ID: 1132793850

View in Genome Browser
Species Human (GRCh38)
Location 16:1708613-1708635
Sequence TTGGTTCAGCAGGAGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132793850_1132793858 -3 Left 1132793850 16:1708613-1708635 CCCCAGGGCTCCTGCTGAACCAA 0: 1
1: 0
2: 2
3: 19
4: 195
Right 1132793858 16:1708633-1708655 CAAGCTGGCGGGTGTGCGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132793850 Original CRISPR TTGGTTCAGCAGGAGCCCTG GGG (reversed) Intronic
900120409 1:1046448-1046470 CTGGCTCAGGAGGAGCCCTGGGG - Exonic
900238781 1:1605012-1605034 TTGGGTCAGCAGAAGCCCCTCGG - Intergenic
900281700 1:1873860-1873882 ATGGTGGAGCAGGATCCCTGTGG + Intronic
900950491 1:5855768-5855790 TGGGTGCAGCAGGTCCCCTGTGG - Intergenic
900986353 1:6075090-6075112 TTGGTTCAGTTGGAGCCCTGGGG + Intronic
901633491 1:10659028-10659050 AGGGTTCAGGAGGAGCTCTGGGG + Intronic
901752395 1:11418709-11418731 CTGGGGGAGCAGGAGCCCTGGGG - Intergenic
901953570 1:12768670-12768692 CTGGCTCAGCAGGAGCCCTGTGG - Intergenic
902127627 1:14229847-14229869 TGGATGCAGAAGGAGCCCTGTGG + Intergenic
903173668 1:21568617-21568639 CTGGCTCTGCAGGCGCCCTGGGG + Intronic
903403042 1:23071484-23071506 TTGGTACATAAGGAGCCATGGGG + Intronic
905065221 1:35175203-35175225 TTGGTTCAGGACGAGATCTGAGG - Intergenic
905393650 1:37653471-37653493 TTTGTCCAGCCTGAGCCCTGTGG - Intergenic
908798923 1:67858882-67858904 CTGGTTCAGCAGGGGCTCTCAGG - Intergenic
912255509 1:108054203-108054225 TTGGGTCAGCAGTTGTCCTGAGG + Intergenic
912823404 1:112885142-112885164 CTGTTTCAGTAGGAGCCCAGAGG + Intergenic
912866238 1:113259852-113259874 TTGGTTCAGCATTAGCCATTGGG + Intergenic
912872877 1:113326257-113326279 TAGGTTCACCAAGAACCCTGTGG - Intergenic
912926015 1:113913505-113913527 TTGGTGCAGCAGGAAACATGGGG + Exonic
917241615 1:172954844-172954866 TTGGTTCAGGAGCAACCCTAAGG - Intergenic
922470470 1:225873928-225873950 TTGGCCCAACAGAAGCCCTGAGG + Intronic
922842175 1:228651337-228651359 AGAGCTCAGCAGGAGCCCTGTGG + Intergenic
923067880 1:230537005-230537027 TTGGGGCAGCATGAGCCCAGAGG + Intergenic
1064035831 10:11912734-11912756 TTGTTGCAGCAGAAGCCCAGAGG - Intergenic
1064218822 10:13422057-13422079 TTGGTTCTGCAGAAGCCAGGAGG - Intergenic
1064425606 10:15226526-15226548 ATGGTTCAGGAGGTGTCCTGGGG - Intronic
1065559051 10:26944206-26944228 ATGGCTCCGCAGAAGCCCTGTGG + Intergenic
1066273583 10:33846751-33846773 TTAGTACAGCGGGTGCCCTGGGG - Intergenic
1068737377 10:60429599-60429621 TTGGTTCAGCAGAAGGCTTTTGG + Intronic
1075141864 10:119844871-119844893 GTGGTTCACCAGGAGCTCTTAGG + Intronic
1081257749 11:40918089-40918111 TTGGTCGATCAGGAGCCCTTTGG + Intronic
1081866176 11:46361865-46361887 CTGGCTCAGCAGGAGCTCGGGGG - Intronic
1083658239 11:64240610-64240632 TCGGTCCTGCAGGGGCCCTGTGG + Intergenic
1084333750 11:68445419-68445441 TGGCTGCAGCAGGATCCCTGGGG - Intronic
1085814074 11:79717182-79717204 TTGGTTGTGCACCAGCCCTGTGG - Intergenic
1087065873 11:94027438-94027460 TTTGGAGAGCAGGAGCCCTGGGG + Intronic
1088696400 11:112369894-112369916 TAGGTTCAGCTGAAGTCCTGAGG - Intergenic
1088788355 11:113202504-113202526 TGGGTAGAGCAGGAGCCCTCAGG + Intronic
1088984379 11:114892659-114892681 GTGGTTTAGCAGCAACCCTGGGG - Intergenic
1091402055 12:187100-187122 TTTTTGCAGCAGAAGCCCTGAGG - Intergenic
1091665460 12:2415618-2415640 TTGGTCAAGCAGAGGCCCTGGGG + Intronic
1091779040 12:3202306-3202328 GTGGTCCAGGAGGAGCACTGGGG + Intronic
1091854010 12:3724313-3724335 CTGGCTCAGCAGGAGCCTAGAGG - Intronic
1092231328 12:6777279-6777301 TTGGGTCACCTGGATCCCTGGGG + Exonic
1093548916 12:20383618-20383640 TAGGAGCAGCAGGAGTCCTGTGG + Intronic
1096753081 12:53775667-53775689 GTTGTTCAGCAGGAGCCATGAGG + Intergenic
1096883953 12:54698628-54698650 ATGAATCATCAGGAGCCCTGAGG + Intergenic
1097356959 12:58612753-58612775 TTGGTATGGCAGGAGCCCAGTGG - Intronic
1097445231 12:59662549-59662571 CCTGTTCACCAGGAGCCCTGGGG - Intronic
1098770126 12:74540949-74540971 TTGGTCCAACAGGTGCCCAGAGG + Exonic
1098972390 12:76869993-76870015 TTGGTTCTGCAGGAATCATGAGG - Intronic
1101019074 12:100533660-100533682 TTGTTCCAGCTGGAGCGCTGAGG + Intronic
1102903711 12:116658897-116658919 TTGTTGCAGCAGCTGCCCTGGGG + Intergenic
1106421477 13:29589525-29589547 CTGGCACAGCTGGAGCCCTGGGG - Intronic
1107064486 13:36197793-36197815 ATGTTGCAGCAGGAGCTCTGTGG - Intronic
1107670184 13:42737518-42737540 TTTGTTCAGCAGGCACACTGGGG + Intergenic
1107793637 13:44028342-44028364 CTGGCTCAGCAGGACCCCTGTGG + Intergenic
1108372219 13:49781275-49781297 TTCCTTGAGCAGGAACCCTGAGG + Intronic
1114639469 14:24209676-24209698 TTGCTACAGAAGGAGCCCTTGGG - Exonic
1120085147 14:80263450-80263472 ATGTTTCAGCAGGAGCACTCTGG + Intronic
1122452751 14:101824043-101824065 TTCCTTCAACAGGAGCTCTGGGG - Intronic
1125522044 15:40353722-40353744 TGGGTGCTGCAGGAGCCCAGTGG + Intronic
1125723908 15:41858519-41858541 GTGGTTCAGCACCAGCTCTGGGG + Intronic
1126424103 15:48507126-48507148 CTGGGTCAGCAGGAGCCTAGAGG + Intronic
1129446837 15:75625071-75625093 TTGAAACAGCAGGAGCCCGGCGG - Intronic
1131280599 15:91018222-91018244 TTTGTTCAGCAGGAGACCAGGGG - Intronic
1131288758 15:91086203-91086225 TTGGTTCTTAAGGAACCCTGTGG - Intergenic
1132023410 15:98384179-98384201 TGGGCTCAGCGGGAGCCCAGTGG + Intergenic
1132157405 15:99505381-99505403 ATGCTTCTGCAGGAGCACTGGGG - Intergenic
1132256832 15:100383538-100383560 CTGGTGCAGAAGGAGCCCAGGGG + Intergenic
1132319911 15:100918442-100918464 GAGGTCCTGCAGGAGCCCTGCGG + Intergenic
1132793850 16:1708613-1708635 TTGGTTCAGCAGGAGCCCTGGGG - Intronic
1133122104 16:3615392-3615414 TTACTCCAGCAGAAGCCCTGGGG + Intronic
1133999923 16:10775005-10775027 CTGGTTCAGCAAGAGCTTTGTGG - Exonic
1135621540 16:23960120-23960142 TTGGTTGAGGATGGGCCCTGGGG - Intronic
1138880094 16:61002734-61002756 TTGTTTCAACAAAAGCCCTGGGG + Intergenic
1141707030 16:85671829-85671851 TTGGTTCAGCAGATGTCCTTGGG + Intronic
1142121878 16:88390489-88390511 TTGGGTCAGGAGGAGCAGTGGGG - Intergenic
1143375977 17:6468004-6468026 CTGGTTCCACAGGAGCCCTGAGG - Intronic
1145026457 17:19471348-19471370 TGGGTTCAGCAGGACCCTAGGGG + Intergenic
1145276963 17:21437317-21437339 CTGGCTCAGCAGGACCCCAGGGG + Intergenic
1145713235 17:26995147-26995169 CTGGCTCAGCAGGACCCCAGGGG + Intergenic
1146917366 17:36686830-36686852 CCGGTGGAGCAGGAGCCCTGTGG - Intergenic
1147965466 17:44192244-44192266 TTGGTCCAGCAGGGACCCTGAGG - Exonic
1148550810 17:48550061-48550083 TTGGTAGTGCTGGAGCCCTGGGG + Exonic
1152234067 17:79129487-79129509 CTGGCTCAGCAGGAGCCTGGGGG - Intronic
1152801477 17:82332810-82332832 TGGGCTCAGCAGCAGCCCCGTGG + Intronic
1154375328 18:13804255-13804277 TTGGCTGAGCAGGAGCGGTGAGG + Intergenic
1157446383 18:47749454-47749476 TTGGTTCCTTAGCAGCCCTGGGG - Intergenic
1157804292 18:50646599-50646621 TTGGGTTCGCTGGAGCCCTGGGG - Intronic
1159814045 18:73051843-73051865 TAGGTTCAGCAGGAATCCTGTGG + Intergenic
1160876047 19:1296667-1296689 CTGGTGCGGCAGGGGCCCTGTGG - Intronic
1161669390 19:5596780-5596802 GTGGATCAGCAGGAGGCCTCAGG - Intronic
1163033744 19:14560301-14560323 GTGGTTCAGCAGGAACTCGGAGG + Intronic
1164816984 19:31211765-31211787 GGGGTTCAGCATGAGCCCTTTGG + Intergenic
1166588232 19:43969885-43969907 TTGGTACAGCAGGTGTGCTGCGG - Intronic
926846132 2:17141122-17141144 TTGGTTCATCATTAGTCCTGTGG + Intergenic
928099767 2:28429971-28429993 ATGGAGCAGTAGGAGCCCTGTGG - Intergenic
928394102 2:30930997-30931019 GTGGCTCTGCAGGAGCCATGTGG - Intronic
932844423 2:75120646-75120668 GTGGTTGAGTAGTAGCCCTGGGG + Exonic
933710044 2:85318487-85318509 TTGCTTGAGCAAGAGTCCTGGGG - Intronic
933812183 2:86039790-86039812 TGAGCTCAGCAGGAGCACTGTGG - Intronic
934165893 2:89293773-89293795 CTGGCTCAGCAAGAGCCCTGGGG - Intergenic
934201384 2:89888683-89888705 CTGGCTCAGCAAGAGCCCTGGGG + Intergenic
935053757 2:99546859-99546881 CTGGTTGAACAGGAACCCTGTGG + Intronic
936711450 2:115136195-115136217 ATTGTGCAGCAGTAGCCCTGAGG + Intronic
942655627 2:178211503-178211525 TTGCTCTGGCAGGAGCCCTGAGG - Intronic
943436375 2:187869439-187869461 TTTGTGCAGCTGGAGACCTGGGG - Intergenic
943595617 2:189851647-189851669 TTAGTTAAGCAGGAACCGTGGGG - Intronic
946046999 2:216829632-216829654 TTGATACAGCAGGAGCCTGGTGG + Intergenic
947988536 2:234468679-234468701 CTGGAGCAGCAGGAGCTCTGCGG - Intergenic
948254434 2:236555866-236555888 TTGCTTCTACAGAAGCCCTGTGG - Intergenic
948580659 2:238985649-238985671 TTGGCTCTGCAGCAGCCCCGTGG - Intergenic
948705434 2:239789413-239789435 TGGTTTCAGCAGGAACCCTGTGG - Intronic
948910658 2:241000854-241000876 TTTGCTCAGCAGGAGGCTTGAGG + Intronic
949070805 2:242022917-242022939 GTGGTGCAGCTGGAGACCTGGGG + Intergenic
1168838026 20:890628-890650 TAGGTTTAGCAGGATCCCTCTGG - Intronic
1172151104 20:32791042-32791064 TTGGTACATCAGGAGACTTGTGG + Intronic
1173006495 20:39143295-39143317 GGGGCTCAGCAGGAGCCCTAGGG - Intergenic
1173250709 20:41362899-41362921 CAGGGACAGCAGGAGCCCTGGGG + Exonic
1173295037 20:41748519-41748541 TGTGTTCACCTGGAGCCCTGGGG + Intergenic
1173525127 20:43726487-43726509 TTGTGTCAACAGGAGCGCTGTGG - Exonic
1173926219 20:46783360-46783382 CTGGATCTGCAGGTGCCCTGAGG - Intergenic
1174064067 20:47852140-47852162 TGGGTTTAACAGGAGCCCTGTGG + Intergenic
1175402584 20:58708879-58708901 GTGGTTCTGGAGGAGCCGTGTGG + Intronic
1175519432 20:59590565-59590587 GTGGTTAAGAAGGAGGCCTGAGG + Intronic
1175878733 20:62244129-62244151 TTGGCTGGGCAGGTGCCCTGGGG + Intronic
1176111699 20:63413858-63413880 CCGGTTCAGCAAGAGGCCTGAGG - Intronic
1177739223 21:25133837-25133859 TTGGTACAGCAGGGTACCTGTGG - Intergenic
1178742226 21:35212545-35212567 TTGAGACACCAGGAGCCCTGTGG - Intronic
1180057340 21:45365663-45365685 TTGCTCCAACAGGGGCCCTGAGG + Intergenic
1180158871 21:45990252-45990274 TTGGGTCCCCTGGAGCCCTGCGG - Exonic
1182084496 22:27551932-27551954 ATGGTTCAGCACCATCCCTGTGG + Intergenic
1182939732 22:34264033-34264055 TTGGTTAATCACCAGCCCTGTGG - Intergenic
1183671200 22:39273979-39274001 CTGGTTCATGAGGAGGCCTGGGG - Intergenic
1183694787 22:39415583-39415605 CTGGCCCAGCAGGAGCTCTGCGG - Exonic
1183729748 22:39611365-39611387 ATGGGTGAGCACGAGCCCTGGGG - Intronic
1185085696 22:48739921-48739943 TTGAGTCAGCAGAAGCTCTGGGG + Intronic
949994107 3:9602686-9602708 AGAGTTCAGCAGGATCCCTGTGG + Intergenic
953794750 3:45976040-45976062 TTGAATCAGAAGGAGCCCAGGGG + Intronic
954420594 3:50417118-50417140 TTGGTGCAGCAGGAACTTTGAGG + Intronic
954554894 3:51509953-51509975 GTGGGTAAGAAGGAGCCCTGTGG - Intergenic
958809270 3:98840960-98840982 TTGCTTCAGCAGAATCCCTGAGG - Intronic
960041205 3:113151591-113151613 CTGGCTCAGCAGGGGCCCAGTGG - Intergenic
961662627 3:128477741-128477763 TTTATTCACCAGGGGCCCTGAGG - Intergenic
962843025 3:139252517-139252539 TGGGGTCAGAAGGAACCCTGAGG - Intronic
965524227 3:169699574-169699596 TTGGTGCAACAGGAGATCTGGGG + Intergenic
967014943 3:185473349-185473371 TCGGCCCAGCAGCAGCCCTGCGG + Exonic
969048556 4:4356418-4356440 TTGGTCCACCAGCAGGCCTGGGG - Intronic
969494705 4:7519968-7519990 CTGGCAGAGCAGGAGCCCTGGGG - Intronic
971222976 4:24725831-24725853 ATGGTGCAGCAGGAGCCTGGGGG + Intergenic
975444133 4:74443508-74443530 TAGGTTCACCAGGAGCTCAGTGG - Intergenic
979108271 4:116715791-116715813 CCTGTTCTGCAGGAGCCCTGTGG + Intergenic
983455143 4:167953649-167953671 TTGGATAAGCATGAGGCCTGTGG + Intergenic
986294165 5:6423509-6423531 GTGACTCAGGAGGAGCCCTGAGG - Intergenic
991645953 5:68800422-68800444 TTTCTTGAGCAGGAGACCTGAGG - Intergenic
992176066 5:74149787-74149809 TTGGTTCACCAGCAGCCATTTGG + Intergenic
994179990 5:96753576-96753598 TTTGGTCAGTAGAAGCCCTGTGG + Intronic
998367424 5:141640181-141640203 TTGGCTCTGCAGAAGCTCTGGGG - Exonic
998984594 5:147742112-147742134 TTTGTTCCGCATTAGCCCTGTGG + Intronic
999182700 5:149681211-149681233 TGGGTTCCACAGGAGTCCTGTGG + Intergenic
1000168588 5:158679293-158679315 GTGAATCATCAGGAGCCCTGTGG + Intergenic
1000633157 5:163614065-163614087 TTGGTTCAGCAGTGGGCATGCGG + Intergenic
1003502663 6:6715157-6715179 GAGGTTCAGGAGCAGCCCTGTGG - Intergenic
1003566782 6:7229300-7229322 TTGGTGCAGCCGGGGTCCTGAGG - Exonic
1004788180 6:18992366-18992388 TTGGTAAAGAGGGAGCCCTGTGG - Intergenic
1007589324 6:43011969-43011991 TTTGGTGAGCAGCAGCCCTGGGG + Exonic
1008456783 6:51720337-51720359 TTGGTTCCTGAGGAGCCCTGTGG - Intronic
1011660420 6:89589727-89589749 TTTGTTCAGGCTGAGCCCTGTGG - Intronic
1012584158 6:100902199-100902221 TTGGTTCATCATCAGTCCTGAGG - Intergenic
1017391086 6:153940263-153940285 TTGACTCACCAGGAGCCCAGAGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022382741 7:29875438-29875460 TTGGTCCAGGAGGGGACCTGGGG + Intronic
1022489357 7:30804937-30804959 TTGGTGTAGCTGGAGCCCAGGGG + Intronic
1023871656 7:44266579-44266601 TGAGTTCAGCAGGTTCCCTGGGG - Intronic
1024691064 7:51803977-51803999 TTGGTTCAGCTGGAGCTGTATGG + Intergenic
1025906220 7:65788070-65788092 TTTGTTCAGCTGAAGCCTTGGGG + Intergenic
1026290160 7:68998874-68998896 CTGGTTCAACAGAAGCCCTGAGG - Intergenic
1027479490 7:78677910-78677932 TTGGTTCAGTCTGTGCCCTGAGG - Intronic
1028106664 7:86886872-86886894 TTGGTTGAGCTGAAGCCCAGTGG + Intronic
1028556857 7:92134462-92134484 TGGGTTTAGTAGGAGACCTGGGG - Exonic
1030085463 7:105811836-105811858 TTGGCCCACCAGGAGCCATGGGG - Intronic
1030089947 7:105849670-105849692 ATGATTCACCAGGGGCCCTGAGG + Intronic
1034679299 7:152916231-152916253 TTGGTTCAGAAGTAGCCCCAAGG - Intergenic
1034796201 7:154015849-154015871 TTGTTTCAACAGGATCCCTGTGG - Intronic
1035045735 7:155964205-155964227 TGGTTTCAGCAGGGACCCTGCGG + Intronic
1035081194 7:156217669-156217691 GTGGGACAGCAGGAGCCCGGAGG - Intergenic
1036709781 8:11070873-11070895 TGGGTTCAGCAGGAGGAATGAGG - Intronic
1037256697 8:16963680-16963702 TTGGTGTAGTAGGAGACCTGGGG + Intergenic
1038494207 8:27990180-27990202 CTGGTCCAGCAGGAGCCCAGGGG + Intronic
1038681046 8:29668489-29668511 TTGTTGCAGCTGGAGCCCTGAGG + Intergenic
1042482787 8:69322949-69322971 TTTGTGCAGCTGGAGACCTGGGG + Intergenic
1045781374 8:105867409-105867431 TTGTGCCAGCAGGAGTCCTGAGG + Intergenic
1046238142 8:111454218-111454240 TTGAATCAGTGGGAGCCCTGAGG - Intergenic
1047874181 8:129117013-129117035 ATAGTTCAGAAGGAGGCCTGGGG - Intergenic
1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG + Intronic
1052966353 9:34343461-34343483 TTGCTTCAGCAGGATCCTTGTGG + Exonic
1052987299 9:34497011-34497033 TTGATTCAGCAGTAGCTCTCTGG - Intronic
1055561529 9:77526369-77526391 TTGGGTCAGCATGAGCTTTGGGG - Intronic
1055847513 9:80584626-80584648 TTGGTTCTTCACCAGCCCTGTGG + Intergenic
1056434384 9:86561348-86561370 TTGGTTCTGCAGGAGAAGTGAGG + Intergenic
1057274470 9:93669091-93669113 TTGATTCACCAGCAACCCTGCGG + Intronic
1057320505 9:94008072-94008094 TTGCTTCAGCAGGCCCCCTCTGG - Intergenic
1059256979 9:112939741-112939763 TCTGTTCAGCTGGAACCCTGGGG + Intergenic
1062295170 9:135821299-135821321 TTACTTCGGGAGGAGCCCTGTGG + Exonic
1062338243 9:136081936-136081958 TGAGTTCTGCAGGAGCCCTGGGG - Intronic
1191902272 X:66053565-66053587 TTGCTCCAGCAGGGACCCTGAGG - Intergenic
1193221934 X:78935838-78935860 TTGGTTCTCTTGGAGCCCTGCGG + Intergenic
1197251084 X:124217082-124217104 TGTGTCCAGCAGGAGGCCTGGGG - Intronic
1198618699 X:138483581-138483603 TGGTTTCAGCATGAGCCCTTGGG - Intergenic
1198855096 X:141007292-141007314 TTGGATCTGAAGGTGCCCTGTGG + Intergenic
1198876917 X:141237848-141237870 TTGGATCTGAAGGTGCCCTGTGG - Intergenic
1198907595 X:141580077-141580099 TTGGATCTGAAGGTGCCCTGTGG - Intergenic
1198909196 X:141594347-141594369 TTGGATCTGAAGGTGCCCTGTGG + Intronic
1198917880 X:141693804-141693826 TTGGATCTGAAGGTGCCCTGTGG - Intronic
1199084828 X:143616572-143616594 TTTGTTCAACAGGATCTCTGAGG - Intergenic
1200075470 X:153548465-153548487 TTGGCTCAGCAGGTGAGCTGGGG - Intronic