ID: 1132799087

View in Genome Browser
Species Human (GRCh38)
Location 16:1742674-1742696
Sequence CAGTAACACCACAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132799083_1132799087 -1 Left 1132799083 16:1742652-1742674 CCAGGGGAACAGGCAGGGCTGGC 0: 1
1: 1
2: 9
3: 46
4: 533
Right 1132799087 16:1742674-1742696 CAGTAACACCACAGGGAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 228
1132799078_1132799087 11 Left 1132799078 16:1742640-1742662 CCTCTGCTGGCGCCAGGGGAACA 0: 1
1: 0
2: 2
3: 16
4: 201
Right 1132799087 16:1742674-1742696 CAGTAACACCACAGGGAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 228
1132799077_1132799087 12 Left 1132799077 16:1742639-1742661 CCCTCTGCTGGCGCCAGGGGAAC 0: 1
1: 0
2: 0
3: 13
4: 182
Right 1132799087 16:1742674-1742696 CAGTAACACCACAGGGAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132799087 Original CRISPR CAGTAACACCACAGGGAGGC AGG Intronic
900574531 1:3376526-3376548 CAGTGAGACCACAGTCAGGCGGG + Intronic
900751566 1:4401121-4401143 CAGACACATCACATGGAGGCAGG - Intergenic
900769458 1:4529009-4529031 AAGAAAGAACACAGGGAGGCCGG + Intergenic
901507037 1:9691261-9691283 CAGTACCACCAAAGGGAGCTGGG + Intronic
901773933 1:11546143-11546165 CAGTGACAGCTCAGGGAGGAGGG - Intergenic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
904465186 1:30703519-30703541 GAGGAACACCAAAGAGAGGCAGG - Intergenic
904874406 1:33643163-33643185 GAGGACCTCCACAGGGAGGCAGG - Intronic
905732529 1:40306504-40306526 CAGTACCCCCACAGGGAGGGAGG + Intronic
906321939 1:44822607-44822629 CACCAGCTCCACAGGGAGGCGGG - Exonic
907446324 1:54510279-54510301 TGATAAAACCACAGGGAGGCAGG + Intergenic
908280589 1:62530797-62530819 CAGTTACGGCACAGGGATGCAGG - Intronic
908805603 1:67928095-67928117 CAGTATCACCACAGAGTGACTGG - Intergenic
909308490 1:74114088-74114110 CAATAAGAGCACAAGGAGGCAGG + Intronic
909345760 1:74584509-74584531 CAGAAAGACCACAGGGAGCAGGG - Intronic
909609767 1:77539810-77539832 CAGTAAAACAACAGGGAGGAGGG - Intronic
910806910 1:91197586-91197608 CAGTCACACCCCAGAGAGACTGG + Intergenic
910982914 1:92976588-92976610 CAGGAACACCAAAGGGAATCTGG - Intergenic
914882352 1:151557053-151557075 CAGTTAATCCACAGGAAGGCAGG - Intronic
915119163 1:153617731-153617753 CAGTGACAGCCCTGGGAGGCTGG + Intergenic
916888735 1:169096118-169096140 CAGTAAGTCCTCAGGGAGCCAGG - Intergenic
917336126 1:173926086-173926108 GAGAAACAGCAAAGGGAGGCTGG + Intergenic
917651125 1:177078286-177078308 CAGTGACCCCACAGGGATGAAGG - Intronic
917766660 1:178227069-178227091 CTGTAACACCACAGGTGGGCAGG - Intronic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
919805537 1:201379129-201379151 GAGGACCACCACAGGGAAGCAGG + Intronic
920418119 1:205812470-205812492 CAGGAACACAGGAGGGAGGCGGG - Intronic
920749521 1:208660361-208660383 CCGTAACACCAAAGGTAGCCTGG - Intergenic
921273022 1:213489657-213489679 CAGTGGCAACTCAGGGAGGCAGG + Intergenic
922096534 1:222447744-222447766 CAGCAGAACCACAGGGAGTCTGG - Intergenic
923517169 1:234707550-234707572 CAGTAACAGCATAGGAAGGAAGG + Intergenic
923569307 1:235099950-235099972 GAGTAACACCAAAGAGAGACTGG + Intergenic
923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG + Intergenic
1063396399 10:5692439-5692461 CAGTAACCCCACTAGGAGGATGG - Intronic
1063819138 10:9814109-9814131 CAGTAAAACCACAAGGAGAAAGG - Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1067272189 10:44802196-44802218 CAGGATCACCCCAGGGAGACTGG - Intergenic
1068843136 10:61638451-61638473 AATTAAAACCACAGTGAGGCCGG - Intergenic
1069264653 10:66443083-66443105 CTGCAAGGCCACAGGGAGGCTGG + Intronic
1070826498 10:79393387-79393409 CAGTCCCACCCCAGGCAGGCTGG - Intronic
1077246650 11:1542509-1542531 CGGCGGCACCACAGGGAGGCAGG + Intergenic
1078240774 11:9529413-9529435 CAGGACCAGCACTGGGAGGCTGG - Intergenic
1078607074 11:12786120-12786142 CAGTCACAGCACAGGGTGGGAGG + Intronic
1079786538 11:24680276-24680298 CAGAAGCAGCACAGGGAAGCTGG - Intronic
1082775115 11:57238573-57238595 CTGTAAGACCACAGGGGGTCAGG + Intergenic
1082902190 11:58267136-58267158 CAGCAGCACCACAGTGAGGTGGG + Exonic
1082928774 11:58578701-58578723 CAGTGGCTCCTCAGGGAGGCAGG + Intergenic
1083904356 11:65660413-65660435 CAGGGAGCCCACAGGGAGGCTGG - Intronic
1084449801 11:69229773-69229795 CAGTAACAGCACAGACAGGTGGG - Intergenic
1085319820 11:75567077-75567099 CTGTGACAACCCAGGGAGGCAGG + Intronic
1085654539 11:78300989-78301011 AATTAAAACCACAGCGAGGCTGG - Intronic
1086502281 11:87465719-87465741 CAGCAACACCACAGGAAACCCGG - Intergenic
1088333653 11:108679151-108679173 CATTAACACCAGGGGAAGGCTGG - Intronic
1088491058 11:110388477-110388499 CTGCAACACCACAGCGAGACTGG - Intergenic
1089499977 11:118926041-118926063 GAGTCAGACCACTGGGAGGCTGG - Intronic
1091091746 11:132777491-132777513 TAGTAACTCCACTGGGTGGCTGG - Intronic
1091805321 12:3351957-3351979 CAGTAACTCAAGAGGGAGACAGG - Intergenic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1095867163 12:46984271-46984293 CAGTCACACCCCAGGGAGTAAGG + Intergenic
1096187679 12:49592876-49592898 CAGTTACTCCACAAGAAGGCAGG + Intronic
1096559185 12:52423783-52423805 CACTAACAGAGCAGGGAGGCCGG + Intergenic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1097608230 12:61782242-61782264 CAGTAATTCCAAAGGGAGGCGGG - Intronic
1099327018 12:81229826-81229848 CAGGATCACTACTGGGAGGCTGG + Intronic
1104373411 12:128243748-128243770 CAGTACAAACCCAGGGAGGCAGG - Intergenic
1104903195 12:132200054-132200076 GAGTAGAAGCACAGGGAGGCTGG + Intronic
1106899270 13:34337892-34337914 GAATAACACCACATGAAGGCAGG - Intergenic
1107594080 13:41943804-41943826 AACTTACACCACAGTGAGGCTGG + Intronic
1110904834 13:80873738-80873760 CACTGACACCACAGAGAGGGTGG - Intergenic
1112092436 13:96095534-96095556 CAGTCACACCACCGGAAGGTTGG + Intronic
1112578124 13:100655473-100655495 CAGTAACAGGACTGGGAGGGAGG - Intronic
1113049452 13:106193314-106193336 CAGTAAGAACACAGGGACACAGG + Intergenic
1114693582 14:24607105-24607127 CAGAAAGACCACAGGGAGAGAGG - Intronic
1115848472 14:37565761-37565783 GAGGAACACCACAAGGGGGCAGG - Intergenic
1118331274 14:64817794-64817816 CAGGAACTCCCCAGGGAGGGTGG - Intronic
1119899404 14:78247129-78247151 CAGCAACACCGCAGGGGGGCTGG - Intronic
1120810539 14:88798868-88798890 CAGTATTACCCCAGTGAGGCAGG + Intergenic
1121332133 14:93056251-93056273 CAGAAAGATCACAGGGAGGACGG + Intronic
1121436236 14:93922004-93922026 GAGAAACAGCACAGGGTGGCTGG + Intronic
1121657229 14:95605925-95605947 CAGAAACACCCCAGAGTGGCCGG + Intergenic
1122319595 14:100845732-100845754 CAGAGACAACACAAGGAGGCAGG - Intergenic
1122950631 14:105042548-105042570 CAGTGACACCACAAGGAGGCAGG + Intergenic
1125828316 15:42693904-42693926 CAGTAACTCCTCAGGTTGGCAGG - Exonic
1128925436 15:71651109-71651131 CAGAAACTCCACTGGGGGGCAGG - Intronic
1131864560 15:96693641-96693663 CAGTAACTTGACAGGGAGGAAGG + Intergenic
1132552484 16:559289-559311 CTGAAACAGCACAGGGAGCCCGG - Intergenic
1132799087 16:1742674-1742696 CAGTAACACCACAGGGAGGCAGG + Intronic
1132980182 16:2734623-2734645 CATTAGAACCACAGTGAGGCCGG + Intergenic
1134073759 16:11276446-11276468 CAGTAACACCAAGGGCAGGTGGG - Exonic
1135008310 16:18848631-18848653 CAGTAACAGCTCAGTGAGCCTGG + Intronic
1135427253 16:22349249-22349271 CTGTAACTCCACAGAAAGGCAGG + Intronic
1136005562 16:27326725-27326747 CAGCAGGCCCACAGGGAGGCTGG + Intronic
1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG + Intronic
1137326032 16:47438109-47438131 CGGTAAGGCCACAGCGAGGCTGG + Intronic
1137701350 16:50500293-50500315 CAGTGACAACCCAGGGAGGGAGG + Intergenic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1138974196 16:62184158-62184180 CAGTAACCCAGCAGGGGGGCGGG - Intergenic
1141505482 16:84475132-84475154 CAGTAAGAACACATGGATGCAGG + Intergenic
1141685573 16:85567974-85567996 TCCTAACACCACTGGGAGGCTGG - Intergenic
1142942877 17:3397661-3397683 CAGTGACACCACAGACAGGTGGG + Exonic
1142946411 17:3433065-3433087 CAGTGACACCACAGAGAGGTGGG + Exonic
1142964228 17:3571011-3571033 CAGAAAAACCCCAAGGAGGCCGG - Intronic
1143102452 17:4511943-4511965 AAGTCACACCACAGGGAAGTAGG - Intronic
1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG + Intronic
1144288540 17:13803627-13803649 TACTAAGAACACAGGGAGGCTGG - Intergenic
1145056013 17:19704412-19704434 CAGAAGCAGCACAGGCAGGCGGG + Intronic
1146308523 17:31749387-31749409 CAGTAATAAAACAGGAAGGCAGG + Intergenic
1146489575 17:33270619-33270641 CAGTAACACCACTGGCCGGCTGG - Intronic
1146663997 17:34684404-34684426 GGGTAAAATCACAGGGAGGCAGG + Intergenic
1146969070 17:37057703-37057725 CAGAAAAACCACAACGAGGCCGG - Intergenic
1147319915 17:39639883-39639905 CAGAAAAGCCACAGGGAGGAGGG - Intronic
1148576920 17:48718903-48718925 CAGAGACACCGCAGGGAGTCAGG - Intergenic
1150506650 17:65705606-65705628 CAATGACACCACAAGGAAGCAGG + Intronic
1151318378 17:73337792-73337814 CAATTCCAGCACAGGGAGGCAGG + Exonic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1155025198 18:21934718-21934740 CAGAGAGTCCACAGGGAGGCAGG - Intergenic
1156409581 18:36815056-36815078 CAGGTACACCAGATGGAGGCTGG + Intronic
1156654765 18:39272137-39272159 TAGTGACAGCAAAGGGAGGCAGG - Intergenic
1159908417 18:74119637-74119659 CAGTAACACTGCAGGCAGGAGGG + Intronic
1160527437 18:79545867-79545889 TAGTGACAGCAAAGGGAGGCAGG + Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
926018491 2:9474679-9474701 CAGCGACCCCGCAGGGAGGCCGG - Intronic
926136580 2:10340827-10340849 CAGTAACAGGACAGGGATTCAGG - Intronic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927439061 2:23097390-23097412 CAGTAACTCCAGGGGGAGTCTGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927528400 2:23769978-23770000 AATTAAGACCACAGTGAGGCCGG - Intronic
933203013 2:79472281-79472303 CAGTACCACCACCTGAAGGCAGG - Intronic
934107220 2:88706500-88706522 CAGTGAGAACACATGGAGGCAGG + Intronic
936698904 2:114986449-114986471 GAATAACACCTCAGGGAAGCAGG - Intronic
937037313 2:118792887-118792909 CAGAAACACAACAGATAGGCAGG + Intergenic
937496746 2:122428615-122428637 CAGTGAGACTACAGGCAGGCGGG - Intergenic
944474797 2:200092623-200092645 CAGTATCCCCACAGGAAGCCAGG + Intergenic
945219630 2:207470460-207470482 AAGTAACAGCAAAGAGAGGCAGG - Intergenic
946465390 2:219907374-219907396 CAGAAACTCCACAGGCTGGCTGG - Intergenic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947638699 2:231693954-231693976 CAGAGACCCCACAGGCAGGCTGG - Intergenic
1170873267 20:20227921-20227943 AAGTAACACTACAAGGAGACAGG - Intronic
1171413314 20:24960706-24960728 CAGTCACATCCCTGGGAGGCTGG + Intergenic
1173622952 20:44450500-44450522 AAGAACCATCACAGGGAGGCAGG - Intergenic
1173667886 20:44775576-44775598 GAGTAACCCCACAGCGGGGCTGG + Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1179926523 21:44538098-44538120 CAGTCACCCCACAGCCAGGCCGG - Intronic
1180076901 21:45467676-45467698 CAGTTCCACCACAGGGAAGGAGG - Intronic
1183836525 22:40458779-40458801 CAGAAACACCTCAGGCTGGCCGG + Intronic
1184402678 22:44282889-44282911 CTGGGACACCACATGGAGGCTGG + Intronic
1184518548 22:44978653-44978675 GATGAAAACCACAGGGAGGCTGG - Intronic
1184576091 22:45367475-45367497 CAGCAACACCACACAGAGGTAGG - Intronic
950161952 3:10766894-10766916 CAGATAAACCACAGGGAAGCAGG - Intergenic
952493428 3:33894299-33894321 CAGTTTCACCCCAGGGATGCAGG - Intergenic
953864819 3:46575236-46575258 AAGTAACCCCACTGTGAGGCTGG - Intronic
953916987 3:46926615-46926637 TGGTAACTCCACAGGGCGGCAGG + Intronic
954438876 3:50510811-50510833 CAGCACCACCCCAAGGAGGCAGG - Intergenic
954505186 3:51063871-51063893 CTGTTACACCAGAGGGAGTCGGG + Intronic
954708890 3:52495333-52495355 CAGGCACAGCACAGGCAGGCGGG - Exonic
954947102 3:54435314-54435336 CACTAACACCAGAGGCACGCAGG - Intronic
954962485 3:54578589-54578611 CTGTATCACCAGAGGGAGCCGGG - Intronic
956186050 3:66562886-66562908 CAGGAAAACAACAGGGAGTCAGG + Intergenic
957526409 3:81384363-81384385 CATTAAAACATCAGGGAGGCCGG + Intergenic
959619184 3:108381676-108381698 CATTAACTTCAAAGGGAGGCAGG + Intronic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
962431964 3:135328175-135328197 CAATCACACTACAGGGAGGCCGG + Intergenic
962599382 3:136979450-136979472 CTGTAACAGCAAAGGGAGGCAGG + Intronic
965278195 3:166715174-166715196 CAGTAACTCAAAAAGGAGGCTGG + Intergenic
966191542 3:177276298-177276320 CAACAAAAACACAGGGAGGCAGG - Intergenic
968005606 3:195240629-195240651 CAGCAACGCCACAGGTCGGCCGG + Intronic
968046546 3:195626886-195626908 CAGTGACACACCAGGGAAGCCGG + Intergenic
968115136 3:196083514-196083536 AAGGAACACCACAGGGGAGCAGG - Intergenic
968308107 3:197663155-197663177 CAGTGACACACCAGGGAAGCCGG - Intergenic
968467855 4:761870-761892 CAGTGACACCATGGGGATGCAGG + Intronic
969973607 4:11073995-11074017 AAGGAATAGCACAGGGAGGCTGG - Intergenic
973839650 4:54848139-54848161 CAGTGACTGCACAGGGAGACTGG - Intergenic
975743925 4:77457222-77457244 CAGTAACTTCACAGGCTGGCAGG + Intergenic
979408226 4:120341070-120341092 CAGTGACTCCACAGTGAAGCAGG + Intergenic
979664565 4:123296262-123296284 AAATAACACCAGAGGGATGCAGG + Intronic
981018210 4:139997454-139997476 CAGTAACAGCACAAAGAGGGTGG - Intronic
981263199 4:142747817-142747839 CAATAAGAACACAGGGATGCAGG + Intronic
981663042 4:147189826-147189848 CAGTAAGAACACAGGGACCCAGG + Intergenic
981747919 4:148068862-148068884 AAGTAGCACCAAAGAGAGGCAGG - Intronic
985290460 4:188381235-188381257 CAGCAACACCATATAGAGGCAGG - Intergenic
989195491 5:38712494-38712516 CATTAAAACCACAGAGTGGCTGG - Intergenic
989236724 5:39156426-39156448 CAGCAAAACCAGAGGGAAGCAGG + Intronic
991464131 5:66892308-66892330 CAGTAATACAAAAGGGAGGAGGG - Intronic
992554667 5:77891723-77891745 CAGGAACAGCACAGGGGAGCTGG + Intergenic
992800653 5:80292769-80292791 CACTGACACCAGAGTGAGGCTGG - Intergenic
993295350 5:86131529-86131551 CAGTAACACCAGAGAGAGTAAGG - Intergenic
993916654 5:93751950-93751972 CAGGCACACCACAGTCAGGCAGG + Intronic
993961610 5:94304273-94304295 CACTTATGCCACAGGGAGGCAGG - Intronic
997356763 5:133267425-133267447 CATAAGCCCCACAGGGAGGCCGG + Intronic
997512437 5:134462927-134462949 CAGTACCACTGCATGGAGGCTGG + Intergenic
997690729 5:135825907-135825929 CAGTCACACCACGGGGAAGCCGG + Intergenic
998496219 5:142592098-142592120 CAGCCACACCTCAGGGATGCTGG + Intergenic
999112966 5:149137991-149138013 CAATAACAGCAATGGGAGGCAGG + Intergenic
1003168885 6:3704746-3704768 CAGTAGCAGCCCAGTGAGGCTGG + Intergenic
1006422557 6:33944563-33944585 CAGTGACACCACTGGGTTGCTGG - Intergenic
1006831812 6:36972678-36972700 GAGTGACACCCCAGGGGGGCTGG - Exonic
1008979288 6:57464569-57464591 CAGAAATACAAAAGGGAGGCCGG - Intronic
1010813685 6:80329615-80329637 CAGCACCAGCACAGGGAGGAGGG - Intronic
1011677265 6:89746995-89747017 CAGTGTCACCACAGGTAGTCTGG - Intronic
1012266211 6:97146446-97146468 CAGTCACAAGGCAGGGAGGCAGG + Exonic
1012620613 6:101339698-101339720 CAGCATGGCCACAGGGAGGCAGG - Intergenic
1019360779 7:603256-603278 CAGGCCCACCGCAGGGAGGCAGG + Intronic
1020011760 7:4809181-4809203 CAGTGACAGCCCGGGGAGGCGGG - Intronic
1020891242 7:13880440-13880462 CAGTGTCAACACAGGCAGGCAGG - Intergenic
1021783711 7:24132535-24132557 CACTGACCCCACAGGGTGGCTGG + Intergenic
1023927213 7:44678185-44678207 CAGTAACAACACTGGGTGTCTGG + Intronic
1024146473 7:46522437-46522459 CAGAAAGACCCCAGGGAGGGCGG + Intergenic
1024626873 7:51215428-51215450 CAGAAACATCACAGGGAGGTTGG + Intronic
1027403808 7:77836765-77836787 CAGTAAGAACACATGGAGACAGG + Intronic
1028708842 7:93883721-93883743 TAGTAACCCCAAAGGGAAGCTGG - Intronic
1029032193 7:97480323-97480345 CAGTCACAACTCAGAGAGGCAGG - Intergenic
1029215569 7:98946786-98946808 TTGCAACACCACTGGGAGGCAGG - Intronic
1031894049 7:127327626-127327648 CAGGACCACCCCAGGCAGGCTGG + Intergenic
1032446801 7:131991186-131991208 TAGGTTCACCACAGGGAGGCAGG + Intergenic
1032456102 7:132074704-132074726 CAGTGGCATGACAGGGAGGCCGG + Intergenic
1032992523 7:137409730-137409752 TAGAAACAGCACAGGAAGGCAGG - Intronic
1033176831 7:139132518-139132540 CAGTCACATCCCAGGGAGGAGGG - Intergenic
1033306077 7:140226685-140226707 CAGCAGCACCACAGGGTGACAGG - Intergenic
1033307914 7:140238648-140238670 CAGGAACCCCACAGGAAGGAAGG - Intergenic
1035038650 7:155911658-155911680 CTGGATCACCACAGGGAGGCCGG + Intergenic
1036181459 8:6588836-6588858 CAGCACCACGACAGGCAGGCTGG + Intronic
1036767468 8:11557883-11557905 CACTCACACCAGAGAGAGGCTGG + Intronic
1040300836 8:46187216-46187238 CAGTGAGACCACAGGGATGCTGG - Intergenic
1041197728 8:55418023-55418045 CAGAAACAACACAGTGAGGGTGG + Intronic
1041896103 8:62926368-62926390 CAGTAAACCCACAGGGGGGCTGG - Intronic
1043195491 8:77287378-77287400 CATAAACACCAGAAGGAGGCAGG + Intergenic
1045318468 8:101063408-101063430 CAGTCACAGTACAGGGTGGCTGG + Intergenic
1048316078 8:133363287-133363309 AAGCAACACCCCAGGGAGGGTGG - Intergenic
1048427374 8:134335346-134335368 CAGTAACAGCATAGGGAAGGGGG + Intergenic
1052448759 9:28598550-28598572 CAGGAACACAGCAGGGAGGTTGG + Intronic
1053112141 9:35470495-35470517 GAGACACACCACAGGCAGGCTGG + Intergenic
1053380207 9:37642928-37642950 CAAGTACTCCACAGGGAGGCAGG - Intronic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1057270553 9:93648236-93648258 CAGCAACACCACTGGGACGCTGG - Intronic
1057435180 9:95033397-95033419 GAGAAACACAACAGGGAGGGAGG - Intronic
1058147254 9:101425693-101425715 CATTTACACTGCAGGGAGGCAGG + Intronic
1059739209 9:117133287-117133309 CAGTCACCTCACAGGGAGGCTGG - Intronic
1060732288 9:126046404-126046426 GCCTGACACCACAGGGAGGCTGG + Intergenic
1062631093 9:137463513-137463535 ACGTACCACCACAGGGAGCCTGG + Exonic
1185727452 X:2433598-2433620 CAGTGAGAACACAGGGACGCAGG - Intronic
1189453361 X:41160649-41160671 GAGTAACACAGAAGGGAGGCAGG - Intronic
1200054897 X:153455237-153455259 CAGGAACAGCACCTGGAGGCTGG + Intronic