ID: 1132794568

View in Genome Browser
Species Human (GRCh38)
Location 16:1713022-1713044
Sequence GTGTGTGGATAAAGGGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132794563_1132794568 -2 Left 1132794563 16:1713001-1713023 CCGGAGATGCTGGCCATCTGTGT 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1132794568 16:1713022-1713044 GTGTGTGGATAAAGGGAAGCCGG 0: 1
1: 0
2: 4
3: 28
4: 271
1132794560_1132794568 14 Left 1132794560 16:1712985-1713007 CCTTTTCTCGGCACACCCGGAGA 0: 1
1: 0
2: 1
3: 3
4: 48
Right 1132794568 16:1713022-1713044 GTGTGTGGATAAAGGGAAGCCGG 0: 1
1: 0
2: 4
3: 28
4: 271
1132794558_1132794568 24 Left 1132794558 16:1712975-1712997 CCTGTTGTTTCCTTTTCTCGGCA 0: 1
1: 0
2: 0
3: 24
4: 297
Right 1132794568 16:1713022-1713044 GTGTGTGGATAAAGGGAAGCCGG 0: 1
1: 0
2: 4
3: 28
4: 271
1132794556_1132794568 30 Left 1132794556 16:1712969-1712991 CCTGAGCCTGTTGTTTCCTTTTC 0: 1
1: 0
2: 3
3: 129
4: 890
Right 1132794568 16:1713022-1713044 GTGTGTGGATAAAGGGAAGCCGG 0: 1
1: 0
2: 4
3: 28
4: 271
1132794562_1132794568 -1 Left 1132794562 16:1713000-1713022 CCCGGAGATGCTGGCCATCTGTG 0: 1
1: 0
2: 1
3: 26
4: 199
Right 1132794568 16:1713022-1713044 GTGTGTGGATAAAGGGAAGCCGG 0: 1
1: 0
2: 4
3: 28
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132794568 Original CRISPR GTGTGTGGATAAAGGGAAGC CGG Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
901079238 1:6574539-6574561 GTGTGGGGATACAGGGAGCCGGG - Intronic
901943724 1:12683989-12684011 GTGTGTGGAAAAGGTGCAGCTGG - Intergenic
902209345 1:14893535-14893557 GGGTGTGGAGGAAGGGAAGATGG - Intronic
903925629 1:26828673-26828695 GTGTGTGGTTAAAGGGTAAAGGG - Intronic
903944966 1:26956855-26956877 GTGTGTAGAGAAAGGGAAAGAGG + Intronic
904495133 1:30882307-30882329 CTGTGAGGAAAAATGGAAGCAGG - Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906725898 1:48044009-48044031 GTCTGTGGAGAAAATGAAGCAGG + Intergenic
907595954 1:55720103-55720125 GTGTGAGGATTAAGTGAAGCAGG + Intergenic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
910781889 1:90947017-90947039 CTGTGTGGATGAAGGCAAGGAGG + Intronic
911013012 1:93301613-93301635 GTGTGTGTATAAAAGGAGCCAGG + Intergenic
912008747 1:104933833-104933855 GTGTGTGGATGAGGGGAATGTGG - Intergenic
912451362 1:109769649-109769671 GTGTATAGATAAAGAGAAGGGGG + Intronic
912456704 1:109802930-109802952 GTGTGTGGAGAAAGGGTTTCTGG + Intergenic
912705736 1:111910622-111910644 GTGTGCGGAGAAAGTGAAGGGGG - Intronic
912745557 1:112242865-112242887 GCATGTGGGTAAAGAGAAGCAGG - Intergenic
913505234 1:119510834-119510856 GTGGGAGGATAAATGGAGGCTGG - Intronic
915154368 1:153862549-153862571 GTGTGTGGAAACTGGCAAGCTGG - Intronic
916941261 1:169680949-169680971 GAGTGGAGATAAACGGAAGCAGG - Intronic
919816385 1:201443413-201443435 AGGTGTGGATAGAGAGAAGCTGG + Intergenic
919853811 1:201692187-201692209 AGGTGTGGATATAGAGAAGCAGG + Intronic
921549382 1:216514945-216514967 GTGTGTGTATAAAGTAAAACTGG - Intronic
922999058 1:229990875-229990897 GTGTGTGGATATTGACAAGCAGG + Intergenic
923303241 1:232663030-232663052 GTGTGGGGCTCAGGGGAAGCAGG + Intergenic
924554222 1:245104734-245104756 GTGTGGGGAAAAGGGGAAGGAGG - Intronic
1064261459 10:13789888-13789910 TTCTGAGGATAATGGGAAGCTGG + Intronic
1067748288 10:48952924-48952946 GTGTGAGGGGAAAGGAAAGCTGG - Intronic
1068696518 10:59973285-59973307 GTGTGTGAATAAAGAGAAAACGG - Intergenic
1069819814 10:71220446-71220468 GTGTGTGGAAAGAGAGCAGCTGG - Intronic
1070078989 10:73167549-73167571 GTGTCTGGATAAGAAGAAGCAGG - Intronic
1070391181 10:75971884-75971906 CTGTGTGGTTAAAGGGTTGCTGG + Intronic
1070413949 10:76171595-76171617 GTAAGTGGAAAAAGGGAAGGGGG + Intronic
1071002828 10:80850144-80850166 GTGGGGGGATCAAGAGAAGCTGG + Intergenic
1073293561 10:102425137-102425159 GTGTCTGGACAAAGGCAAGGAGG + Exonic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1074360464 10:112821174-112821196 TTGTTTGGATGAAGGGAAGGAGG - Intergenic
1074435786 10:113433161-113433183 GTGTGTGGACAAATGGAAGCTGG + Intergenic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1074645926 10:115452107-115452129 GAGTGTGGAGAATGGGAAGCGGG + Intronic
1076623853 10:131809749-131809771 GTGTGTGGCTACGGGGAAGACGG - Intergenic
1077763532 11:5131848-5131870 GTGTGTGAAGAAAGAGAAGAAGG + Exonic
1077965090 11:7121813-7121835 GTGTGTGGATAAAGGCAGGGTGG + Intergenic
1078716187 11:13840989-13841011 GTGTGTGGATATATGTATGCTGG + Intergenic
1080738500 11:35041162-35041184 ATGTGTGCTTAAAGGGAAGTGGG + Intergenic
1081824509 11:46035578-46035600 GTGTTAGGATAAAGGGAATAAGG + Intronic
1083374040 11:62205316-62205338 GTGTGTGTGTAAGGGGAAGGGGG + Intergenic
1084073421 11:66753205-66753227 GTGTGTGTATGCAGGCAAGCAGG + Intronic
1084082736 11:66839467-66839489 GTATCTGGGTCAAGGGAAGCTGG + Intronic
1084343538 11:68526565-68526587 GTGTGTGAATAGAGGTAAGATGG - Intronic
1086953534 11:92914024-92914046 GTGATTGGATAAAGGGAGGGTGG + Intergenic
1089705135 11:120272355-120272377 GTGTGTGGATACAGGGAGCAGGG - Intronic
1090709448 11:129372794-129372816 GGGTTTGGAAAAAGGGAAGAAGG + Intergenic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091722702 12:2824813-2824835 GTGGGTGGAAAAATGGGAGCAGG - Exonic
1091796682 12:3301248-3301270 GAGTGAGGATGAAGGGGAGCAGG + Intergenic
1092015522 12:5155524-5155546 GGGTGTGGATAAAGGGGAGGTGG - Intergenic
1092842637 12:12557918-12557940 GTGTATGGAGAGAGGGAAGTGGG - Intronic
1093159696 12:15731865-15731887 GTGTGTAGGCAAAAGGAAGCTGG + Intronic
1097011317 12:55955409-55955431 GGGAGTGGATAGAGGGCAGCTGG - Intronic
1097014046 12:55972992-55973014 GTGTGTGGAGAAAGTGAAGTAGG - Intronic
1097309064 12:58098881-58098903 GAGTGTTTATAAAGGGAAGCAGG - Intergenic
1097797659 12:63880915-63880937 GTGTGCAGATAAAGGAAGGCTGG - Intronic
1097989950 12:65824326-65824348 GTGGGCGGATAAAGGGGAGGGGG - Exonic
1098454184 12:70653447-70653469 GGGTGTGGTAAGAGGGAAGCAGG + Intronic
1098504497 12:71233422-71233444 GTGTGAGGGAAAAGGGAAGGTGG + Intronic
1098590698 12:72208175-72208197 GTGTGTGTATAAAGGGCAGAGGG - Intronic
1100457795 12:94768917-94768939 GTGTGTGGCCCAAGGGCAGCAGG + Intergenic
1102950927 12:117030889-117030911 GGGTCTGGATAAAGGTAAGGGGG - Intronic
1104656056 12:130574818-130574840 GTGAGTGGACAGAGGGAACCAGG - Intronic
1106234849 13:27853095-27853117 GAGTGTGGCTTAAGGGACGCGGG - Intergenic
1106875432 13:34066842-34066864 GTGTGTGGAAACAAGGAGGCCGG + Intergenic
1107088797 13:36453676-36453698 CTGTGTGGTTAAAAGGAAGCAGG - Intergenic
1109075639 13:57831845-57831867 GTGTGTTGATGTTGGGAAGCGGG + Intergenic
1110210019 13:72960623-72960645 GTGTGTGGGGAAAGGGTGGCAGG - Intronic
1110910690 13:80958765-80958787 GTATGTGGATAAATGGAGGTAGG - Intergenic
1111705880 13:91748938-91748960 GTGTGTGAATAGAGAGAAGGGGG + Intronic
1111972915 13:94935698-94935720 GGGTGAGGATATGGGGAAGCTGG - Intergenic
1113301098 13:109020003-109020025 TTATTTGGATAAATGGAAGCTGG + Intronic
1114975120 14:28086373-28086395 GTATATGCATAAAGGGAAGAAGG + Intergenic
1115975769 14:38995429-38995451 GGGTGGGCATAAAGGGAAGAGGG - Intergenic
1118054370 14:62063854-62063876 GTGTGTTAATAAAGGGATGAAGG + Intronic
1121113952 14:91330853-91330875 GTGTGTGGGCTAAGGGAAGGCGG + Intronic
1121115439 14:91339686-91339708 GTGGGAGGATACAGGGAATCAGG - Intronic
1121241892 14:92436877-92436899 GGGTGTGGGTAAAGGGGAGAAGG - Intronic
1121696185 14:95914197-95914219 GTGTGTGGATGATCTGAAGCTGG + Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1124949656 15:34305635-34305657 GTGTGAGGATAAATGGAGTCAGG + Intronic
1125266433 15:37886714-37886736 CTGTCTAGATAAAGGGATGCTGG - Intergenic
1125800483 15:42442364-42442386 GTGTGAGGCTACAGGGAACCTGG + Exonic
1125918877 15:43512647-43512669 GGGTGTCTGTAAAGGGAAGCAGG - Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1129115922 15:73365458-73365480 GGGTGTGGGGATAGGGAAGCGGG - Intronic
1129509161 15:76107947-76107969 GGTTGTGGACAAAGGGAAGAGGG - Intronic
1129897033 15:79116088-79116110 ATAGATGGATAAAGGGAAGCTGG + Intergenic
1130164795 15:81443223-81443245 GTGTGTGTATAAAAACAAGCAGG - Intergenic
1130436610 15:83905850-83905872 GTATGGGGAAAAAGGCAAGCTGG - Intronic
1130683040 15:86013173-86013195 CTGTGTGGATAATTGAAAGCTGG + Intergenic
1130970362 15:88727475-88727497 GAGTGATGATTAAGGGAAGCTGG + Intergenic
1131661215 15:94519485-94519507 GTGTGTGGATTAATGGAACGCGG - Intergenic
1131961433 15:97793655-97793677 GTGTTAGGCTAAAAGGAAGCAGG - Intergenic
1132794568 16:1713022-1713044 GTGTGTGGATAAAGGGAAGCCGG + Intronic
1137720727 16:50625909-50625931 GACTGTGGAGAGAGGGAAGCAGG - Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1138271795 16:55701028-55701050 GTGAGTGGATAAAGGAATGAAGG - Intronic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1139527300 16:67524863-67524885 GTGTGTGTATGAGGGGAGGCAGG - Intronic
1141854791 16:86673669-86673691 GTGGGTGCATGAAGGGAAGGAGG - Intergenic
1141854871 16:86674018-86674040 GTGTATGGATGAAGGGATGGAGG - Intergenic
1143913115 17:10268302-10268324 GTGTATGGGGAAAAGGAAGCAGG - Intergenic
1144356584 17:14452335-14452357 GTGAGAAGATTAAGGGAAGCGGG - Intergenic
1144620714 17:16816765-16816787 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1145147293 17:20492995-20493017 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1145271652 17:21407963-21407985 GTGGGTGGATAAATGAATGCAGG - Intronic
1146034185 17:29391094-29391116 GTGTGTGGAAGAAGGGATGTGGG + Intronic
1147572104 17:41577663-41577685 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1148156274 17:45426760-45426782 GTGTGTGGACAACGGGCAGAAGG - Intronic
1148630159 17:49101110-49101132 GTGTGTGCATAAACGGAGACAGG + Intergenic
1148844207 17:50519153-50519175 GTGTCTGGACACAGGGATGCTGG + Intronic
1149043630 17:52219623-52219645 GTGTGTGGATGAAGACAAGAAGG + Intergenic
1150982404 17:70157222-70157244 GTGTGTGGATAGCAGGAAGGAGG + Intergenic
1151730126 17:75906107-75906129 TTGTGTGGATAATGAGAAGTTGG - Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152779144 17:82218753-82218775 GTGCGTGGAGAACGGGCAGCAGG + Intergenic
1153328168 18:3843120-3843142 GTGTGTGTATATAGGGAAGGTGG + Intronic
1155365763 18:25047760-25047782 GTGTGTGGATAAGGAGTAGGTGG - Intergenic
1156519318 18:37708294-37708316 GTGTGAGGCCAAAAGGAAGCAGG - Intergenic
1157389202 18:47287313-47287335 GTGGGAGGTGAAAGGGAAGCAGG - Intergenic
1159121844 18:64180036-64180058 GTGTGTGGGTCTAGGGGAGCTGG - Intergenic
1160533420 18:79578277-79578299 GTGTCTGGACAGAGGGAACCAGG - Intergenic
1160901018 19:1428772-1428794 GGGTGTGTCTAAAGGGAAGGGGG + Intronic
1163383646 19:16985712-16985734 ATGAGTGGATAAAGGGTAGTAGG + Intronic
1163582468 19:18146749-18146771 TTGTGTGGATGAATGGATGCTGG + Intronic
1163799728 19:19357086-19357108 GTCTGTGACTAAAGGGACGCTGG + Exonic
1165084145 19:33331201-33331223 GTATGTGGACAAAGGGTAGAGGG + Intergenic
1165397813 19:35576773-35576795 CTGTGGGGGTAAAGGCAAGCTGG + Intergenic
1166329400 19:42069676-42069698 CTGGGTGGAGAAAAGGAAGCCGG + Intronic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1166803840 19:45473368-45473390 GTGTGAGGATTAAGGGACGGGGG + Exonic
925442525 2:3900701-3900723 GTTTGTGGTTAAACAGAAGCGGG + Intergenic
925902042 2:8515800-8515822 GAGGGTGGATAAAGAGGAGCAGG - Intergenic
928169613 2:28994950-28994972 ATGTGGGGATAAAGGGCTGCTGG + Intronic
928348523 2:30523213-30523235 GTGGGTGTATAAAAGGAAGTAGG + Intronic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
930617386 2:53607718-53607740 GTGTGTGGATCAAGGGTTCCAGG - Intronic
930768802 2:55111760-55111782 GTGTCTGGATAAAGGAAGGGTGG - Intronic
931087463 2:58848980-58849002 GTGTGTGGATCAATTGAAGTCGG + Intergenic
931734237 2:65179497-65179519 ATGTATGGATAAAGTGAAACAGG - Intergenic
931829754 2:66038536-66038558 GTGTGAGGATGAAGAGCAGCAGG - Intergenic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932522592 2:72428641-72428663 GTGGGTGGAAAAAGCCAAGCGGG + Intronic
933247117 2:79987971-79987993 CTGTGTGGTTTAAGGGAAGTTGG + Intronic
936763707 2:115817930-115817952 GGGAGAGGAAAAAGGGAAGCTGG + Intronic
937992558 2:127672691-127672713 CTGTGTGGAGAAAGGGCTGCTGG - Intronic
939744669 2:145953987-145954009 GTGAGTGGATAAAGGAAATGTGG - Intergenic
940251789 2:151685734-151685756 GTGAGTGGATACAATGAAGCTGG - Intronic
940847894 2:158661143-158661165 ATGTGTGGATAATGGGGAGCGGG + Intronic
941248390 2:163130519-163130541 GTGTGTGGAATAAGAGAAGCTGG + Intergenic
942485252 2:176432521-176432543 GTGTGTGTATTATGGGAAGAAGG - Intergenic
943432104 2:187816966-187816988 GTGTCTGGATGAAGGGAACATGG + Intergenic
945193563 2:207216108-207216130 GTGTGTGAAGAAAGGGAAGCAGG + Intergenic
945265571 2:207888340-207888362 GTGTGTGTATGAAGAAAAGCAGG - Intronic
945580367 2:211587122-211587144 GTGTGTGGATCAAGGAGATCAGG + Intronic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
947571819 2:231241873-231241895 GTCTGTGCAAAAAGGGAAACAGG + Intronic
947918151 2:233848099-233848121 TTGAGTCGCTAAAGGGAAGCTGG - Intronic
948870285 2:240794422-240794444 GTGTGTGGGTAAAGGGCAGATGG - Intronic
1169737061 20:8848678-8848700 GTGTGTGGATGAAGGAGGGCTGG + Intronic
1170217680 20:13908877-13908899 GGGTATGTACAAAGGGAAGCTGG - Intronic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1172149533 20:32780276-32780298 GGGTGGGGTGAAAGGGAAGCAGG - Intronic
1174400291 20:50272283-50272305 GGCTGTGGTTAAACGGAAGCAGG - Intergenic
1174577279 20:51545515-51545537 ATGTGTGGATAAATGGAGGATGG + Intronic
1175499886 20:59442173-59442195 GAGTGGGGAGAAAGGGAAGGAGG - Intergenic
1175739528 20:61411007-61411029 GTGGGTGGATAATGGAAAGATGG - Intronic
1177958862 21:27636711-27636733 GTGTTAGGAAAAAGGGAAACAGG + Intergenic
1178297685 21:31424406-31424428 GTGTGTGGATAAACGAAATGCGG + Intronic
1178501030 21:33125571-33125593 GGCTTTGGATAAGGGGAAGCAGG + Intergenic
1178777329 21:35564735-35564757 GTGGGTGGATATTGGGGAGCAGG - Intronic
1181406727 22:22690224-22690246 GTGAGTGGACAGGGGGAAGCTGG + Intergenic
1181684386 22:24518432-24518454 GAGTGTGGATAAAAGGCAACAGG + Intronic
1182262291 22:29082579-29082601 GTCTGTTGAAAGAGGGAAGCTGG - Intronic
1184654845 22:45935861-45935883 GTGTGTGGTGATGGGGAAGCTGG + Intronic
1184991034 22:48170234-48170256 ATGGGTGGATGAAGGCAAGCGGG - Intergenic
950091339 3:10297284-10297306 GTGTTTGGGAAAAGGGAAACAGG - Intronic
950725411 3:14913922-14913944 GTGTGGGGAAGAAGAGAAGCAGG - Intronic
951308033 3:21090041-21090063 GTGAGTGGATAAAGAAAATCTGG + Intergenic
952270803 3:31829599-31829621 GTGTGTCTATGAGGGGAAGCAGG + Intronic
952593208 3:34982687-34982709 GTGTGTGGGGTAAGGGAAGAGGG - Intergenic
955898798 3:63729421-63729443 GAGTGGGGATAAAGAGAGGCTGG + Intergenic
956068343 3:65420247-65420269 GTGCCTGGAGAAAGGGGAGCAGG - Intronic
956763262 3:72462193-72462215 TTGTGTGGATAAAGCGAAGGTGG + Intergenic
962053699 3:131846490-131846512 GAATGGGGATAAAGGGAAGCTGG - Intronic
962227199 3:133623411-133623433 GTATGTGGATAAAGAGATTCAGG + Exonic
964154449 3:153567695-153567717 TTGTTTGGATAAAATGAAGCTGG + Intergenic
964389367 3:156181717-156181739 GTGTGGGGAGAAATGGAAGGAGG + Intronic
967341635 3:188405210-188405232 GTATGTGGAAAAGGGGAAGAGGG - Intronic
969571724 4:8012707-8012729 GTGAGTAGATAAGTGGAAGCTGG - Intronic
970174300 4:13323014-13323036 TTGTGGGGAAAAAGGTAAGCTGG - Intergenic
974474027 4:62356533-62356555 GTGTGTGGATATAGGAAAGCTGG - Intergenic
977397010 4:96484006-96484028 GTCTGTGGAAAGAGGGAAGGAGG - Intergenic
977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG + Intergenic
979163730 4:117498094-117498116 GTGTGTGCAGAAAGGGAGACTGG - Intergenic
979663086 4:123281176-123281198 TTTTGTGGATAAAGGGAAAAAGG + Intronic
979946897 4:126843620-126843642 GTGTCTGGACAAGGGGAACCGGG - Intergenic
980570859 4:134618292-134618314 TTGTGTGGATAATGGGAATAAGG + Intergenic
981147669 4:141343896-141343918 GTATGTGGATAAAGTTAAGAAGG + Intergenic
982547393 4:156751325-156751347 GTCTGTGGATAAAGGGTAGAGGG + Intergenic
985306542 4:188548252-188548274 GTGTTTGGATAAGGGGAAACAGG - Intergenic
985477728 5:89216-89238 GTGTGTGGACAGAGGGGAGGAGG - Intergenic
985733031 5:1561511-1561533 ATGTGGGGATAAGGGGAAGGCGG + Intergenic
988185901 5:27861612-27861634 GTGTGTGCATGAAGGGAAGGGGG - Intergenic
992161837 5:74011904-74011926 CAGAGTGGAAAAAGGGAAGCTGG + Intergenic
993626576 5:90232204-90232226 GTGTGAGGATAAAGAGAGGTGGG + Intergenic
995495790 5:112741483-112741505 GTGTGAGAATAAAGGGGAGAAGG - Intronic
996278615 5:121699194-121699216 GTGTCTGTAAAAATGGAAGCAGG + Intergenic
996887113 5:128370453-128370475 GTGTGTGCTTAAATGGAAGGAGG + Intronic
997391919 5:133524170-133524192 GTGTCTGGAGCATGGGAAGCTGG + Intronic
998165138 5:139838491-139838513 ATGGGTGGATAAAGGGGAGAGGG - Intronic
999379011 5:151106931-151106953 GTGGGAGGAGAAAGGGAAGAGGG + Intronic
1000120797 5:158195994-158196016 GTGTGTGGACAATGAGAAGCAGG - Intergenic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1005879315 6:30043034-30043056 GTGTGTGGGGACAGGGAAGATGG + Intergenic
1007376326 6:41459356-41459378 ATGTGTGGATAAACTGAAGGGGG + Intergenic
1007413547 6:41678968-41678990 GTGGGTGGATAAAGGCCAGCTGG - Intergenic
1007617981 6:43193373-43193395 GTGTTTGGAAAAAGGGAAAAGGG + Intronic
1008710653 6:54222601-54222623 GTAAGTGGATAAAGGAAAGGTGG - Intronic
1010686527 6:78859937-78859959 GTGTGTGGAGGTAGGGAAGGCGG - Intergenic
1011276941 6:85641778-85641800 GTGTGTGGAGAAAGCAAAACTGG + Intronic
1011344060 6:86349561-86349583 CTGTGTGGATAACTGGAAGGAGG - Intergenic
1011412409 6:87079555-87079577 CTGTGTGTATAAAGGGTTGCTGG - Intergenic
1011484088 6:87824135-87824157 GTGTGCTGATAAAGGGAAGCAGG + Intergenic
1012405792 6:98896271-98896293 GTGTGTGTATCAAAGGAAGAAGG + Intronic
1012526045 6:100178869-100178891 GTGAGTGAAAAAAGGAAAGCAGG - Intergenic
1013271273 6:108547427-108547449 AGGTGAGGATAAGGGGAAGCAGG + Intergenic
1013399575 6:109779378-109779400 ATGTGGGAATAAAAGGAAGCTGG + Intronic
1014474937 6:121860408-121860430 AGGTGTGGATAAAGGGTAGCAGG + Intergenic
1020036019 7:4963535-4963557 GAGTGTGGCTAAAGGGAGACAGG - Intergenic
1021539441 7:21740858-21740880 GTGTGAGGATATAGAGAAACTGG - Intronic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1027998397 7:85457674-85457696 TTGTGTGGATAAAGCAATGCTGG - Intergenic
1028819070 7:95184845-95184867 ATGAGTGGATAAAGAAAAGCTGG - Intronic
1030241661 7:107332701-107332723 GTGTGGGGCAAAAGAGAAGCAGG + Intronic
1030564147 7:111131255-111131277 GTGTGAGGCTAAAGGGAATTAGG + Intronic
1032080609 7:128856724-128856746 GTCTGTGGATAAAGGGTTGGTGG - Exonic
1032539922 7:132694421-132694443 ATGGGTGGAGAAAGGGAGGCTGG - Intronic
1033770565 7:144546735-144546757 GTGGGAGGTGAAAGGGAAGCAGG - Intronic
1033817992 7:145098553-145098575 CTGTGTGTTTATAGGGAAGCTGG + Intergenic
1035348666 7:158227099-158227121 GTGCGTGGATAAATGGGAGGAGG + Intronic
1035399132 7:158553393-158553415 GTGTGTGTATAAGGGGAGGCTGG - Intronic
1035407751 7:158610739-158610761 GTGTGTGTATAAAGTGAACTGGG - Intergenic
1035607985 8:941550-941572 GCCTGTGGAGAAAGGGGAGCAGG - Intergenic
1036020709 8:4842214-4842236 GTGTGGGAATTAAGGGAACCAGG + Intronic
1036224716 8:6947982-6948004 CTGTGTGGATAAAGGCACACTGG - Intergenic
1036227956 8:6975776-6975798 CTGTGTGGATAAAGGCACACTGG - Intergenic
1036230409 8:6994893-6994915 CTGTGTGGATAAAGGCACACTGG - Intergenic
1036232861 8:7013996-7014018 CTGTGTGGATAAAGGCACACTGG - Intronic
1036654627 8:10670226-10670248 GTGTGTAGAGAAAGGGGAGAAGG + Intronic
1037848170 8:22303126-22303148 GTGTGAATATAAAGGGCAGCAGG + Intronic
1038284133 8:26191793-26191815 GTGTGTGGGAAAGGGGCAGCAGG - Intergenic
1038492591 8:27981491-27981513 GTGAGGGGAGACAGGGAAGCTGG - Intronic
1041667879 8:60463507-60463529 GTGTGTGGAGACAGGGATCCTGG + Intergenic
1042153175 8:65811725-65811747 GTGTGTAGTTAGAGGGAAGAAGG + Intronic
1042654495 8:71081347-71081369 GAATGGGGATAAAGGGAAGGAGG - Intergenic
1042830989 8:73028316-73028338 GTGTGAGGTTAAAGAGAGGCAGG - Intronic
1043960785 8:86416266-86416288 GTGTGAAGACAAAGGGAAGGAGG + Intronic
1044313279 8:90720468-90720490 CTGAGTGGATTAAGGTAAGCTGG - Intronic
1044554038 8:93542652-93542674 GTGTTAGGATAGAGGTAAGCTGG - Intergenic
1044870843 8:96618492-96618514 GTGTGTGGGGAAGGGGAACCAGG + Intergenic
1046282340 8:112050292-112050314 GTGAATGGATACAGGGAATCAGG - Intergenic
1047415798 8:124663546-124663568 GTGTGGGGAGAAAGGGGAGGTGG - Intronic
1048312406 8:133335773-133335795 GTGGGAGGTTAAAGGGAAGGAGG + Intergenic
1048333593 8:133487430-133487452 GTGTGTGGATAATGGCTAGTGGG + Intronic
1049333493 8:142068911-142068933 GTGTGTGGATGACAGGAATCGGG + Intergenic
1049677237 8:143896102-143896124 GTGAGTGGATAAAGAGAATGTGG - Intergenic
1050585552 9:7108062-7108084 TTGTGTGCATAATGGAAAGCAGG + Intergenic
1050628894 9:7538038-7538060 GTGTTTGGATAAAGAGTAGCAGG + Intergenic
1050719959 9:8577099-8577121 GAGAGTGGAAAAAAGGAAGCTGG - Intronic
1051945382 9:22563191-22563213 ATGTGTGGATAAAGGAAATGTGG + Intergenic
1054867111 9:70013958-70013980 GTGTTTGGTTAGAGGGAATCAGG + Intergenic
1055785981 9:79869377-79869399 GATTGTGGATAGAGAGAAGCAGG + Intergenic
1056137329 9:83643042-83643064 GTGTGTGGACACAGGGCTGCCGG - Intronic
1056291597 9:85149083-85149105 GTGTTTGGAAAAAGGAAGGCAGG + Intergenic
1058350736 9:104019155-104019177 GTGTGTTGATAAGGTGAAGGTGG + Intergenic
1059763733 9:117363502-117363524 GTGTCTCCATAAAGGGAGGCGGG - Intronic
1059840085 9:118205263-118205285 GTGAGTGGATGAAGTGAGGCAGG + Intergenic
1059900019 9:118913761-118913783 GAGTGTGGATAAAGAGAAACTGG - Intergenic
1061923674 9:133795645-133795667 GTGTGTGGGTAAACTGAGGCAGG - Intronic
1186216938 X:7310728-7310750 GTGTGAAGATAAAGGGAAGGGGG - Intronic
1188955537 X:36431596-36431618 GTGTGTGGGTAGAGGGAGGGAGG + Intergenic
1191772578 X:64777339-64777361 GTGGGTGGATAAAGATAAGTGGG - Intergenic
1192309899 X:70002213-70002235 GTGTGTAGATAAAGAAAAGCAGG + Intronic
1192877362 X:75245791-75245813 GTGGGTGGAGAAAGGGAGGAGGG + Intergenic
1193685167 X:84568948-84568970 GTGTGTGGAAAAAGGGAATGTGG + Intergenic
1193787438 X:85776529-85776551 GTGAAAGGTTAAAGGGAAGCAGG + Intergenic
1194903946 X:99550006-99550028 GGGTGTGGAAAAAGGGATGGAGG + Intergenic
1195066980 X:101246172-101246194 GTGCGAGGATAAAGGAAGGCAGG - Intronic
1195927453 X:110039898-110039920 GTGTGTGGATAAGGGGTTGGGGG + Intronic
1197262084 X:124330878-124330900 GTGTGTGGGGAAAGGGAGACAGG - Intronic
1197615433 X:128685345-128685367 TTGTCTGGATAAGAGGAAGCAGG - Intergenic
1197746634 X:129935894-129935916 GACTGTGGAAGAAGGGAAGCAGG + Intergenic
1198786675 X:140296282-140296304 GCGTGTGTATAAAGTGAAGGGGG - Intergenic