: 2
3: 26
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132793506 Original CRISPR GGTCCCGCGGTCCGGGGTGC CGG (reversed) Intronic