ID: 1132796317

View in Genome Browser
Species Human (GRCh38)
Location 16:1725039-1725061
Sequence AGGCAGGAGGGTGGGCCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 499}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132796301_1132796317 28 Left 1132796301 16:1724988-1725010 CCCCTGGGGTCCCCACCTCTTCA 0: 1
1: 0
2: 2
3: 39
4: 332
Right 1132796317 16:1725039-1725061 AGGCAGGAGGGTGGGCCCGCTGG 0: 1
1: 0
2: 3
3: 39
4: 499
1132796303_1132796317 26 Left 1132796303 16:1724990-1725012 CCTGGGGTCCCCACCTCTTCACA 0: 1
1: 0
2: 3
3: 43
4: 304
Right 1132796317 16:1725039-1725061 AGGCAGGAGGGTGGGCCCGCTGG 0: 1
1: 0
2: 3
3: 39
4: 499
1132796304_1132796317 18 Left 1132796304 16:1724998-1725020 CCCCACCTCTTCACACTGCTGAG 0: 1
1: 0
2: 1
3: 36
4: 334
Right 1132796317 16:1725039-1725061 AGGCAGGAGGGTGGGCCCGCTGG 0: 1
1: 0
2: 3
3: 39
4: 499
1132796302_1132796317 27 Left 1132796302 16:1724989-1725011 CCCTGGGGTCCCCACCTCTTCAC 0: 1
1: 1
2: 3
3: 34
4: 319
Right 1132796317 16:1725039-1725061 AGGCAGGAGGGTGGGCCCGCTGG 0: 1
1: 0
2: 3
3: 39
4: 499
1132796308_1132796317 13 Left 1132796308 16:1725003-1725025 CCTCTTCACACTGCTGAGGAGTG 0: 1
1: 0
2: 1
3: 17
4: 218
Right 1132796317 16:1725039-1725061 AGGCAGGAGGGTGGGCCCGCTGG 0: 1
1: 0
2: 3
3: 39
4: 499
1132796307_1132796317 16 Left 1132796307 16:1725000-1725022 CCACCTCTTCACACTGCTGAGGA 0: 1
1: 1
2: 1
3: 20
4: 304
Right 1132796317 16:1725039-1725061 AGGCAGGAGGGTGGGCCCGCTGG 0: 1
1: 0
2: 3
3: 39
4: 499
1132796305_1132796317 17 Left 1132796305 16:1724999-1725021 CCCACCTCTTCACACTGCTGAGG 0: 1
1: 0
2: 1
3: 25
4: 313
Right 1132796317 16:1725039-1725061 AGGCAGGAGGGTGGGCCCGCTGG 0: 1
1: 0
2: 3
3: 39
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132796317 Original CRISPR AGGCAGGAGGGTGGGCCCGC TGG Intronic
900261251 1:1730927-1730949 AGGTAGGAGGCTGGGCACGGGGG + Intronic
900370357 1:2329487-2329509 AGGCGGGGGGCTGGGCCCCCAGG - Intronic
900372349 1:2337563-2337585 AGACAGCAGGGTGGGCCCTGGGG - Intronic
900586544 1:3435091-3435113 AGGGAGGCGGCTGGGCCCGGGGG - Exonic
901049689 1:6419992-6420014 AGGCAGGAGGTGGGACCAGCGGG - Intronic
901158293 1:7155208-7155230 AGGCAGGAAGGTGGCCTCGGGGG + Intronic
901490971 1:9596026-9596048 AGGCGGACGGGTGGGCACGCGGG + Intronic
901529565 1:9844475-9844497 AGGCAGGAGGAGGGGCTGGCCGG + Intergenic
901597852 1:10399294-10399316 GGGCAGGGGGCCGGGCCCGCAGG - Intronic
902700374 1:18168086-18168108 AGGCAGCAGGGTGGTCCTGCTGG - Intronic
902769138 1:18635552-18635574 AGGCAGGCAGGTGGGCAGGCAGG + Intronic
902881644 1:19375462-19375484 AAGGAGGAGAGTGGCCCCGCAGG - Intronic
903134977 1:21303275-21303297 AGGGTGGAGGGTGAGGCCGCTGG - Intronic
903315486 1:22501309-22501331 GGGCAGGAGCATGGGACCGCAGG + Intronic
903353971 1:22735192-22735214 AGGCAGGAGGGTGAGGCAGGAGG + Intronic
903797736 1:25942643-25942665 AGGCAGGAGGGAGAGGACGCTGG + Intergenic
903930914 1:26862076-26862098 AGGCAGGAAAGTGGGACAGCCGG + Intergenic
905392633 1:37647479-37647501 AGGCAGCAGGCTGGACCCGGTGG + Intergenic
905862716 1:41361761-41361783 AGGCAGGGGGCTGGACGCGCTGG - Intergenic
905923782 1:41735891-41735913 AAGCAGGAGGGTGGGGGCTCTGG + Intronic
906136933 1:43506457-43506479 AGGCAGAAGGTTGGGCAGGCTGG - Intergenic
906493473 1:46286063-46286085 AGGCGGCAGGGTGGGCCACCAGG + Exonic
906680587 1:47723293-47723315 AGACAGCATGGTGGGCCTGCGGG + Intergenic
906790198 1:48652490-48652512 AGGCAGGATGGTGGACACACAGG + Intronic
907261074 1:53219121-53219143 ATAGAGGAGGGTGGGCACGCCGG - Intronic
907429912 1:54405867-54405889 AGGCAGGTGGGCGGGCGGGCGGG - Intronic
907437517 1:54459045-54459067 AGGAAGGAAGGTGGGCAGGCAGG + Intergenic
908027924 1:59971001-59971023 AGGCAGGAGGATGGGGCCAGTGG + Intergenic
909671512 1:78194212-78194234 TGGCAGGAGGTTGGGCCCCAAGG + Intergenic
912701570 1:111882049-111882071 AGGCAGGTGGGTGGCCTCTCCGG + Intronic
915145538 1:153794110-153794132 AGGCAGGAGACTGGGGCTGCTGG + Intergenic
915320093 1:155051660-155051682 AGGCAGGAGGCAGGGGGCGCCGG - Intronic
915493555 1:156265608-156265630 GAGCAGGAGGGTGGACCCTCAGG + Intronic
915594110 1:156886765-156886787 AGGCAGGAGGGTGGGGTTGGTGG - Intergenic
915662499 1:157415862-157415884 AGGCAGGAGTCTGTGCCCGGAGG - Intergenic
915724575 1:158008319-158008341 AGGCAGGAGGCTGTGCCCCTTGG + Intronic
917344482 1:174015065-174015087 AGGTAGGATGGAGGGCCAGCTGG - Intronic
917369190 1:174270437-174270459 AGGTAGGAGGGTGGGAGAGCGGG + Intronic
918074619 1:181160869-181160891 AGGCAGCAGGGTGGACCAGCAGG - Intergenic
918466673 1:184827769-184827791 AGGAAGGAGGGTGGTCTCTCTGG - Intronic
918695051 1:187534742-187534764 AGGAAGGAGGGCGGGCGGGCGGG + Intergenic
919746791 1:201013968-201013990 TGCCAGGAGGGAGGGCCGGCTGG + Intronic
920328151 1:205183207-205183229 AGGCAGGAGGGTGGGGAAGAGGG + Intronic
920455375 1:206097222-206097244 AGGCAGGAGGGAGGGACCCTGGG - Intronic
920562662 1:206949926-206949948 AGCCTGGAGGGTGGCCCTGCTGG - Intergenic
920649707 1:207827642-207827664 AGCCAGGAGGGTGGCCCATCAGG - Intergenic
920698832 1:208202543-208202565 AGGCAGGAGAGTGGACCAGGTGG + Intronic
921084678 1:211778053-211778075 AGGCACGAGGCTGGGCGCGGTGG + Intronic
921937396 1:220807866-220807888 AGAAAGCAGGGTGGGCCAGCGGG + Intronic
922213423 1:223502210-223502232 AAGCAGGGAGGTGGGACCGCAGG + Intergenic
922287519 1:224183154-224183176 AGGCAGGCGGGCGGGCCGGGGGG + Exonic
923670229 1:236034131-236034153 AGGCATGAGGCTGGGCCTGGTGG + Intronic
924708983 1:246518990-246519012 AGGCAGGAGGTGGGGCCAGGAGG - Intergenic
1063361467 10:5462969-5462991 AGGCTGGAGGGAGGGCAGGCTGG - Intergenic
1063458779 10:6202802-6202824 GGGGAGGAGGGTGGGCGAGCCGG - Intronic
1066389621 10:34968284-34968306 AGGCAGGAGGCTGGGGCCCAGGG - Intergenic
1066703684 10:38156490-38156512 AGCCCGGAGGGTGGGACCCCAGG + Intergenic
1067553869 10:47254205-47254227 AGGCATGGGGGTGGACCCGGAGG + Intergenic
1069789060 10:71007766-71007788 AGGCAGGAGACTGGGCCAGGAGG + Intergenic
1069991601 10:72319820-72319842 ATGCTGGAGGCAGGGCCCGCCGG - Intergenic
1069993471 10:72328912-72328934 TGGCAGGAGGTTGGGCCCTGAGG + Intergenic
1070022935 10:72604558-72604580 AGGCAGAAGGCCGGGCACGCTGG - Intronic
1070290254 10:75109161-75109183 AGGCAGAGGGGTGGGCGGGCTGG - Exonic
1070706969 10:78646872-78646894 AGGCAGGAGGTTGGCCCAGAAGG - Intergenic
1070800408 10:79242019-79242041 AGGCAGGTGGGTGGGGCTGGGGG + Intronic
1071457748 10:85863726-85863748 GGACAGGAGGGTGTGCCTGCCGG + Intronic
1071617988 10:87094262-87094284 AGGCCGGAGGGGAGGGCCGCAGG + Intronic
1072140205 10:92582898-92582920 AGTCAGCAGGCTGGGCACGCTGG - Intergenic
1072518309 10:96208331-96208353 AGGTAAGAGGGTGGTCCAGCAGG + Intronic
1073123123 10:101133887-101133909 AGGGAGGTGGTTGGGCTCGCGGG + Intronic
1073177364 10:101564678-101564700 AGGCAGGCAGGTGGGCAGGCGGG + Intergenic
1073458836 10:103653899-103653921 AGGTGGGAGGGTGGGGCCTCGGG - Intronic
1073480723 10:103784688-103784710 AGGCAGGAGGATGGGTCTGCTGG + Intronic
1074105695 10:110388219-110388241 AGGCAGGTGGGTGCACCCACAGG - Intergenic
1074757466 10:116635113-116635135 AGGCAGCAGGGTGGGCTGGAGGG + Intronic
1075666174 10:124232718-124232740 AGACCTGAGGGTGGGCCAGCAGG - Intergenic
1075861188 10:125678546-125678568 AGGCAGGTGGGTGGGTTCTCAGG + Intronic
1076065584 10:127445236-127445258 AGGAAGGAGAGTGGGCTCCCCGG - Intronic
1076351156 10:129816088-129816110 CGGCAGGAGGGTGGGGATGCTGG - Intergenic
1076371880 10:129960370-129960392 AGGCAGGAGGCTGGGTGAGCGGG - Intronic
1076624953 10:131816059-131816081 AGGGAGGAGGGTTGGCTCCCTGG - Intergenic
1076800737 10:132826894-132826916 AGTCAGGAGGGTGGGCGCTGTGG + Intronic
1076840587 10:133043398-133043420 AGGCAGGAGGGTGTCCAGGCAGG - Intergenic
1076844052 10:133060457-133060479 GGTCAGGAGGGTGGGCAAGCAGG + Intergenic
1076904950 10:133357044-133357066 AGGCAGGCGGGCGGGCGGGCTGG - Intronic
1076908889 10:133377770-133377792 AGGTGGGTGGGTGGTCCCGCTGG + Intergenic
1077077134 11:706886-706908 AGGCAGGAGGGTGGGCTGGCAGG + Intronic
1077146987 11:1050763-1050785 AGGCAGGAGGTGGGCCCAGCGGG + Intergenic
1077217177 11:1399786-1399808 AAGAAGGAGGCTGGGCCCGACGG - Intronic
1077227399 11:1444460-1444482 AGGCAGGAGGCTGGGAGGGCCGG - Intronic
1077283490 11:1755933-1755955 AGGCAGGAGGGAGGGTCTGAGGG - Intronic
1077320748 11:1940256-1940278 AGGCTGGAATGTGGGCACGCCGG - Intergenic
1077332888 11:1991051-1991073 AGGCGGGAGGCCGGGTCCGCGGG - Intergenic
1077506265 11:2931258-2931280 AGGCAGGCTGGTGGGCCTGGAGG - Intergenic
1077960609 11:7073002-7073024 GGGCAGGAGAGAGGGCCCCCAGG - Intergenic
1078095107 11:8291925-8291947 AGGCAGGGAGGTGAGCCCACAGG + Intergenic
1078190683 11:9091085-9091107 AGGCAGGAGGGTGCGGACCCTGG - Intronic
1078241568 11:9535246-9535268 AGGCAGGATGGTGGGCCTTGGGG + Intergenic
1078436576 11:11330492-11330514 AGGCAGGAGGGAGGGGAGGCTGG + Intronic
1078885185 11:15493003-15493025 AGGCAGGAGGCTGGGAGCGATGG - Intergenic
1079353446 11:19712599-19712621 ACGCAGGGGTGTGGGCCCCCCGG + Intronic
1080641717 11:34162308-34162330 AGGCAGGGTGGAGGGCCCGAGGG + Intronic
1080653698 11:34242285-34242307 AGGCAGGAGGGTGGGAGCAAGGG + Intronic
1080668726 11:34357672-34357694 AGGAAGGAGGGTGGCCCGGAGGG - Exonic
1081598187 11:44473642-44473664 AGGTAGGAGGCTAGGCCCTCGGG + Intergenic
1081808599 11:45903069-45903091 AGGCAGGGGGCTGGGGCCGCGGG - Exonic
1082023325 11:47552916-47552938 AGGCAAGAGGGAGGCGCCGCGGG - Intronic
1082996047 11:59256424-59256446 TGGCTGGTGGGTGGGCCTGCGGG - Intergenic
1083034964 11:59628529-59628551 AGGCAGGCGGGTGGGCAGGAGGG - Intergenic
1083159229 11:60844388-60844410 GGAGAGGAGGGTGGGCCTGCCGG - Intronic
1083342368 11:61967206-61967228 AGGGAGGCGGGAGAGCCCGCGGG + Intronic
1083366909 11:62146911-62146933 AGGCAGGCAGGCGGGCCAGCAGG - Intronic
1083571066 11:63762700-63762722 TGGGAGGAGAGTGGGGCCGCCGG + Exonic
1084533942 11:69745917-69745939 ATGAAGGAGGGAGGGTCCGCAGG + Intergenic
1084683073 11:70678419-70678441 AGGCAGGAGGCTGGGCGTGGTGG - Intronic
1084793340 11:71488962-71488984 AGGCAGGAGGGTGGCTTTGCTGG + Intronic
1085643111 11:78205798-78205820 AGGCAGGATGGTGGGCACCAGGG - Intronic
1087896207 11:103589671-103589693 AGACAGGAGGGTGGGGTCCCTGG + Intergenic
1088887671 11:114020605-114020627 AGGCAGGAGGATGGCCTCGGAGG - Intergenic
1089244061 11:117105490-117105512 AGCCAGGAGGCTGGGCGCGGTGG + Intergenic
1089254582 11:117187583-117187605 AGGCAGGAAGGAGAGGCCGCAGG - Intronic
1089284029 11:117394326-117394348 TGCAAGGAGGGTGGGCCCACCGG - Intronic
1089341306 11:117759624-117759646 AGACAAGAGAGTGGGCCTGCGGG - Intronic
1089466651 11:118690174-118690196 AGCCAGGACGCTGGGCCCGGCGG + Intergenic
1089517645 11:119043953-119043975 AGGCTGGAGGGTGGGTCCCTTGG - Intergenic
1089519458 11:119054289-119054311 AAGCAGGTGGGTGGGCAGGCAGG - Intronic
1089955700 11:122569138-122569160 AGGCAGGAGGGGAGGCTTGCTGG + Intergenic
1090406357 11:126477837-126477859 GGGCAGGAGGGTGGTGCTGCTGG - Intronic
1202815871 11_KI270721v1_random:46227-46249 AGGCGGGAGGCCGGGTCCGCGGG - Intergenic
1092238001 12:6821798-6821820 AGGGAGGAGGGCGGGCGAGCTGG + Exonic
1093173208 12:15882330-15882352 TGGCGGGAGGGCGGGCTCGCCGG - Intergenic
1096260221 12:50085554-50085576 GGGCAGGAGGAGGGGCGCGCGGG + Intronic
1096504020 12:52081601-52081623 AGGCAGGGGGCTGGGCCCAGGGG + Intergenic
1096663807 12:53148766-53148788 AGAAAGGAGGGTGGGTCGGCTGG + Intergenic
1097184946 12:57191529-57191551 AGGCAGGAGGGTGAGGCAGCTGG - Intronic
1099943412 12:89217407-89217429 AGGCAGGCAGGTGGGCAGGCAGG + Intergenic
1102347702 12:112170108-112170130 ATGCAGCTGGGTGGGCCCCCGGG + Intronic
1102563846 12:113781678-113781700 GGGCAGGACGGTGGGGCAGCAGG + Intergenic
1102925010 12:116819669-116819691 AGGTAGGAGGCGGGGCCAGCGGG - Intronic
1103567225 12:121822895-121822917 GGGCAGGAGCAAGGGCCCGCTGG - Exonic
1103786392 12:123436341-123436363 AGGGACGAGGTTGGGCCCGAGGG - Exonic
1104007304 12:124902664-124902686 AGGCAGGAGGGTTGCCCGGTAGG - Intergenic
1104462913 12:128969882-128969904 TGCCAGGAGTGTGAGCCCGCAGG + Intronic
1104736314 12:131137811-131137833 AGGCAGGCGGGTGGGCGGGCGGG - Intronic
1104895663 12:132162497-132162519 AGGCATGAGGGAGGGCCAGGCGG - Intergenic
1105811710 13:24001520-24001542 AGGCAGGAGGGTGGCCGGGCTGG + Intronic
1106517025 13:30464959-30464981 TGGCGGGCGGGTGGGCCCTCGGG - Intronic
1108672627 13:52707506-52707528 AGGCAGGAGACTGTGCCCTCAGG - Intronic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1112657479 13:101467142-101467164 AAGAAGGTGGGTGGGCCTGCAGG - Intronic
1113649943 13:112027923-112027945 AGGCAGGAGGATGAACCAGCTGG + Intergenic
1113665112 13:112136128-112136150 AGGCAGGAGGCTGTGCCCTGGGG - Intergenic
1113949009 13:114060837-114060859 GAGCAGGAGGCTGGGCCCTCGGG + Intronic
1114499022 14:23154389-23154411 AGGCTGGAGGTTGGAGCCGCTGG + Intronic
1115379828 14:32723068-32723090 TTGCAGGAGGGGGAGCCCGCAGG - Intronic
1117253604 14:53956878-53956900 GGGAAGGAGGGAGGGGCCGCCGG - Intronic
1117440799 14:55757328-55757350 AGGCAGGAGGCCGGGCGCGGTGG + Intergenic
1118892532 14:69921978-69922000 AGGGAGGAGGTTGGGCAGGCAGG - Intronic
1119213346 14:72849476-72849498 AGGCAGGAAGGCGGCCCCGGGGG - Intronic
1119668108 14:76499082-76499104 AGGCAGGGGGGTAGGCCCCGAGG - Intronic
1120039083 14:79731769-79731791 AGGAAGGAGGGTGGGCTCAGTGG - Intronic
1120218430 14:81705309-81705331 AGGCAGGAGGGCGGGGTCTCTGG - Intergenic
1121625774 14:95384567-95384589 AGGAAGGAGGGTGGGGCTGATGG - Intergenic
1122123852 14:99568684-99568706 GGGCAGGAGGGCAGGGCCGCTGG + Intronic
1122346185 14:101061966-101061988 AGTCAGCAGGGAGGTCCCGCAGG + Intergenic
1122422136 14:101584265-101584287 AGGCTGGAGGGCGGGGCCGACGG + Intergenic
1122503270 14:102215904-102215926 AGGCAGGGGGGTAGGCCTGCGGG - Intronic
1122976401 14:105172657-105172679 AGGCCTGGGGGTGGGCCTGCTGG - Intergenic
1124159444 15:27255224-27255246 AGGCAGAAGGGTGGATCCACAGG - Intronic
1124490399 15:30151632-30151654 AGGGAGGTGGGTGGGCTTGCTGG + Intergenic
1124723422 15:32133385-32133407 AGGCAGGAGGGTGGGGCCCGTGG + Intronic
1124753133 15:32386697-32386719 AGGGAGGTGGGTGGGCTTGCTGG - Intergenic
1124974872 15:34522397-34522419 AGGGAGGTGGGTGGGCTTGCTGG - Intergenic
1125575791 15:40754818-40754840 AGGCAGGCGGGCGGGCGGGCGGG + Exonic
1127260912 15:57325549-57325571 TGGCAGAATGGTGGGCCCCCAGG + Intergenic
1127674761 15:61228784-61228806 AGCCAGGGGGGTGAGCCCGCCGG + Intronic
1128305835 15:66598461-66598483 AGGCAGCAGAGTGGGCGTGCTGG - Intronic
1128495582 15:68196648-68196670 AGGCAGGAGGGTCCGCAGGCTGG + Intronic
1128769948 15:70274471-70274493 AGGCCAGAGGCTGGGCCAGCTGG - Intergenic
1129162474 15:73754098-73754120 AGGGAGGAGGGTGGGAGCACAGG + Intergenic
1129333974 15:74841685-74841707 GGGAAGGAGGGTGGGCACTCGGG - Intronic
1129653969 15:77510588-77510610 AGGCAGGAGGCTGGGGCCTTGGG - Intergenic
1131916602 15:97272326-97272348 AGGCTGGAGAGTGGGCACCCAGG - Intergenic
1132110783 15:99100494-99100516 AAGCAGGAGGCTGCGCGCGCCGG - Intronic
1132185485 15:99798954-99798976 AGGGAGGTGGGTGGGCTTGCTGG + Intergenic
1132431510 15:101765587-101765609 AGGGAGGTGGGTGGGCTTGCTGG - Intergenic
1132577040 16:668914-668936 AGGAGGGAGGGAGAGCCCGCGGG - Intronic
1132621139 16:868801-868823 AGGCAGGAGGTGGGGCCTGCTGG - Intronic
1132666482 16:1083396-1083418 TGGGATGAGGGTCGGCCCGCTGG - Intergenic
1132749087 16:1449115-1449137 AGCCAGGAGGGTGGACGTGCTGG - Intronic
1132796317 16:1725039-1725061 AGGCAGGAGGGTGGGCCCGCTGG + Intronic
1133422017 16:5653983-5654005 ACGCAGCAGGGTGGGCAGGCGGG + Intergenic
1134081333 16:11327090-11327112 AGGGAGGAGGAAGGGCCCTCAGG + Intronic
1134116020 16:11549511-11549533 AGACATGAAGGTGGGCCCCCTGG + Exonic
1135174609 16:20216846-20216868 GGGCAGGAGGGAGGGGCTGCAGG - Intergenic
1135521453 16:23181789-23181811 AGGAAGGAAGGTGGGCGGGCGGG + Intergenic
1136168469 16:28472551-28472573 ATGTAGGAGGCTGGGCGCGCTGG + Intergenic
1136406908 16:30053393-30053415 GGGAAGGAGGGTGGGCACCCCGG + Intronic
1138174273 16:54882516-54882538 TGGCAAGAGGGTGAGCCCGTAGG - Intergenic
1138550340 16:57744269-57744291 AGGCAGGAGGGGGAGCCCCATGG - Intronic
1138686387 16:58729796-58729818 AGGGAGGGTGGTGGGCCTGCGGG - Intronic
1139482141 16:67236635-67236657 AGACCGGAGGGAGGGCCCACAGG + Exonic
1139549034 16:67663379-67663401 AGGCTGGAGGGGGGCCCCACTGG - Intronic
1140328212 16:74026677-74026699 AGGAAGGAGGCTGAGCCAGCAGG + Intergenic
1140477087 16:75244430-75244452 GGGGAGGAGGGTGGGCCCTAGGG - Intronic
1140851528 16:78939089-78939111 AGACAGGACAGTGGCCCCGCTGG + Intronic
1141125481 16:81397902-81397924 AGGCAGGAGGGTGCGTCTGTCGG - Intergenic
1141137019 16:81473102-81473124 GGGCAGGAGGCAGGGGCCGCAGG - Intronic
1141194898 16:81853041-81853063 AGGCCCCAGGCTGGGCCCGCTGG + Intronic
1141575129 16:84958793-84958815 AGGCCTGAGGTTGTGCCCGCAGG + Intergenic
1141605900 16:85153001-85153023 AGGCTGGTGGGTGGGCACGGGGG + Intergenic
1141963458 16:87425043-87425065 AGGCAGGAGGGTGGACACCTCGG - Intronic
1142614711 17:1127575-1127597 AGGGAGGAGGGAGGGGCCGGCGG - Intronic
1142756724 17:2020914-2020936 AGGAAGGAAGGGCGGCCCGCTGG - Intronic
1142941056 17:3380062-3380084 AGGCAGGAGGAGTGGCCTGCAGG - Intergenic
1143473968 17:7192580-7192602 AGGCAGGGGAGAGGGCCAGCGGG + Intronic
1143503144 17:7350429-7350451 AGGCAGGCGGGAGGGCGGGCAGG + Intronic
1144587028 17:16493026-16493048 GGGGAGGAAGGTGGGCCAGCAGG - Intergenic
1144836810 17:18160851-18160873 AGACAGGAGGGTGGACCTGATGG - Intronic
1145321355 17:21769250-21769272 ATTCAGGAGGGCGGGCCCCCAGG + Intergenic
1146062011 17:29612639-29612661 CGGCAGGAGGCTGGGGGCGCGGG - Exonic
1146156724 17:30530508-30530530 AGGCAGGAGGCTGGGTCCCTGGG - Intergenic
1146662574 17:34674468-34674490 AGGGAGGATGGTGGGGCAGCTGG - Intergenic
1147141621 17:38463611-38463633 TGGAAGGAGGGTGGCCCAGCAGG + Intronic
1147559376 17:41499623-41499645 AGGCAGGTGGCTGGGCACCCTGG - Intergenic
1147971887 17:44222522-44222544 TGGCTGGAGGCTGGGCCCGTTGG - Intergenic
1148106483 17:45121445-45121467 AGGCTGGAGGATGGGGCAGCAGG - Intronic
1148135713 17:45290439-45290461 GGGCAGGTGGGTGGGCCTGCAGG - Intronic
1148339184 17:46863243-46863265 AGCCAGCAGGGTGGGACTGCAGG + Intronic
1148439597 17:47704877-47704899 TGGCAGGAAGGAGGGCCCCCTGG - Intronic
1148758553 17:49987387-49987409 AGGGAGGAGGGCTGGCCAGCTGG + Intergenic
1149531031 17:57395476-57395498 TGGCAGGAGGGTGGCTCCGAGGG + Intronic
1149865217 17:60147844-60147866 AGGAAGGAGGCTGGGGCTGCTGG + Intergenic
1150361523 17:64539025-64539047 TGGCAGAAGGGTGGGCCACCAGG + Intronic
1150656824 17:67044863-67044885 GGGCAGGGTGATGGGCCCGCAGG - Exonic
1151732419 17:75919443-75919465 AGGCAGGAGGGGGTACCCACAGG - Intronic
1152396408 17:80036013-80036035 AGGCCTGAGGGAGGGCCAGCAGG - Intergenic
1152611761 17:81318319-81318341 AGGCAGGTGGGTGGGGCCTCTGG - Intronic
1152639155 17:81442515-81442537 AGGCACGAAGGTGGGCCCGCTGG - Exonic
1152742166 17:82023132-82023154 GGGCATGAGGGTGGGGCCCCGGG - Intronic
1152917719 17:83050787-83050809 AGGCAGGTGTGTGGGCACGGAGG + Intronic
1153273399 18:3345183-3345205 AGGCAGGAGGGAGGCCCCACTGG + Intergenic
1153749244 18:8211867-8211889 AGGCAGCATGGAGGGCTCGCTGG + Intronic
1153756766 18:8291868-8291890 AGGAAGGAGGGTGGACTCACAGG + Intronic
1156509320 18:37622631-37622653 AGGCAGGAGGTTGGGGCCCAAGG - Intergenic
1157253918 18:46120871-46120893 AGGCAGGAGGCTGGGTGCGGTGG - Intronic
1157620499 18:49014513-49014535 TGGCAGGAGGTTGGGCCACCGGG + Intergenic
1159336531 18:67075257-67075279 AGGCAGGAAGGCGGGCGGGCAGG - Intergenic
1160248414 18:77179780-77179802 AGGCAGAAGGGGAGGCCTGCTGG + Intergenic
1160369876 18:78363201-78363223 GGGCAGAAGGCCGGGCCCGCAGG + Intergenic
1160426778 18:78783282-78783304 AGACCGGAGGGTGGGCTGGCTGG + Intergenic
1160568143 18:79799216-79799238 AGGCAGCTGGGTGACCCCGCGGG + Intergenic
1160682433 19:417965-417987 GGGGAGGAGGGAGGGCCGGCAGG - Intronic
1160751375 19:736073-736095 AGGCAGGTGGGTTGGCCCCCAGG + Exonic
1160796459 19:947944-947966 AGGCAGGCGGGGGAGCCCCCCGG + Intronic
1160863956 19:1249193-1249215 CGGCCGGCGGGTGGGCGCGCGGG + Intronic
1161610087 19:5237628-5237650 GGGCAGGCGGGGGGGCACGCGGG + Intronic
1161750435 19:6092366-6092388 GGGACGGAGGGTGGCCCCGCAGG + Intronic
1162199496 19:9010344-9010366 AGGCAGTAGGATGGGCCGGGAGG - Intergenic
1162301510 19:9847598-9847620 AGGCAGGGGGCTGGCCCCCCGGG - Intronic
1162361924 19:10225683-10225705 AGCCAGGCGGCTGGGCCCGGTGG - Intronic
1162778844 19:12996281-12996303 TGGCAAGAGGGTGGTCCCGAGGG + Intronic
1163062649 19:14771558-14771580 AGCCAGGAGTGTGGCCCCACAGG + Intronic
1163323950 19:16591231-16591253 GGGAAGGAGGGTGGGCCCTTTGG + Intronic
1163688626 19:18726234-18726256 AGGCAGGTGGCTGGGAGCGCCGG - Intronic
1164605342 19:29593922-29593944 CGGCAGGAGGCTGAGCCTGCCGG - Intergenic
1164833880 19:31344585-31344607 AGGCAGGCAGGCAGGCCCGCGGG - Intronic
1165058731 19:33194749-33194771 GGGCAGGAGGCGGCGCCCGCGGG + Exonic
1165162527 19:33826093-33826115 AGGCAGGAGGCTGGGCGGGATGG + Intergenic
1166231039 19:41425980-41426002 AGGCAGGTGGCAGGGCCCGCAGG + Exonic
1166347784 19:42177062-42177084 GGGCAGGCGGGCGGGCGCGCAGG + Intronic
1166934090 19:46320648-46320670 AGGCAGGAGGCAGGTCCCACAGG - Intronic
1167095016 19:47370606-47370628 GGGCAGGAGGCTGGATCCGCTGG + Intronic
1167471456 19:49678173-49678195 AGGGAGGAGGGTATGTCCGCTGG + Intronic
1167499723 19:49838362-49838384 AGGCAGAAGGGCGGGCCCAGGGG - Intronic
1167739083 19:51312919-51312941 AGGCTGGAGGGTGGGCGCTCAGG + Intronic
1167859516 19:52271436-52271458 AGACAGGTGGGTGGGCCGGTTGG - Intronic
1167971493 19:53190282-53190304 AGACAGGTGGGTGGGCCCGTTGG + Intronic
1168361087 19:55741305-55741327 AGGAAGGATGCTGGGCCCGGTGG + Intergenic
925187658 2:1860254-1860276 AAGCAAGAGGCTGGGGCCGCCGG + Intronic
925348773 2:3187603-3187625 ATGCAGGTGGGTGGGGCCGTGGG - Intergenic
926077419 2:9952086-9952108 GGGGAGGAGGGTGGCCCCTCCGG - Intronic
926199958 2:10787775-10787797 AGGAAGGAGGCTGGGCACGGTGG + Intronic
926533435 2:14081809-14081831 AGGCAGCAGGGTGGGCAAGATGG + Intergenic
927198511 2:20564346-20564368 GAGCTGGAGGGTGGGCCAGCTGG - Intronic
927338251 2:21950347-21950369 AGGGAGGAGGCTGGGCACGGTGG - Intergenic
927458558 2:23278031-23278053 AGGCAGGAGGGAGGGCAGGCAGG - Intergenic
927720555 2:25379242-25379264 AGGAAGGAGGGAGGGGCCGTGGG + Intronic
927872716 2:26633786-26633808 AGGCAGGAGGGGCTGCCTGCGGG + Intronic
928178780 2:29053147-29053169 TGGCATGAGGCTGGGCCCTCAGG - Exonic
929265951 2:39919852-39919874 AGGCAGGCTGGTGGGCCCTTGGG + Intergenic
929453037 2:42048837-42048859 AGGTACGAGGGTGGGGACGCGGG + Exonic
932106129 2:68944277-68944299 TGGCAGGCAGGTGGGCCTGCGGG + Intergenic
932306181 2:70705573-70705595 AGGCCGAAGGGTGGGCCCTGTGG - Intronic
932337080 2:70937644-70937666 AGGGAGGAGGGACGGCCTGCAGG - Intronic
932752480 2:74380103-74380125 AGGCAGGAGGGTCAGGGCGCTGG + Exonic
933533546 2:83541506-83541528 AGGCAGGAGGCAGGGACCTCAGG - Intergenic
934164747 2:89283753-89283775 AGGCAGGATGCTGTGCCCACAGG - Intergenic
934168108 2:89315099-89315121 AGGCAGGAGGCTGTGCCCACAGG - Intergenic
934199177 2:89867482-89867504 AGGCAGGAGGCTGTGCCCACAGG + Intergenic
934202527 2:89898771-89898793 AGGCAGGATGCTGTGCCCACAGG + Intergenic
935261076 2:101356364-101356386 AGGCAGGAGGGCAGGGCCCCTGG - Intronic
935645375 2:105329799-105329821 AGCCAGGCGGCAGGGCCCGCGGG - Exonic
936519503 2:113202619-113202641 AGGAAGGAGGCTGGGCCGGAGGG + Exonic
936519529 2:113202753-113202775 AGGGAGGAGGGTGGCCTAGCAGG - Exonic
937085733 2:119170524-119170546 ATGCAGGAGGGTGAGCCAGCTGG + Intergenic
938978481 2:136502894-136502916 AGGCAGAAGGTTGGGCCCTGAGG - Intergenic
940505228 2:154545758-154545780 AGGCAAGAGGGTGTGCACACTGG - Intergenic
941725665 2:168857477-168857499 AGGCAGGGAGGTGGGCCTCCTGG + Intronic
946020538 2:216636921-216636943 AGGCAGGCGGGCGGGCGGGCGGG + Intronic
946249272 2:218402916-218402938 AGGAAGGAGACTGGGCCCGCAGG - Intronic
946428843 2:219613949-219613971 AGGCAGGAGGGTGGGCAGGAGGG + Intronic
946429086 2:219615087-219615109 AGGCAGGTGGAAGGGCCTGCAGG - Exonic
946572901 2:221043710-221043732 AGGGAGGAGGCTGGGCGCGGTGG - Intergenic
946853397 2:223929473-223929495 AAGCAGGAGGCTGGGCACGGTGG - Intronic
948231540 2:236352408-236352430 AGGCAGGAGGATGGGCTGGGAGG + Intronic
948720712 2:239898389-239898411 AGTCAGGAAGGTGGCCCCGAGGG + Intronic
948799292 2:240424129-240424151 GGGCAGGAGGGCTGGCCAGCAGG + Intergenic
948900788 2:240956026-240956048 AGGCAGGAGGGGTGGCCCCCTGG - Intronic
948903363 2:240966936-240966958 CGGTGGGAGGGTGGGCCCGAAGG - Intronic
949035611 2:241814576-241814598 GGCCAGCAGGGTGGGCCCGGGGG - Exonic
1170629202 20:18053951-18053973 AGGGAGGCGGGTGGGCCTGAGGG - Intronic
1170998691 20:21391789-21391811 AGGAAGGAGGGTGCGCCCGAGGG - Intergenic
1171013838 20:21522737-21522759 AGCTAGGAGGGTGGGGCCGCTGG - Intergenic
1171908765 20:30921999-30922021 AGGCACGAGGGAGGCCCCGAGGG - Intergenic
1172442778 20:34977716-34977738 GGGCAGGAGGGTGGGCGGGTGGG + Intronic
1172767675 20:37359427-37359449 AGGGAAGCGGGTGGGCCTGCTGG + Intronic
1173250407 20:41361450-41361472 GTGCAGGAGGCTGGGCCTGCTGG - Exonic
1174168907 20:48604271-48604293 AGGCAGGAGGGTGGGCTTCAGGG + Intergenic
1174174517 20:48636429-48636451 GGGCGGGAGGGCGGCCCCGCTGG - Intronic
1174522318 20:51141285-51141307 ATTCAGCAGGGTGGGCCCGAGGG - Intergenic
1174558354 20:51412570-51412592 CAGCAGGAGGGAGGCCCCGCTGG + Intronic
1174574052 20:51524482-51524504 AGGCAGGAGGGAGGGTCTGAGGG - Intronic
1174921156 20:54703961-54703983 AGGAAGGAGGAGGGGCCCTCAGG - Intergenic
1175371485 20:58495882-58495904 AGGCTGGAGGGTGGGGAGGCTGG - Intronic
1175771862 20:61629070-61629092 AGGCAGGAGCTTGGCCACGCAGG + Intronic
1175891864 20:62319275-62319297 AGGGAGCAGGGTGGGCCAGGCGG - Intronic
1175979391 20:62729439-62729461 TGGATGGAGGGTGGGCCCTCAGG + Intronic
1176032413 20:63019228-63019250 AAGCAGGCGGGTGGGCGGGCGGG - Intergenic
1176228668 20:64018994-64019016 GGGCAGGAGGATGGCCCAGCCGG - Intronic
1176424240 21:6538182-6538204 AGGCAGGAGTGTGGCCGTGCAGG + Intergenic
1178860580 21:36285723-36285745 AGGCAGGAGGCTGGGCACAGTGG + Intronic
1178883186 21:36464653-36464675 AGGGTGCAGGGTGGGTCCGCTGG - Intronic
1179699733 21:43146497-43146519 AGGCAGGAGTGTGGCCGTGCAGG + Intergenic
1179819719 21:43929739-43929761 AGGCTGGAGGGTGGGCAGGATGG + Intronic
1179913667 21:44462954-44462976 TGGAAAGAGGGTGGGCCGGCAGG - Intergenic
1179982612 21:44904178-44904200 AGGCTGGAGGGTGGGGCAGAGGG - Intronic
1180109895 21:45642956-45642978 GGGCGGGCGGGTGGGCCCGACGG - Intergenic
1180162477 21:46004376-46004398 AGGCAGGAGGGAGGGCGGGCAGG - Exonic
1180766969 22:18351083-18351105 AGGCGGCAGGGTGTGCCCGTGGG + Intergenic
1180779344 22:18511296-18511318 AGGCGGCAGGGTGTGCCCGTGGG - Intergenic
1180812061 22:18768616-18768638 AGGCGGCAGGGTGTGCCCGTGGG - Intergenic
1180938375 22:19640963-19640985 AGGCAGGTCGGTGGGCAAGCAGG + Intergenic
1181055529 22:20258946-20258968 AGCCAGGAGGGTGGAGGCGCTGG + Intronic
1181198216 22:21202860-21202882 AGGCGGCAGGGTGTGCCCGTGGG - Intergenic
1181703489 22:24634041-24634063 AGGCGGCAGGGTGTGCCCGTGGG + Intergenic
1182418660 22:30237908-30237930 GGGCAGGAGGGCTGCCCCGCTGG + Intergenic
1182549627 22:31093804-31093826 AGGCAGGTGGGTGGGCCACGGGG - Intronic
1183355253 22:37355362-37355384 AGACATCAGGGAGGGCCCGCAGG - Intergenic
1183663563 22:39234980-39235002 AGGCAGGAGGGGGCCCCAGCTGG - Intronic
1184040387 22:41939602-41939624 AGGAAGGAGGGAGGGGCAGCGGG + Intronic
1184900800 22:47445333-47445355 AGGCAGGAGGATGGGCGGTCAGG - Intergenic
1185184187 22:49382647-49382669 AGGCATGAGGCTGGACCCACAGG - Intergenic
1185272915 22:49936864-49936886 AGGCAGGTTGGGGGGCCTGCAGG + Intergenic
1203228591 22_KI270731v1_random:91977-91999 AGGCGGCAGGGTGTGCCCGTGGG + Intergenic
950261367 3:11545104-11545126 AGCCAGGAGGCTGCGGCCGCTGG + Intronic
950418743 3:12884250-12884272 AGGGAGGAGGGCCAGCCCGCTGG - Intergenic
950493646 3:13320977-13320999 AGGGAGGAGGGCCAGCCCGCTGG - Intronic
950666999 3:14503704-14503726 TGGCAGGCGGGTGGGCGGGCTGG + Intronic
951982025 3:28576151-28576173 TGGCAGAAGGGAGGGCGCGCGGG + Intergenic
952966689 3:38625460-38625482 AGGCAGGAGAGTGGACCGGGTGG - Intronic
953697816 3:45173395-45173417 AGACAAGAGGATGGGCCCACAGG - Intergenic
954367510 3:50154522-50154544 AGGCTGGAGGCTGAGCCCGCGGG + Intergenic
954498432 3:50987704-50987726 AGGCAGGATGGTGGCCCGCCAGG + Intronic
954699350 3:52443302-52443324 CAGCTGGAGGGTGGGCCAGCAGG + Intronic
960630437 3:119725302-119725324 AGGCAGGAGGATGTGGCCACTGG - Intronic
961116447 3:124334094-124334116 AGGCCGGAGGATGGGCCCCATGG + Intronic
961456918 3:127028957-127028979 GAGCTGGAGGGTGGGGCCGCTGG - Intronic
961528190 3:127521622-127521644 AGACAGTAGGCTGGGCCCGGTGG - Intergenic
962353455 3:134673363-134673385 AGGGAGGAGGGTGGGACTTCAGG - Intronic
963706715 3:148697768-148697790 AGGGAGGAGGTTGGGCCGGGAGG + Exonic
963829734 3:149993519-149993541 AGGCAGGTGGGTGGGTCCTTGGG - Intronic
966918571 3:184598010-184598032 TGGCAGGAGGGAGAGCCTGCGGG - Intronic
966924740 3:184636914-184636936 AGGCAGGAGGCAGGGGCTGCTGG - Intronic
967332132 3:188301083-188301105 AGGCAGGAGGGTGGATGGGCAGG - Intronic
968173785 3:196531304-196531326 AGGCGGGCGGGTGGGCGGGCAGG - Intergenic
968433269 4:571987-572009 GGACAGGAGGGTGTGCACGCAGG + Intergenic
968433355 4:572396-572418 GGACAGGACGGTGTGCCCGCGGG + Intergenic
968470880 4:781778-781800 AGGCGGGAAGGTGCGGCCGCGGG + Intergenic
968673090 4:1862760-1862782 AGGCAGGAGAAGAGGCCCGCGGG - Intergenic
968907954 4:3463267-3463289 GGCCAGGAGGGCGGGCCCGCGGG - Intergenic
968935322 4:3607299-3607321 AGGCTGCAGGGTGGGCATGCCGG - Intergenic
968959002 4:3733395-3733417 AGGCAGGCGGGTAGGGCCTCAGG - Intergenic
969447213 4:7252214-7252236 AGGCAGGAGAGTGGGAGGGCAGG + Intronic
969536507 4:7759718-7759740 AGGCATCAGGGTTGGCCGGCAGG - Exonic
970617469 4:17781477-17781499 AGGAAAAAGGGTGGGCGCGCGGG - Exonic
971737072 4:30467232-30467254 AGGCAGGAGGCCGGGCGCGGTGG - Intergenic
972532992 4:39977374-39977396 AGACTGGAGGGGGGGGCCGCGGG - Intronic
972568576 4:40290449-40290471 AGGAAGGAGGGTGGGCAGGAGGG - Intergenic
975708322 4:77133703-77133725 GGGCAGGCGGGTGGGCAGGCAGG - Intergenic
975708326 4:77133715-77133737 AGGCAGGCAGGTGGGCAGGCGGG - Intergenic
976272686 4:83247220-83247242 AGGCAGGAGGGAATGCCTGCAGG - Intergenic
976765145 4:88591845-88591867 AGGCTGGAGGGTGGACCCGGGGG - Intronic
980132181 4:128827086-128827108 AAGGAGGAGGGTGGGGCCGGTGG - Intronic
980826723 4:138082138-138082160 GGGGAGGAGGGTGGGGCCTCGGG - Intergenic
981821188 4:148889346-148889368 AGGCAGCAGGCTGGGCTCTCAGG + Intergenic
981848823 4:149203317-149203339 AGCCAGGATGGTGGGCAGGCTGG + Intergenic
982217659 4:153096000-153096022 AGGCTGGAGGCTGGGCCTGGTGG + Intergenic
984602389 4:181743629-181743651 AGGCAGGAGTGTGGGCACCAGGG + Intergenic
984805297 4:183746481-183746503 AGGCAGGGGGCCGTGCCCGCTGG + Intergenic
985110288 4:186541050-186541072 AGGCAGGGTGGTGGGAACGCAGG - Intronic
985534892 5:458787-458809 AGGCAGGAGTGAGGGCTGGCGGG + Intronic
985780112 5:1866063-1866085 AGGAAGGTGGCGGGGCCCGCAGG - Intergenic
985840383 5:2301144-2301166 AGCCAGGAGGTGGGGCCCACAGG - Intergenic
986330321 5:6712910-6712932 CGTCAGGAGGGAGGGCCGGCCGG + Intergenic
988697259 5:33634968-33634990 AGTCAGGAGGGTGGGGCGGGAGG - Intronic
990978526 5:61580257-61580279 AGGCAGGAGGGTGGAACAGGTGG + Intergenic
992487447 5:77210434-77210456 AGGAAGGAGGGTGGGAGCGAGGG + Intronic
996962426 5:129267521-129267543 AGGCAGGAAGGTCGGCAGGCAGG - Intergenic
997337574 5:133118938-133118960 AGGCAGAGTGGTGGGCCGGCAGG - Intergenic
997355903 5:133262883-133262905 AGGAAGGAGGGTGGGGCTGAGGG + Intronic
997530483 5:134578725-134578747 AGGCAGGCGGGTGCGGCCTCGGG - Exonic
997975682 5:138440190-138440212 AGGGAGCAGGGTGGGGCTGCCGG - Intronic
998130645 5:139649625-139649647 AGGAGGGAGGGAGGGGCCGCGGG - Intronic
998199465 5:140108020-140108042 AGGAAGGAGGGCGGGCTGGCGGG - Intronic
999143919 5:149380454-149380476 AGCCAGGAGGGTGGGCCTGAGGG - Intronic
999144479 5:149383369-149383391 ACGCTCTAGGGTGGGCCCGCTGG - Intronic
1000345696 5:160312064-160312086 GCGCAGGAGGGGGCGCCCGCCGG - Intronic
1001456615 5:171866482-171866504 AGGTAGGAGGGAGGGCCTGGAGG + Intronic
1002140378 5:177134000-177134022 AGGGAGGAGGGTGGCCGGGCGGG + Intronic
1003870401 6:10398353-10398375 CCGCCGGAGGGTGGGCGCGCGGG + Exonic
1005990122 6:30897301-30897323 GGGCAGGGGGGTGGGGGCGCGGG + Intronic
1006678827 6:35782571-35782593 AGGCAGGAGGGGGAGGCAGCCGG + Intronic
1007406832 6:41640195-41640217 AGGCAGGAAGGAGGCCCAGCGGG - Intronic
1007433721 6:41792932-41792954 TGGGAGGAGGGTGGGCTGGCCGG - Exonic
1007705820 6:43790555-43790577 AGGGAGGAGAGTGGGCCAGCAGG - Intergenic
1007926648 6:45654996-45655018 AGTCAGGAGGGTTGGCCCAGGGG - Intronic
1008921110 6:56844305-56844327 GGGCAGAAGGGAGGGACCGCAGG - Intronic
1011175608 6:84556714-84556736 AGTGAGGAGGGCGGGCCCTCAGG - Intergenic
1011986210 6:93450048-93450070 AGGCAGGATGGTGGTATCGCAGG + Intergenic
1013317471 6:108956407-108956429 AGGCAAGAGGCTGGGCACGGTGG + Intronic
1013455637 6:110326895-110326917 AGGGTGGAGGTTGGGCCAGCAGG + Intronic
1013587612 6:111593648-111593670 AGGGAGGAGGGAAGGCCAGCCGG - Intronic
1015414267 6:132930894-132930916 AGGAGGGAGGGTGGGGCTGCTGG + Intergenic
1015554960 6:134451734-134451756 AGGCAGGGGCCTGGGCCTGCAGG - Intergenic
1016010881 6:139135928-139135950 GGGCAGCAGGCTGGGCCCGAGGG - Intronic
1017817555 6:158026757-158026779 AGGCAGGAGGATGGCCCCTGTGG - Intronic
1018349760 6:162943949-162943971 GGGCAGGTGGGTGGGTCCTCAGG - Intronic
1018847462 6:167565567-167565589 GGGCAGGCGGGTGGTCCTGCTGG - Intergenic
1018916355 6:168134873-168134895 AGGCAGGAGGGTGTGCAGGAGGG + Intergenic
1019190934 6:170250249-170250271 AGGCAGGAGGGTGGACATGCGGG - Intergenic
1019321385 7:416993-417015 AGGCAGGAGTGGGGTCCCGTGGG + Intergenic
1019410357 7:904072-904094 GCACAGGAGGGTGGGCCCTCAGG - Intronic
1019497277 7:1346461-1346483 AGGCAGCAGGGTGGGGAAGCTGG - Intergenic
1019740353 7:2670005-2670027 AGACAGGAGTGTGGCCCCGTGGG + Intergenic
1020007922 7:4792173-4792195 AGTCCGGAGGGTGGGACCACAGG - Intronic
1020077293 7:5266788-5266810 GGCCAGGAGGGTGGGGCAGCGGG - Intergenic
1020471961 7:8547642-8547664 AGGCAGGAGAGTGGGGCAGGGGG - Intronic
1021095132 7:16527090-16527112 AGGCAGGAGGTGGGGCCCTGGGG - Intronic
1021554992 7:21909966-21909988 GGGCAGGAGGGTGGGCTGGGAGG + Intronic
1022306981 7:29155744-29155766 AGCCAGGAGGGTAGGCTGGCTGG + Intronic
1022417560 7:30191044-30191066 AGGGAGGAGCGTGGGCCTGTGGG + Intergenic
1023617266 7:42032618-42032640 AGGCAGGAGGGTCAGAGCGCTGG + Intronic
1023907583 7:44533417-44533439 AGGCAGGAGGTAGGGGCAGCTGG - Exonic
1024046828 7:45590842-45590864 AGGCAGGAGGTTGCCCCTGCTGG - Intronic
1024261418 7:47576687-47576709 GGGCAGGAGAGTGGGCCCTGGGG - Intronic
1025201825 7:56966885-56966907 GGCCAGGAGGGTGGGGCAGCAGG + Intergenic
1025670121 7:63610043-63610065 GGCCAGGAGGGTGGGGCAGCAGG - Intergenic
1026118676 7:67517941-67517963 AGGCAGGAAAGTGGGCATGCTGG - Intergenic
1026819618 7:73538020-73538042 AGGCAGTAGGGTCGGCCTGAGGG + Intronic
1027171762 7:75877943-75877965 GGGCAGGAGGCTGGGCACGGTGG - Intronic
1027355096 7:77346941-77346963 AGGCAGGGGGGTGGGGCGGGGGG - Intronic
1028121411 7:87059697-87059719 ACGCCGGAGGGAGGGACCGCGGG + Exonic
1028520180 7:91721238-91721260 AGGCAGGTGGGTGGGTCCTCAGG - Intronic
1029570188 7:101363590-101363612 AGGCTGGGGGTTGGGGCCGCGGG + Intronic
1029616819 7:101664516-101664538 AGGGAGGAGGGTGGCCCCCAGGG + Intergenic
1032901944 7:136320438-136320460 AGGCTGGTGGGTGGGTCCACAGG + Intergenic
1033299792 7:140176282-140176304 AGGCAGGCGCGTCGGCCGGCCGG + Intronic
1033338560 7:140474072-140474094 AGACTGTAGGGTGGGCCCGGTGG + Intronic
1034270962 7:149803283-149803305 AGGCAGGAGGGTGGGCATGGGGG - Intergenic
1034564361 7:151901432-151901454 AGACAGGAGGGTGGGAGCCCTGG - Intergenic
1035020888 7:155799649-155799671 AGGGAGGCGGGCGGGCCTGCAGG - Intergenic
1035162471 7:156961184-156961206 AGGCAGGAGGGAGAGCTGGCAGG + Intronic
1035305530 7:157929043-157929065 AGGCAGGAGAGTGGGGTCCCGGG + Intronic
1035317521 7:158006105-158006127 AGGCAGGAGGAAGGGGCAGCAGG - Intronic
1035466733 7:159084345-159084367 GGGCAGGCGGCTGGGCACGCTGG + Intronic
1036421932 8:8604860-8604882 AGGAAGGAGGCTGGGCCCAATGG + Intergenic
1036635487 8:10547499-10547521 AGGCAGGAGGCTGAGGCCGAGGG - Intronic
1036645755 8:10610878-10610900 AGGCTGCAGGGTGAGCCTGCGGG - Exonic
1037645565 8:20789781-20789803 AGGAAGGAGGGAGGACCTGCAGG - Intergenic
1037662475 8:20939619-20939641 AGGGAGGAGGATGGGACAGCTGG + Intergenic
1038018918 8:23536688-23536710 AGGCAGAAGGGCAGGCCCGAGGG - Intronic
1038182348 8:25241187-25241209 AGTCAGGAGGCTGGGCACGGTGG + Intronic
1038261890 8:26002936-26002958 AGGCAGGCGGGCGGGCAGGCAGG + Intronic
1039104025 8:33970906-33970928 AGGCATGAGGGTGGGGTCCCTGG - Intergenic
1039456467 8:37710744-37710766 AGCCAGGAGGGTGGGCCCTGGGG - Intergenic
1040898304 8:52391111-52391133 AGGAAGCAGCGTGGGCCAGCTGG - Intronic
1041085297 8:54251206-54251228 AAGCAGAAGGGTGGGGCCGGCGG - Intergenic
1041753626 8:61288573-61288595 AGGCAGGAGGGAGAGACCCCAGG + Intronic
1044918044 8:97137026-97137048 AGATACCAGGGTGGGCCCGCTGG - Intronic
1045137055 8:99232817-99232839 AGGTAGGAGGCAGGGCCCGGAGG + Intronic
1045489518 8:102657572-102657594 AGGAAGGAAGGTAGGCCTGCCGG - Intergenic
1045674092 8:104589063-104589085 AGGGAGGAGGGAGCGCGCGCGGG - Intergenic
1049528948 8:143143742-143143764 AGGCAGGTGGGTGGGCGGGCAGG + Intergenic
1049588096 8:143441136-143441158 GTGCAGGTGGGTGGGCCGGCTGG + Intronic
1049658546 8:143809509-143809531 AGGCAGGAGGCTGGGCCTGCTGG - Intronic
1049662141 8:143824248-143824270 AGGCAGGCGGGCGGGCGGGCGGG + Intronic
1049673781 8:143880803-143880825 AGGCAGGATGGAGGGCCCGGCGG + Intergenic
1049678819 8:143906211-143906233 GGGAAGGAGGGTGGCCCTGCAGG - Intergenic
1051250121 9:15150999-15151021 AGGGAGAAGGGTGGGCAGGCTGG - Intergenic
1053010260 9:34628900-34628922 AGGCAGGTGAGTGCGGCCGCGGG - Intergenic
1053353406 9:37428072-37428094 GGGCAGCAGGGTGGGCCCTGTGG + Intronic
1054454863 9:65424603-65424625 AGGCTGCAGGGTGGGCATGCTGG + Intergenic
1057211988 9:93205454-93205476 GGCCAGCAGGGTGGGCCCCCAGG - Intronic
1057259921 9:93577427-93577449 ACGGCGGAGGGTGGGCGCGCCGG - Intronic
1057524044 9:95783982-95784004 AGGCAGGACAGTGGGCTCCCAGG + Intergenic
1057723773 9:97554176-97554198 TGGCAGGAGGGTGGGCGGGGTGG + Intronic
1058149524 9:101449113-101449135 AGGCAGGTGGGCGGGCGGGCAGG + Intergenic
1059337984 9:113581004-113581026 AGGCAGGTGGCTGGGCCAGGGGG + Intronic
1060202044 9:121657030-121657052 AGGCAGGGGAGTGGCCCCGTTGG + Intronic
1060264523 9:122102823-122102845 AAGCAGGAGGCTGGGCACGGTGG + Intergenic
1060510571 9:124229115-124229137 AGGCTGAAGGGTGGCCCCGATGG + Intergenic
1060965049 9:127707527-127707549 TGGCAGGCGGGTGGACCCCCAGG + Intronic
1061232746 9:129324349-129324371 AGGCAGGAGGGCGGGGTCCCAGG + Intergenic
1061297255 9:129683446-129683468 AGGCAGGAGGCCGGGCGCGGTGG + Intronic
1061884320 9:133583985-133584007 AGGCAGGAGGGTGGAGGCCCAGG - Intronic
1061917334 9:133762131-133762153 AGGCAGGAGGGTTGGAGGGCTGG - Exonic
1061933479 9:133845210-133845232 AGGCAGAAGCGTGGACGCGCTGG + Intronic
1062082897 9:134633874-134633896 AGACAGGAGGGTGGAGCGGCTGG - Intergenic
1062103756 9:134741603-134741625 AGGCAGGAGGGTGGGGTGGGAGG + Intronic
1062146457 9:134992300-134992322 AGGAAGGAGGGAGCGCCCCCCGG + Intergenic
1062349394 9:136131688-136131710 AGGTGGCAGGGTGGGCCTGCTGG - Intergenic
1062502878 9:136858793-136858815 AGGCAGGAGGCTGGGGTGGCCGG - Exonic
1062523884 9:136970552-136970574 AGGCAGGTGGGTGGACCCCGTGG + Intronic
1190246899 X:48696816-48696838 AGGCAGAGGCGCGGGCCCGCTGG + Intronic
1193413667 X:81196250-81196272 AGGCAGGAAGGTGGGCACTAGGG + Intronic
1195923262 X:110002899-110002921 AGGCGGGAGGCCGGGCCAGCCGG - Intronic
1198302259 X:135344184-135344206 AGACAAGAGGCGGGGCCCGCAGG + Intergenic
1199987423 X:152962694-152962716 AGGTAGGAGGGCAGGCCCTCAGG + Intronic
1200444564 Y:3243855-3243877 AGGGTGGAGGGTGGGCTGGCGGG + Intergenic
1201000387 Y:9466832-9466854 AGGCAGGGGGGTGGGGGGGCTGG + Intergenic
1201077937 Y:10200627-10200649 AGGCAGGAGGGAGCCCCCGAGGG - Intergenic