ID: 1132797521

View in Genome Browser
Species Human (GRCh38)
Location 16:1732595-1732617
Sequence GGACTTGCCCTGAGAACGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132797518_1132797521 -9 Left 1132797518 16:1732581-1732603 CCTGCAGTTCTCAGGGACTTGCC 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1132797521 16:1732595-1732617 GGACTTGCCCTGAGAACGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 103
1132797512_1132797521 28 Left 1132797512 16:1732544-1732566 CCTCAGGCAGTCTCGCTGCTCTC 0: 1
1: 0
2: 0
3: 13
4: 186
Right 1132797521 16:1732595-1732617 GGACTTGCCCTGAGAACGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132797521 Original CRISPR GGACTTGCCCTGAGAACGGG CGG Intronic
900516310 1:3083829-3083851 GGACTTGCCCAGGGAACTGCAGG + Intronic
901300882 1:8199412-8199434 GAACTTGCCCTGATAACCTGTGG - Intergenic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
903251854 1:22059931-22059953 GGACTATCCCTGAGAGCTGGGGG + Intronic
905099549 1:35507072-35507094 GGAGTTGGCCTGAGATCTGGGGG - Exonic
905807981 1:40890663-40890685 GGACCTGCCCAGAGGACAGGTGG + Intergenic
907440606 1:54475910-54475932 GGGCCTCCCCTGAGAACTGGGGG - Intergenic
923798843 1:237186987-237187009 GGACTTGCCCTGACAAGTGAAGG + Intronic
924707398 1:246511263-246511285 GCACCTGCCCTGAGGACCGGGGG + Intergenic
924787810 1:247216502-247216524 AGACTGGCCCTGAGAAAGGGAGG + Intergenic
1076511864 10:131019854-131019876 GCACCTGCCCCGAGAACGGTGGG + Intergenic
1088466114 11:110140618-110140640 GGACTTGCCATGATAAAGGAGGG - Intronic
1096469161 12:51865455-51865477 GGACAAGCCCTGTGAACAGGTGG - Intergenic
1096594414 12:52685527-52685549 GGACTTGCCCTGGGAAAGCTAGG + Intergenic
1099658398 12:85524569-85524591 CTACTTGGCCTGAGAAAGGGAGG - Intergenic
1105440138 13:20408172-20408194 GGACTTGCCCAGGGTAGGGGAGG + Intronic
1106134066 13:26961331-26961353 AGACACGGCCTGAGAACGGGCGG + Intergenic
1106340288 13:28820406-28820428 AAACTTGCCCTGAGAGCCGGCGG - Exonic
1106667715 13:31870146-31870168 GCAGTTGCCCTGGGAAGGGGTGG - Intergenic
1110280032 13:73682199-73682221 GGACTTGCCTTGGGAGCAGGTGG + Intergenic
1112286746 13:98111505-98111527 AGGGCTGCCCTGAGAACGGGAGG - Intergenic
1113769636 13:112899750-112899772 GGACCTGCCCTGTGGACGGAGGG + Intronic
1117724524 14:58659924-58659946 AGATATGCCCTGAGAATGGGTGG - Intergenic
1117900987 14:60532989-60533011 GAACTTGCTCTGAGATGGGGAGG - Intergenic
1123116854 14:105898823-105898845 GGGCTTGGCCTGAGAGGGGGCGG + Intergenic
1123122033 14:105921207-105921229 GCAGACGCCCTGAGAACGGGAGG + Exonic
1123476833 15:20596786-20596808 GGATTTGCCCTGTGAGCAGGTGG + Intergenic
1123641178 15:22403578-22403600 GGATTTGCCCTGTGAGCAGGTGG - Intergenic
1127384739 15:58458300-58458322 GGACTTCCCCTGAGCAAGGTCGG + Intronic
1129209626 15:74060202-74060224 GGACCTGCCCTGAGACAGAGGGG + Intergenic
1131079711 15:89524445-89524467 GGACTTTCACTGAGAATGGTGGG + Intergenic
1132797521 16:1732595-1732617 GGACTTGCCCTGAGAACGGGCGG + Intronic
1132797557 16:1732755-1732777 CAGCTTGCCCCGAGAACGGGTGG + Intronic
1132833990 16:1943308-1943330 GGACCAGCCCTGAGGAGGGGCGG - Exonic
1133685060 16:8158711-8158733 GGACTTGACCTGAGACCAGAAGG - Intergenic
1136628865 16:31477648-31477670 GGCCTTGCTCTCAGAGCGGGAGG + Exonic
1141165962 16:81661305-81661327 GGGCTTTCCCTGAACACGGGAGG + Intronic
1144070524 17:11667471-11667493 GGCCTTGCCTTCAGAACTGGAGG - Intronic
1145816456 17:27798410-27798432 GAGCTTGGCCTGAGAATGGGAGG - Intronic
1147654666 17:42082056-42082078 GGACTTGCCTGGAGAAAGGCGGG - Intergenic
1148020016 17:44547566-44547588 GGCCTTCCCCTCAGAACTGGGGG - Intergenic
1151571046 17:74925464-74925486 GGACAGGCCCTGAGGATGGGAGG - Intronic
1152068263 17:78123121-78123143 GCACTTGCCCTGAGAGGGGAAGG - Intronic
1152605291 17:81286544-81286566 GGACTGGCACAGAGAAAGGGAGG + Intronic
1153781604 18:8499980-8500002 GGACCTGCTCTGAGAACAGGTGG + Intergenic
1156400890 18:36739159-36739181 GGTCTTGCCCTGGAAAGGGGTGG - Intronic
1163272737 19:16263815-16263837 GGACTTGCTCTGCGCACCGGAGG + Intergenic
1164724659 19:30457974-30457996 GGGCTTGCTATGAGAATGGGTGG + Intronic
927698440 2:25252517-25252539 GGGCGGGCCCTGGGAACGGGCGG - Intronic
932889565 2:75580189-75580211 GGACCTGCCCTGGGACAGGGGGG + Intergenic
934037795 2:88103218-88103240 GGAAGTGGCGTGAGAACGGGCGG + Intronic
937418602 2:121737016-121737038 GGAGTTGCCCGGAGAAGCGGGGG + Intergenic
944680625 2:202073593-202073615 GGACTGCCCTTGAGAAGGGGTGG + Exonic
946077895 2:217090857-217090879 TGACTTGGCCTGAGAGAGGGTGG - Intergenic
949057616 2:241936982-241937004 GCACTTGCCGTGACAACAGGCGG + Intergenic
1168765824 20:381193-381215 GGACTCGCCCGGAGGCCGGGGGG + Intronic
1170305397 20:14932327-14932349 AGACCTGCCCTGGGAACAGGCGG + Intronic
1170590952 20:17771404-17771426 GGACTTGGGCTGAGAGCTGGTGG - Intergenic
1170778661 20:19403743-19403765 GGACTGGCCCTGGGGAAGGGAGG + Intronic
1174385749 20:50187724-50187746 GGACCTGCGCTGAGAAGGGATGG + Intergenic
1178436817 21:32567314-32567336 GGACCTGCCCTGTGGAGGGGAGG + Intergenic
1179956691 21:44744658-44744680 TGACATGCCCTGATAACTGGTGG - Intergenic
1181841121 22:25662469-25662491 GGACTTGCTGTGACAATGGGAGG - Intronic
1184594451 22:45505325-45505347 GGACTTGGCTTGAAAACGTGTGG + Intronic
954194205 3:48986669-48986691 GGAGTGGCCCTGAGCATGGGTGG - Intergenic
956116936 3:65928356-65928378 GCACTTGCTCTGAGAACTTGAGG + Intronic
963921966 3:150914410-150914432 GAGCTTGCCCTGAGAGCTGGGGG + Intronic
965684455 3:171287103-171287125 GAACTTGCCCTGAGGACTGTAGG - Intronic
968575079 4:1362257-1362279 GGAGGTGCCCTGTGCACGGGTGG + Intronic
968625869 4:1626476-1626498 GGCCATGCCCTGAGCCCGGGGGG + Intronic
968625919 4:1626650-1626672 GGCCATGCCCTGAGCCCGGGGGG + Intronic
971012685 4:22456352-22456374 GGACCTGCCCTCAGTATGGGTGG + Intronic
975928472 4:79489170-79489192 GTATTTCCCCTGAGAACTGGAGG - Intergenic
979158580 4:117429598-117429620 GGAGTTGCCCTGAGCCCAGGCGG + Intergenic
983915052 4:173282805-173282827 TGACATGCCCTGATAACTGGTGG + Intronic
996650185 5:125866426-125866448 GGACAAGCACTGAGAACGTGGGG - Intergenic
998733721 5:145110723-145110745 GGACTTGCTATGAGAACTGGAGG - Intergenic
1002863635 6:1101999-1102021 ACAGTTGCCCTGAGAACTGGTGG + Intergenic
1003383398 6:5645662-5645684 TGGCCTGCCCTGAGAACTGGGGG + Intronic
1008528794 6:52434949-52434971 GAAGTTGGCCTGAGAATGGGAGG - Intronic
1016012276 6:139149713-139149735 GGGCTTGCCCTGAGACCGGCAGG - Intronic
1017969583 6:159299871-159299893 GGACCTGGCCTGAGACTGGGTGG - Intergenic
1021488643 7:21194154-21194176 GCACAGGCCCTGAGAACGTGAGG - Intergenic
1024337954 7:48228391-48228413 AGACTTGCCCTCAGAAGGAGGGG - Intronic
1030969903 7:116044173-116044195 TGACTTGCCCTAAGAAAGGCAGG + Intronic
1033685127 7:143632723-143632745 GGACTTGCTCTGAAGGCGGGAGG - Intronic
1033688300 7:143711942-143711964 GGACTTGCTCTGAAGGCGGGAGG - Intronic
1033699487 7:143824898-143824920 GGACTTGCTCTGAAGGCGGGAGG + Intergenic
1041298381 8:56386026-56386048 GGACCTGCCCTGAGAAAATGTGG + Intergenic
1047552730 8:125894148-125894170 GGACATACCCTGAGATTGGGAGG + Intergenic
1048306413 8:133287703-133287725 GGGGCTGCCCTGAGCACGGGAGG + Intronic
1048857940 8:138699951-138699973 GGGCTTGTCCTGAAAACAGGTGG - Intronic
1062310062 9:135930599-135930621 TGACTTCCCCTGAGATCGTGGGG - Intergenic
1062312145 9:135944639-135944661 GGCCCTGCCCAGAGACCGGGAGG - Intronic
1062707749 9:137954579-137954601 GGCCATGCCCTGAGAATGAGAGG - Intronic
1187588462 X:20689874-20689896 GGACCTGCCCTGGGAAAGAGGGG - Intergenic
1188682826 X:33032232-33032254 GTACTTCCCCTGACAAAGGGAGG - Intronic
1188715643 X:33456586-33456608 GGACCTGCCCTGAGACAGAGGGG + Intergenic
1188749979 X:33893278-33893300 GGACTTGCCCTGAGCCAGAGGGG - Intergenic
1189295557 X:39915165-39915187 GGACTTGGCCTGGGCAGGGGTGG - Intergenic
1192439355 X:71163419-71163441 GGACCTGCCCTGAAAATGAGGGG + Intronic
1197384126 X:125782581-125782603 TGACATGCCCTGATAACTGGTGG + Intergenic
1199927361 X:152481061-152481083 CGACTTGCCCAGAGCCCGGGAGG + Intergenic
1200555403 Y:4631184-4631206 GGACCTGCCCTGAGACAGAGAGG - Intergenic
1201324813 Y:12744790-12744812 TGACATGCCCTGATAACTGGTGG + Intronic
1201686177 Y:16705054-16705076 TGACTTGACCTGAGAAGTGGAGG + Intergenic
1202338681 Y:23837052-23837074 GGACATGCCCTGATAACTGAGGG + Intergenic
1202532085 Y:25833020-25833042 GGACATGCCCTGATAACTGAGGG - Intergenic