ID: 1132799728

View in Genome Browser
Species Human (GRCh38)
Location 16:1746080-1746102
Sequence GTCCCAGGCAGCCGCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132799728_1132799737 8 Left 1132799728 16:1746080-1746102 CCCACCCAGCGGCTGCCTGGGAC 0: 1
1: 1
2: 0
3: 22
4: 233
Right 1132799737 16:1746111-1746133 GAGCCACCTGGGTGCCTCTGAGG 0: 1
1: 0
2: 3
3: 22
4: 250
1132799728_1132799735 -4 Left 1132799728 16:1746080-1746102 CCCACCCAGCGGCTGCCTGGGAC 0: 1
1: 1
2: 0
3: 22
4: 233
Right 1132799735 16:1746099-1746121 GGACAGGCACAGGAGCCACCTGG 0: 1
1: 0
2: 1
3: 38
4: 360
1132799728_1132799736 -3 Left 1132799728 16:1746080-1746102 CCCACCCAGCGGCTGCCTGGGAC 0: 1
1: 1
2: 0
3: 22
4: 233
Right 1132799736 16:1746100-1746122 GACAGGCACAGGAGCCACCTGGG 0: 1
1: 0
2: 3
3: 28
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132799728 Original CRISPR GTCCCAGGCAGCCGCTGGGT GGG (reversed) Intronic
900199707 1:1398972-1398994 GGCCCAGGTAACCGCTGGGGCGG - Intronic
900329662 1:2127741-2127763 GTCCCTGGCAGCCCCTGGCCAGG + Intronic
900458227 1:2787534-2787556 GCCCCAGGCAGCCCCTGTGCTGG - Exonic
900599101 1:3495567-3495589 GGGCCAGGCAGGCGCTGGGTAGG + Intronic
901027036 1:6284185-6284207 CTCACAGGCAGCCTCTGGGAAGG + Intronic
901237749 1:7676531-7676553 GTCCTAGGGAGCGGCTGGCTTGG + Intronic
901463272 1:9404387-9404409 GACCCAGGGAGCAGCAGGGTTGG + Intergenic
902300513 1:15499164-15499186 GTCCCAGTCAGCCTCTGTCTGGG - Intronic
903164299 1:21509823-21509845 GTCCCAGGCAGCGGCTCGGGAGG - Intronic
903175580 1:21578184-21578206 GTCCCAGGAAGCCGGTGCCTGGG + Exonic
904297823 1:29533228-29533250 ATCACAGGCAGCTGCTGGGTTGG + Intergenic
904473621 1:30750881-30750903 GTCCCAAGCAGCCCCTGTGCAGG + Intronic
904830529 1:33303698-33303720 GTTCCAGGAAGCTGCAGGGTGGG - Intergenic
905319256 1:37104343-37104365 GTCCCAGGCAGCAGCTTGGCTGG + Intergenic
905972706 1:42153682-42153704 GACCAAGGCAGCTGGTGGGTGGG + Intronic
912557958 1:110529877-110529899 ATCCCAGGCACCAGCTGGGCAGG - Intergenic
918420968 1:184363878-184363900 GTCCCCGGCAGAGGCTGGGGTGG + Intergenic
922473616 1:225891067-225891089 GTTCCAGGCACCCCCTGTGTGGG + Intronic
924455348 1:244214784-244214806 GTACCAGGCAGGCACTGGCTTGG - Intergenic
1062848451 10:725750-725772 GTCCGGGGCAGCTGCTGGGTGGG - Intergenic
1063387137 10:5623120-5623142 GTCCCAGGGAGCCACGGGCTGGG - Intergenic
1066488898 10:35875147-35875169 GTCACAGCCAGCCCCTGGATGGG - Intergenic
1067308978 10:45094453-45094475 GTCGCAGCCAGCCCCTGGATGGG - Intergenic
1070555617 10:77525565-77525587 GCCCCAGGCACCAGCTGTGTGGG - Intronic
1070814519 10:79314306-79314328 GCCCCAGGCAGCAGCCGGGAAGG - Exonic
1072226743 10:93377055-93377077 GTCCCAGGCAGCCTCAGGCAAGG - Intronic
1073931216 10:108578992-108579014 GTCCCAGCCAGCTACTGGGGAGG + Intergenic
1076096078 10:127736207-127736229 GACCCAGGCTGACGCTGGGCTGG - Intergenic
1076617178 10:131763169-131763191 GTCCCAGGCAGCAGCGGGTGTGG - Intergenic
1077171554 11:1168573-1168595 ACCCCAGGCAGCCCCGGGGTGGG - Intronic
1077608211 11:3626542-3626564 GTGGCAGGCAGCCGCTTGGGAGG - Intergenic
1077891100 11:6418887-6418909 GACCCGGGCTGCCGCAGGGTAGG + Intronic
1078340926 11:10497481-10497503 ATCCCAGGCATCCGGAGGGTGGG - Intronic
1079077963 11:17395449-17395471 GGCCCAGGCAGCCTCTGGAAGGG - Intronic
1079173820 11:18120818-18120840 GGCCAAGGCAGCGGCTGGGGAGG - Intronic
1080388415 11:31823714-31823736 GCGCGAGGCAGCCGCTGGCTAGG + Intronic
1081664101 11:44906497-44906519 TTCCCAGGCCTCTGCTGGGTGGG + Intronic
1083670884 11:64299470-64299492 GTCCAGCGCAGCCGCTGGGCAGG + Exonic
1084150425 11:67285618-67285640 GCGCCGGGCAGCGGCTGGGTTGG - Exonic
1084534857 11:69750672-69750694 GATCCAGGCAGCCCCTGGGAGGG - Intergenic
1084914485 11:72418113-72418135 GCCCTAGGCAGCAGCTGGGCAGG - Intronic
1084979806 11:72823003-72823025 GACCCTGGCAGCCTCTGGGGTGG - Intronic
1090307227 11:125702069-125702091 TTTCCAGGCAGCCTCTGGGCAGG - Intergenic
1090321056 11:125844289-125844311 GCCCCATGCAGCTCCTGGGTGGG - Intergenic
1090977251 11:131688535-131688557 CTCCCAGGCACACGCTGGGCAGG + Intronic
1091822767 12:3489067-3489089 GCCCCAGGCTGGCTCTGGGTTGG + Intronic
1092205960 12:6614227-6614249 GGCCCAGGCAGGCACGGGGTGGG - Intergenic
1095945353 12:47750494-47750516 GGCACAGGCATCGGCTGGGTGGG - Intronic
1099443034 12:82721249-82721271 GTCAGTGGCAGCTGCTGGGTCGG + Intronic
1100877081 12:98973975-98973997 GTTTCAGGCATCCACTGGGTGGG + Intronic
1102203620 12:111075178-111075200 GTGCCTGGCAGCAGCTGGGATGG - Intronic
1103900919 12:124303319-124303341 TTCCCCGGGAGCCGCTGGGGTGG - Intronic
1103994854 12:124822481-124822503 GTCCCCGGCAGCCACTGGTCTGG - Intronic
1105303469 13:19154234-19154256 GTCCCAGGCAGCAGCTGGGTGGG + Intergenic
1108131582 13:47307174-47307196 TTCCCAGGCAGCTGCAGGCTGGG + Intergenic
1112761174 13:102695148-102695170 GTCCTAGGCAGAGGCTGGGTGGG - Intergenic
1113036568 13:106056412-106056434 GCCCCAGACAGCCTCTGGGGAGG - Intergenic
1113799528 13:113079142-113079164 GTGCCAGGCAGCTGGTGTGTGGG + Intronic
1113992394 14:16037965-16037987 GCCGCAGCCAGCCTCTGGGTGGG - Intergenic
1117567690 14:57012050-57012072 GTCCCAGGCAACCCCTGATTTGG + Intergenic
1119724520 14:76914028-76914050 ATCCCAGCAAGCCACTGGGTGGG + Intergenic
1121050186 14:90815397-90815419 GTCTGAGGCAGCCTCTGAGTAGG - Intronic
1121690988 14:95876936-95876958 GTCCCCGTCTGCCGCTGGCTAGG - Intergenic
1122127523 14:99587213-99587235 ATCCCAGGCAGCCCCTGCCTCGG + Intronic
1122694813 14:103547385-103547407 GTCCCAGGCTTCCCCTGGGTTGG - Intergenic
1122979666 14:105185809-105185831 GTCACAGGCAGCAGGTGGATTGG + Intergenic
1123983360 15:25623144-25623166 GAACCAGACAGCCGCTGGTTTGG + Intergenic
1128133966 15:65249304-65249326 TCCCCAGGCAGCCCCTGGGCGGG + Intronic
1128695275 15:69757319-69757341 GGCCCAGGCATCCCCTGGGGTGG + Intergenic
1128886604 15:71293900-71293922 CCCCCAGGCAGCCACTGGGAGGG - Intronic
1129153785 15:73704948-73704970 CACCCAGGCAGCCGTTGGATGGG + Intronic
1130108875 15:80949013-80949035 TTCCCAGGCAGCTGCTGGCAGGG - Exonic
1130261184 15:82355452-82355474 GTCCCCTGCGGCCGCTCGGTGGG + Intergenic
1130280051 15:82513566-82513588 GTCCCCTGCGGCCGCTCGGTGGG - Intergenic
1130471426 15:84229752-84229774 GTCCCCTGCGGCCGCTCGGTGGG - Intergenic
1130478920 15:84344323-84344345 GTCCCCTGCGGCCGCTCGGTGGG - Intergenic
1130492850 15:84443808-84443830 GTCCCCTGCGGCCGCTCGGTGGG + Intergenic
1130593720 15:85234379-85234401 GTCCCCTGCGGCCGCTCGGTGGG - Intergenic
1131184815 15:90265400-90265422 GGCCTGGGCAGCCGCTGGGGCGG + Intronic
1131694010 15:94856167-94856189 GTCCCAGGCACCCGCCGTGGAGG + Intergenic
1132191590 15:99867050-99867072 GTCCCCGCCAGGCTCTGGGTTGG - Intergenic
1132799728 16:1746080-1746102 GTCCCAGGCAGCCGCTGGGTGGG - Intronic
1133464922 16:6019759-6019781 GACCCTGGCGGCCACTGGGTGGG - Intronic
1134798224 16:17060940-17060962 GTCCCAGGCAGCAGCAGGAATGG - Intergenic
1136911775 16:34149872-34149894 GCCGCAGCCAGCCTCTGGGTGGG - Intergenic
1137707442 16:50545352-50545374 GTCCCAGGCGCCTGCTGGGCTGG + Intergenic
1139510787 16:67427376-67427398 GTCCCAGGCAAAGGCTGGGAGGG + Intergenic
1141789927 16:86227448-86227470 TTCTCAGTCAGCCTCTGGGTTGG - Intergenic
1141823512 16:86463679-86463701 GCTCCAGGCAGCAGCTGGGAGGG + Intergenic
1142513307 17:411192-411214 GTCCAAGGCTGCCCCTTGGTGGG - Intronic
1144058265 17:11559910-11559932 GGCCAGGGCACCCGCTGGGTTGG + Exonic
1145260586 17:21352279-21352301 GTGCCGGGCAGCGGCTGGGTGGG - Intergenic
1145282062 17:21475398-21475420 GTCACCAGCAGCCTCTGGGTAGG - Intergenic
1146886706 17:36475664-36475686 GTCCCAGGCAGCATCTAGGGTGG + Intergenic
1147316875 17:39625271-39625293 GGCCCGGACAGCCACTGGGTGGG - Intergenic
1147399957 17:40174766-40174788 CTCCCAGCCTGCCTCTGGGTGGG + Intergenic
1147739289 17:42661386-42661408 GTCCCAGATAGCCACTGGATGGG + Intronic
1148550716 17:48549430-48549452 GTCCCAGGCAGGGGCTGGGCAGG - Exonic
1150529351 17:65960072-65960094 GTCCCAAGCACACACTGGGTGGG - Intronic
1150570783 17:66385147-66385169 GTCCCTGGCAGGCACTGTGTGGG + Intronic
1151832792 17:76565186-76565208 GTGCAAGGCAGCAGCTGGGGGGG - Intronic
1152460597 17:80440065-80440087 GGCCCAGGCAACCCCAGGGTAGG - Intergenic
1152633444 17:81420866-81420888 GCCCCAGGCAGGCTCTGTGTGGG + Intronic
1154133687 18:11757998-11758020 GAGCCAGGCAGCAGCTGGGAAGG + Intronic
1154310201 18:13261421-13261443 GTCCCAGGCAGGCACTGTGCTGG - Intronic
1157332903 18:46716461-46716483 GGCCCAGGCTGCCTGTGGGTGGG - Intronic
1157625247 18:49045530-49045552 GTGCCAGGCAGGCACTGTGTGGG + Intronic
1157770216 18:50339133-50339155 GACCAAGGCAGCTGCTGGGCGGG - Intergenic
1160236062 18:77087747-77087769 CTTCCAGGCAGGCGCTGGGATGG + Intronic
1160450894 18:78965385-78965407 GTCCCAGGCAGGGGGTGGGCGGG - Intergenic
1160811607 19:1015271-1015293 GTCCCAAGCATCCCCTGGGCAGG - Intronic
1161260809 19:3336864-3336886 TTCCCAGGCAGCCGTGGGGGCGG - Intergenic
1161373247 19:3925391-3925413 GTCCCAGCCTGACGCTGGGTTGG - Exonic
1161864353 19:6822525-6822547 GCGCCCGGCAGGCGCTGGGTGGG - Intronic
1162127441 19:8506993-8507015 GTCCCAGGCAGCCATGGGCTCGG + Intergenic
1163696794 19:18768353-18768375 ATCACAGGCAGCCCCTGGGCTGG - Intronic
1165860634 19:38907440-38907462 GGCCCAGGCAGCCGATGTGCTGG + Exonic
1165916717 19:39265216-39265238 GCCCCTGGCAGCCGCGGGGAGGG + Intergenic
1166076122 19:40414753-40414775 TTCCGAGGCAGCAGCCGGGTGGG - Intergenic
1167118034 19:47499449-47499471 GACCCAGGGAGACCCTGGGTTGG - Intronic
1167158321 19:47752538-47752560 GTCCCAGGCACCCGCCGTGGAGG + Exonic
1167454465 19:49591285-49591307 GTCCCGGGCGGCCCCGGGGTGGG - Intergenic
925489727 2:4377761-4377783 GTTCCAGGTAGCCAGTGGGTTGG + Intergenic
928022494 2:27715704-27715726 GCGTCAGGCAGCCGCTGGGGAGG - Exonic
928178226 2:29049587-29049609 GTCCCTGTCAGCCCCAGGGTGGG - Intronic
929557830 2:42936631-42936653 GCCCCAGGCAGGGGCAGGGTGGG - Intergenic
932494617 2:72140229-72140251 GTGCCAGGCAGCGGGAGGGTGGG - Intronic
932614508 2:73223396-73223418 GTCCCAGGCAGCCCATGGTTGGG - Intronic
933644134 2:84796493-84796515 GACACAGACAGCCCCTGGGTGGG - Intronic
934144759 2:89080997-89081019 GTCCCAGGCAGAGGCTGGTGTGG - Intergenic
934224498 2:90119554-90119576 GTCCCAGGCAGAGGCTGGTGTGG + Intergenic
934655306 2:96114253-96114275 GTCCCTGGCAGGCGCTGGGATGG - Exonic
935250044 2:101253027-101253049 GTCCCGGGAAGCGGCAGGGTCGG + Exonic
936438624 2:112530481-112530503 GCCCAACGCAGCCGATGGGTTGG + Exonic
937294828 2:120803773-120803795 GTCCAGGGCAGCCCCTGGGCTGG + Intronic
937296398 2:120812312-120812334 GTCCCCAGGAGCCGCTGGATGGG + Intronic
938082092 2:128375596-128375618 GTGTCAGGCAGCAGCTGGGCTGG + Intergenic
938292199 2:130156203-130156225 ATACCAGGCGGCAGCTGGGTGGG + Intronic
938464352 2:131516766-131516788 ATACCAGGCGGCAGCTGGGTGGG - Intergenic
938539324 2:132273355-132273377 GCCTCAGCCAGCCTCTGGGTGGG + Intergenic
938769602 2:134489875-134489897 GTCCCAGGCAGCCTCTGTTGGGG + Intronic
942068904 2:172297708-172297730 TTCCCACACAGCTGCTGGGTGGG - Intergenic
942453432 2:176122504-176122526 GGTCCTGGCAGCCGCTGGGCGGG + Intergenic
946184581 2:217972674-217972696 GGACCAGGCAGCTGCTGGGCAGG - Intronic
948136355 2:235639232-235639254 TTCCCAGGGAGCAGCTGAGTAGG + Intronic
948890692 2:240905684-240905706 GCCCCTGGCAGCCCCTGGGGTGG + Intergenic
1171012592 20:21516693-21516715 GTCCAGGGCAGCCACTAGGTTGG + Intergenic
1171519295 20:25763880-25763902 GTCTCAGGCAGCAACTGTGTTGG + Intronic
1171557633 20:26092611-26092633 GTCTCAGGCAGCAACTGTGTTGG - Intergenic
1171769453 20:29311180-29311202 GCCGCAGCCAGCCTCTGGGTGGG + Intergenic
1171907096 20:30908213-30908235 GCCGCAGCCAGCCTCTGGGTGGG - Intergenic
1173657425 20:44709975-44709997 GTCCCAAGCCGACGCTGGGGAGG - Intergenic
1174483236 20:50845544-50845566 GGCCCAGGCAGCCGGGGGCTCGG + Intronic
1176236453 20:64055953-64055975 GCCCCAGGCAGCCGTGGGGTCGG - Intronic
1176412652 21:6457419-6457441 GTCCCAGGCAGGGGCGGGGCAGG - Intergenic
1176414671 21:6467683-6467705 GTCCCAGGCTGCGGCGGGGTGGG - Intergenic
1176551798 21:8226356-8226378 GCCGCAGCCAGCCTCTGGGTGGG - Intergenic
1176570707 21:8409355-8409377 GCCGCAGCCAGCCTCTGGGTGGG - Intergenic
1176578616 21:8453502-8453524 GCCGCAGCCAGCCTCTGGGTGGG - Intergenic
1179419121 21:41222007-41222029 GGCCCAGGCAGTGGCTGAGTTGG + Intronic
1179688146 21:43065741-43065763 GTCCCAGGCAGGGGCGGGGCAGG - Intronic
1179690171 21:43076005-43076027 GTCCCAGGCTGCGGCGGGGTGGG - Intronic
1179890965 21:44334911-44334933 CTCACAGGCAGCCACGGGGTAGG - Intronic
1180045337 21:45302592-45302614 GTCCCCGGCAGCCGGTGTATGGG + Intergenic
1180314877 22:11269552-11269574 GCCGCAGCCAGCCTCTGGGTGGG + Intergenic
1180340502 22:11614151-11614173 GCCGCAGCCAGCCTCTGGGTGGG - Intergenic
1180953007 22:19729197-19729219 GTGCCAGGCCACCGCTGGGGAGG - Intergenic
1181519592 22:23437394-23437416 GTCCCAGGCACACCCTGGGGCGG - Intergenic
1182028424 22:27138252-27138274 GTCCCAGGCAGCTAGGGGGTGGG + Intergenic
1182085958 22:27561367-27561389 GCCACTGGCAGCAGCTGGGTTGG - Intergenic
1182265638 22:29112959-29112981 GTCCCAGTCAGCCTCTGAGGGGG - Intronic
1182667497 22:31970528-31970550 GTTCCAGGGACCCGCTGGGGCGG - Intergenic
1183391332 22:37546998-37547020 GGCCCAGGCAGCCACAGGGCGGG - Intergenic
1184276008 22:43410258-43410280 GTCCCAGGCAGGCGGCAGGTGGG + Intergenic
1184482891 22:44758487-44758509 TTCCCAGGCAGCCGGTGAGGAGG + Intronic
1184512970 22:44943801-44943823 GTGCCAGGGTGCCGCTGGGCTGG - Intronic
1185038352 22:48490913-48490935 GACCCGGGCAGCCGCGGGATCGG + Intronic
1185411301 22:50684345-50684367 GTCCCAGGCAGACAGAGGGTGGG + Intergenic
1203256820 22_KI270733v1_random:143278-143300 GCCGCAGCCAGCCTCTGGGTGGG - Intergenic
950112935 3:10432121-10432143 GAGCCAGGCAGGCGCTGGTTTGG + Intronic
950451703 3:13069067-13069089 GCCCCAGGAAGCCACTGGGCAGG - Intronic
961352175 3:126311055-126311077 GTCCCAGGCTGGGGCTGGGGAGG + Intergenic
961749243 3:129085875-129085897 GGCCCAGGCAGGAGGTGGGTGGG + Intergenic
962804344 3:138916084-138916106 GTCCCAGGGATCCGCAGGGAGGG + Intergenic
964645742 3:158956836-158956858 GTCCCAGGCAGCAGTGGGGAGGG + Intergenic
966862502 3:184238442-184238464 GTCCCTGGCAGCCCATGGGCTGG - Exonic
968284255 3:197498971-197498993 CTCCCAGGGAGCCGCTGAGTGGG + Intergenic
968605692 4:1534293-1534315 GGCCCAGGCAGCTCCTGGGTTGG + Intergenic
969471766 4:7393228-7393250 GGCTCAGGCAGCCTCTGGATGGG + Intronic
969568477 4:7993878-7993900 GTCCCTGGCTGGCCCTGGGTGGG + Intronic
970572924 4:17400308-17400330 GCCCCAGGGAGCCTTTGGGTAGG - Intergenic
971231024 4:24800253-24800275 GTCCCTGGCCGCCGCCGGGTGGG - Exonic
973956241 4:56066216-56066238 CCCCCAGGCAGCCACTGCGTTGG + Intergenic
976078020 4:81321351-81321373 GCCCCATGCAGCTACTGGGTGGG - Intergenic
976090903 4:81456595-81456617 TTCCCAGGCAGAGCCTGGGTGGG - Intronic
977659241 4:99563702-99563724 GAACCAGGGAGCAGCTGGGTAGG + Intronic
982817534 4:159905156-159905178 GGCCATGGCAGCTGCTGGGTGGG - Intergenic
985618087 5:936622-936644 GTCACAGGGAGAGGCTGGGTTGG + Intergenic
985718287 5:1475312-1475334 TTCACAGGCAGCCGCTCAGTTGG - Intronic
989665201 5:43846177-43846199 GTCCCAGGCATCTGGGGGGTGGG + Intergenic
992272740 5:75082297-75082319 GTCCCAGGGAGGCCCTGGGTAGG + Intronic
996056539 5:118988654-118988676 GTCCCACCCTGCCGCTGGGAAGG + Intergenic
996116880 5:119629810-119629832 GTCCCAGGAAACCGCTGAGAAGG + Exonic
998398665 5:141836077-141836099 AGCCCAGGCATCCGTTGGGTGGG - Intergenic
998434435 5:142095568-142095590 TTCTTAGGCAGCTGCTGGGTTGG + Intergenic
999308246 5:150534752-150534774 CTTCCAGGCAGCTCCTGGGTGGG + Intronic
1002535628 5:179874021-179874043 GTCCCAGGCAGCACCTGGCCTGG + Intronic
1004660505 6:17706009-17706031 TTCCCAGGCAGGCTCTGGGCGGG - Intronic
1006402370 6:33825336-33825358 GTCCCAGGAAGCCCCTGAGTCGG + Intergenic
1007114734 6:39335600-39335622 CTCCCTGGCTGCAGCTGGGTTGG + Exonic
1011350998 6:86423710-86423732 TTCCCAGTCACCAGCTGGGTGGG + Intergenic
1011514495 6:88137915-88137937 GACCCAGACAGCCACTGTGTTGG - Intergenic
1013920544 6:115397039-115397061 ATCCCATGCAGCTTCTGGGTGGG + Intergenic
1019170061 6:170128865-170128887 GTCCCAGGAAGCAGGCGGGTTGG + Intergenic
1019273524 7:163979-164001 GTCCCAGGCAGCCACGAGGACGG + Intergenic
1019326019 7:438662-438684 GGCCCAGGCAGCCCTTGGGATGG + Intergenic
1019436698 7:1025890-1025912 GTCCCAGGCAGCGTCCTGGTGGG - Intronic
1019667450 7:2258966-2258988 GGCCGAGGCAGCGTCTGGGTGGG - Intronic
1019774283 7:2903192-2903214 GTCCCAGGCAGTGGCTGGCTGGG - Intergenic
1021456330 7:20832877-20832899 GTCCCAGCCAGCTACTGGGGAGG + Intergenic
1021524197 7:21568484-21568506 GTCACAGCCAGCCCCTGCGTCGG + Intronic
1024061422 7:45701799-45701821 TGCCCAGACAGCCGCTGCGTGGG + Intronic
1025025615 7:55514049-55514071 CTCCCAGTCAGACGCTGGGGTGG - Intronic
1026148713 7:67770533-67770555 CTTCCAGGCAGAGGCTGGGTAGG + Intergenic
1027188141 7:75983886-75983908 GGCTCAGGCAGCCGCGGGATTGG + Intronic
1027201123 7:76064444-76064466 GTCTCAGGCAGCCCCGGGGCTGG + Intronic
1027717284 7:81688833-81688855 GACCCAGCCAGCCACTTGGTTGG + Intergenic
1029593095 7:101520260-101520282 GCCCCAGGCAGGTGTTGGGTGGG - Intronic
1029683036 7:102125457-102125479 GTCCCTGGCCGCCGCTGGGAGGG + Intronic
1032838757 7:135697499-135697521 GTCCAGGGCAGCCGGTGGCTTGG - Intronic
1034450523 7:151134854-151134876 ATCCGAGGCAGGCGATGGGTGGG + Intronic
1034931673 7:155168230-155168252 GTCCAGGTGAGCCGCTGGGTGGG - Intergenic
1035227251 7:157440522-157440544 GGCCCAGGCAGGCTCTGGCTGGG - Intergenic
1037988852 8:23306490-23306512 GTGCCAGGCAGCCCCTTGGCAGG + Intronic
1042690194 8:71489916-71489938 GGCTCAGGCAGCAGCTGGGCAGG - Intronic
1047779498 8:128099958-128099980 TCCCCAGCCAGCCGCAGGGTGGG + Intergenic
1049223913 8:141440667-141440689 GGCCTAGGCAGCTGGTGGGTGGG + Intergenic
1053130097 9:35609710-35609732 GCCCCAGGCAGCTGCAGGCTGGG - Exonic
1057442532 9:95092357-95092379 GACCCTGGCAGTCGCTGAGTGGG + Intergenic
1058288230 9:103206389-103206411 GTGCAAGGCAGCAGCTGGGGGGG - Intergenic
1059723872 9:116987081-116987103 GTGTCAGGCATCCACTGGGTGGG - Intronic
1061014870 9:127975811-127975833 GTCCAAGGCAGCCCTTGGGCAGG - Intronic
1061903111 9:133683156-133683178 GACCCAGGCAGCCACTGCCTAGG + Intronic
1062015284 9:134288168-134288190 GGGCCAGGCTGCGGCTGGGTAGG + Intergenic
1062033999 9:134374644-134374666 TCCCCAGGCAGCCGCTGGCCTGG - Intronic
1062525003 9:136974639-136974661 ATCCCAGGCTGCAGGTGGGTGGG + Intergenic
1203472977 Un_GL000220v1:124960-124982 GCCGCAGCCAGCCTCTGGGTGGG - Intergenic
1185893247 X:3838173-3838195 GTACCAGGCATGCGCTGGGGCGG - Intronic
1185898359 X:3876595-3876617 GTACCAGGCATGCGCTGGGGCGG - Intergenic
1185903474 X:3915024-3915046 GTACCAGGCATGCGCTGGGGCGG - Intergenic
1187622944 X:21078885-21078907 CTCCCAAGCAGCTGCTGGGCTGG + Intergenic
1190391412 X:49935408-49935430 GTGCCAGGCAGGCACTGTGTTGG + Intronic
1192360375 X:70435132-70435154 GTCAGAGGCTGGCGCTGGGTTGG - Intergenic
1195200739 X:102547806-102547828 TTCACAGGCAGGCGCTTGGTTGG + Intergenic
1197481039 X:126986159-126986181 GATCCCGGCAGCTGCTGGGTGGG + Intergenic
1200001213 X:153060703-153060725 GGCCCAGGCAGTGGCTGGTTGGG + Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic