ID: 1132800061

View in Genome Browser
Species Human (GRCh38)
Location 16:1747613-1747635
Sequence CTCCAAATACAGTCATGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 918
Summary {0: 2, 1: 1, 2: 26, 3: 202, 4: 687}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132800053_1132800061 14 Left 1132800053 16:1747576-1747598 CCTCATTTTACCATAATCACCTC 0: 3
1: 26
2: 237
3: 811
4: 1957
Right 1132800061 16:1747613-1747635 CTCCAAATACAGTCATGCTAGGG 0: 2
1: 1
2: 26
3: 202
4: 687
1132800056_1132800061 -5 Left 1132800056 16:1747595-1747617 CCTCTTGAAAGGCCCAGCCTCCA 0: 1
1: 0
2: 16
3: 122
4: 630
Right 1132800061 16:1747613-1747635 CTCCAAATACAGTCATGCTAGGG 0: 2
1: 1
2: 26
3: 202
4: 687
1132800051_1132800061 25 Left 1132800051 16:1747565-1747587 CCACCACGTGACCTCATTTTACC 0: 1
1: 0
2: 2
3: 40
4: 207
Right 1132800061 16:1747613-1747635 CTCCAAATACAGTCATGCTAGGG 0: 2
1: 1
2: 26
3: 202
4: 687
1132800055_1132800061 4 Left 1132800055 16:1747586-1747608 CCATAATCACCTCTTGAAAGGCC 0: 1
1: 16
2: 150
3: 394
4: 1084
Right 1132800061 16:1747613-1747635 CTCCAAATACAGTCATGCTAGGG 0: 2
1: 1
2: 26
3: 202
4: 687
1132800052_1132800061 22 Left 1132800052 16:1747568-1747590 CCACGTGACCTCATTTTACCATA 0: 1
1: 4
2: 32
3: 244
4: 864
Right 1132800061 16:1747613-1747635 CTCCAAATACAGTCATGCTAGGG 0: 2
1: 1
2: 26
3: 202
4: 687

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132800061 Original CRISPR CTCCAAATACAGTCATGCTA GGG Intronic
900798919 1:4725929-4725951 CTCCAAATACAGTCACATTAGGG + Intronic
900800482 1:4734125-4734147 ATCCAAATACAGACCTGCCAGGG + Intronic
901733468 1:11297188-11297210 CTCCTAATACAATCATGTTGGGG - Intergenic
901863023 1:12086897-12086919 CTCCAAATACAGTCACACTGGGG + Intronic
902445890 1:16463994-16464016 CTCCAAATACCATCATACTAGGG + Intergenic
902703299 1:18187731-18187753 CTCCAAATACTGTCACATTAGGG + Intronic
903171466 1:21557117-21557139 CTCCAGATACAGAAATGCTGGGG - Intronic
904352301 1:29916471-29916493 CTCCAAATACAGTCACACTGGGG + Intergenic
904434675 1:30486626-30486648 CTCCAAATACAGTAACACTGGGG - Intergenic
904891550 1:33783301-33783323 CTTCAAATACAGTCACACTGGGG - Intronic
904971288 1:34421276-34421298 CTCCAAATACAGTCATATTGGGG - Intergenic
905749182 1:40447242-40447264 CTCCAAATACAGTCACTTTAGGG - Intergenic
907383172 1:54108345-54108367 CTCCAAATACAGTCACATTCTGG - Intronic
907620878 1:55978274-55978296 CTCCAAATACAGTCACATTAAGG - Intergenic
907756280 1:57313797-57313819 CTCCAAATTCCATCATCCTAGGG - Intronic
907783649 1:57590658-57590680 CTTCAAATACAGTCATGCTGGGG + Intronic
907888016 1:58611781-58611803 CTCCAAATCCAATCAAGCTTTGG + Intergenic
908078018 1:60542539-60542561 CTCCAAATACAGTCACATCAGGG + Intergenic
908271692 1:62428794-62428816 CTCCAAATACTATCATACTGCGG - Intergenic
909471484 1:76033845-76033867 CTCCAAATAGAGTCATATTGAGG - Intergenic
909728024 1:78859143-78859165 TACCAACTATAGTCATGCTATGG - Intergenic
909870051 1:80728063-80728085 CTCCAAATACAGTCACATTAGGG + Intergenic
910059995 1:83079183-83079205 CTCCAGATACAGTCACACTGGGG - Intergenic
910349163 1:86276744-86276766 CTCCAAGTCCAGTAATGCTATGG + Intergenic
910454989 1:87387993-87388015 CTCCAAATATAGTTATACTGGGG + Intergenic
911293239 1:96082873-96082895 CTCCAAATACAGACATTCTGAGG - Intergenic
911743850 1:101417492-101417514 CTCCAAATATAATCATACTGCGG - Intergenic
911774300 1:101788091-101788113 CTTCAAATACAGTCACAATAGGG - Intergenic
912600727 1:110930641-110930663 CTCCAAATACAGTTATACTGGGG + Intergenic
912633435 1:111269245-111269267 CTCCAAATACAGTCACACTGTGG - Intergenic
913291931 1:117281538-117281560 CTCCAAATACAATCATCCCTTGG + Intergenic
913339053 1:117738968-117738990 CTCCAAATACAGTCACATTGGGG + Intergenic
913458685 1:119060490-119060512 CTCTATATACAGTCATACTGGGG + Intronic
913530856 1:119733285-119733307 CTTCAAATTCAGTAATTCTAGGG - Intronic
913969611 1:143404790-143404812 CTCCAAATTCAGGCATACCATGG - Intergenic
913999847 1:143684248-143684270 CTCTAAATACAGTCAAGTTGGGG - Intergenic
916451465 1:164924409-164924431 CTCCAAATATAGTCACACTGGGG + Intergenic
917685932 1:177416152-177416174 CTCCAAATACCATCACGCTGGGG - Intergenic
917864172 1:179177402-179177424 CTCCAACTACAGTCATCCTCAGG + Intronic
918192965 1:182193576-182193598 CTCCAAATACAGTCACATTGGGG + Intergenic
918381924 1:183964551-183964573 CTCCAAATCCATGCCTGCTAAGG - Intronic
919067897 1:192715479-192715501 CTCAAAGTCCAGTAATGCTATGG - Intergenic
919301307 1:195770247-195770269 CTCCAAATACAATCATTCTGAGG - Intergenic
919307707 1:195864263-195864285 CTCCAAATATAGTCATTATAAGG - Intergenic
920839372 1:209541073-209541095 TTCCAAATCCAGGCAGGCTATGG - Intergenic
921253313 1:213317558-213317580 CTCCAAATACAATCACATTAGGG + Intergenic
921314960 1:213881771-213881793 CTCCAAATACAGCCACACTGGGG - Intergenic
921337329 1:214101294-214101316 CTCCAAATACAGTCACACCAGGG + Intergenic
921441902 1:215197586-215197608 CTCCAAATGCAGTCACACTGGGG + Intronic
921483328 1:215688797-215688819 CTCCAAATACAGTCACCTTGGGG + Intronic
921739344 1:218666153-218666175 CTCCAAATACAATCACACTGGGG - Intergenic
922194690 1:223349899-223349921 CTCCAAATAGAGTCATATTGGGG - Intronic
922441436 1:225658330-225658352 CTCCAAAACCATTCAGGCTATGG - Intergenic
922949283 1:229544698-229544720 CTCCAAATACAGCCATGGTGGGG - Intronic
923026584 1:230209282-230209304 CTCCAAATACAGTCACTCTGGGG - Intronic
923181407 1:231523428-231523450 CTCCACATATAGTCACACTAAGG + Intergenic
923681697 1:236123839-236123861 CTCCAAATACAGTCACATTCTGG - Intergenic
923748359 1:236724315-236724337 CTCCAAATACAGGCACATTAGGG + Intronic
1062895260 10:1098141-1098163 CTCCAAATACAGCCACACTGGGG - Intronic
1063208513 10:3857366-3857388 CTCCAAATACAGTCACATTTGGG - Intergenic
1063210868 10:3880186-3880208 CTCCAAATACAGCCACACTGGGG + Intergenic
1063388203 10:5630273-5630295 CTCCAAATACAGTCACATTGAGG - Intergenic
1063659845 10:8027370-8027392 CTCCAATTTGAGTCATTCTATGG - Intergenic
1063796234 10:9516845-9516867 CTCCAAATACAGTCACGTTGAGG - Intergenic
1063997603 10:11635107-11635129 CTCCAAAAACAGTCATACTGAGG + Intergenic
1064168044 10:13003018-13003040 TTCCAAATACAGTCACATTAGGG + Intronic
1064513882 10:16125074-16125096 TTCCAAATACAGTCAAATTAGGG + Intergenic
1064985337 10:21204304-21204326 CTCCAAATACCGTCACACTGGGG - Intergenic
1065437109 10:25714179-25714201 GTCAAAATACAGTCATCCTCTGG - Intergenic
1065500391 10:26375853-26375875 CTCCAAATATAGTCATACTAGGG - Intergenic
1065871349 10:29959021-29959043 CTCCAAATACCATCATACTGTGG - Intergenic
1065893914 10:30144640-30144662 ATCCAAATACAGTCACACTGAGG - Intergenic
1065920449 10:30388130-30388152 CTCCAAATACAGCCACACAAAGG + Intergenic
1065921971 10:30400589-30400611 CTCCAAGCCCAGTGATGCTATGG - Intergenic
1066117080 10:32249988-32250010 CTCCAAATACAGTCACACTGGGG + Intergenic
1066383700 10:34922965-34922987 CTCCAAATATAGTCATGCCAGGG + Intergenic
1067171823 10:43913025-43913047 CTCCAAATACTATCACACTAGGG - Intergenic
1067174541 10:43934291-43934313 CTCCAAATATAGTCACACTGGGG + Intergenic
1067364279 10:45610613-45610635 CTCCAAATACAGCCATGCATGGG - Intergenic
1067364525 10:45612756-45612778 CTCCAAATACAGCCACACTAGGG - Intergenic
1068141889 10:53019505-53019527 ATCCTAATACAGTACTGCTATGG + Intergenic
1068159975 10:53251282-53251304 CTCCTAATACAATCATGTTGGGG - Intergenic
1068789439 10:61010939-61010961 CTCCAAATACAGTCATATTTGGG - Intergenic
1068828425 10:61465889-61465911 CTCCAAATACAGTCAAGTTGTGG - Intergenic
1068939796 10:62669610-62669632 CTCCAAATACAGTCATATTGGGG + Intronic
1069576893 10:69537077-69537099 CTCCAAATACAGTCACATTAGGG + Intergenic
1070084277 10:73220610-73220632 CTCCAAATACAGTCACTTTGGGG - Intronic
1070707725 10:78653471-78653493 CTCCAAATACAGCCACACTGGGG - Intergenic
1071260093 10:83911960-83911982 CTCCAAATACAGTCACATTGGGG + Intergenic
1072192903 10:93090590-93090612 CTCCAAATACAGTCACATTGGGG + Intergenic
1072597649 10:96889654-96889676 CTCCAAATACAGCCACACTGGGG + Intronic
1072758021 10:98033438-98033460 CTCCAAATGCAGTCACACTAAGG - Intergenic
1074011960 10:109491200-109491222 CTCCAAATATAGTCACACTGGGG - Intergenic
1074331433 10:112514853-112514875 CTCCATATACAGGCATGAAAAGG - Intronic
1074817514 10:117153789-117153811 CTCTAAATACAGTCATATTGGGG + Intergenic
1074836453 10:117300676-117300698 CTCCTAATACAATCATGTTAGGG - Intronic
1074999514 10:118784813-118784835 GTCCAAATACAGTCACACTGGGG + Intergenic
1075072847 10:119330494-119330516 CTCCAAATAACGTCACGCTGGGG + Intronic
1075260239 10:120957207-120957229 CTCCAAATACCATCATGTTGGGG + Intergenic
1075341473 10:121649812-121649834 CTCCAAATACAGTCACTTTGGGG + Intergenic
1075389247 10:122080627-122080649 CTCCAAATACAGTCACATTGGGG + Intronic
1075538978 10:123296391-123296413 CTCCAAATACAGCCACACTGGGG - Intergenic
1075571044 10:123545907-123545929 CTCCAAATATAGTTATATTAGGG + Intergenic
1075708340 10:124516390-124516412 CTCCAAATACAGTCACGCTGCGG + Intronic
1075820257 10:125301940-125301962 CTCCAAATACAGTCACGTTGTGG - Intergenic
1075832984 10:125427287-125427309 CTCCAAATACAGTCACATTGGGG + Intergenic
1075947874 10:126453873-126453895 CTCCAAAAACACTCATGATCAGG - Intronic
1076182157 10:128418696-128418718 CTCCAAATACATTCATGAGATGG - Intergenic
1076906043 10:133361638-133361660 CTCCTAATGCAGTCACGGTAGGG + Intergenic
1076935191 10:133564110-133564132 CTCCTAATGCAGTCACACTAGGG - Intronic
1077128713 11:958057-958079 CTCCAAATCCAGTCACACTGGGG - Intronic
1078108707 11:8374664-8374686 CTCCAGATACAGTCACACTGGGG + Intergenic
1078269644 11:9783341-9783363 CTCCAAATACAGTCTTCATTTGG + Intronic
1078397564 11:10994783-10994805 CTCCAAATACAGTCACATTAGGG - Intergenic
1078555879 11:12325758-12325780 CTCCAAATATAGTCACACTGGGG + Intronic
1078592659 11:12658365-12658387 CTCCAAAAACAGTCAAGTTAAGG + Intergenic
1079142906 11:17824829-17824851 CTCCAAATACAGTCACATTGGGG + Intronic
1079532981 11:21477468-21477490 CTCTAAACCCAGTAATGCTATGG - Intronic
1079570706 11:21940402-21940424 CTCCAAATACAGCCACGTTGTGG - Intergenic
1079699734 11:23529803-23529825 CTCCAAATACAGTCACATTGGGG + Intergenic
1080000803 11:27346775-27346797 CTCCAAATACAGTCACATTGAGG - Intronic
1080252158 11:30245607-30245629 CTCCAAATACAGTCACATTGGGG + Intergenic
1080310559 11:30886679-30886701 CTCCAAATATAGTCACACTGGGG + Intronic
1080856942 11:36120778-36120800 CTCCTAATACAATCATACTGGGG - Intronic
1081268923 11:41060640-41060662 CTCCAAATACAGCCATACTGGGG + Intronic
1081417757 11:42836154-42836176 CTCCAAAAACAGTCACACTGGGG + Intergenic
1081431637 11:42982926-42982948 ATCCAAATTCAGTCATGGAATGG + Intergenic
1081803998 11:45880031-45880053 CTCCAAATACAGTCACCTTCTGG + Intronic
1082759918 11:57117410-57117432 CTCCAAATAAAGTCACACTGGGG + Intergenic
1082860132 11:57847727-57847749 CTCCAAATACCATTATGCTGGGG + Intergenic
1082954327 11:58852788-58852810 CTCCAAATACAGTCACATTGGGG + Intronic
1083974697 11:66108392-66108414 CTCCAAATGCAGTCACTTTAGGG + Intronic
1084699708 11:70778466-70778488 CTCCAAATCCAGTCACACTGAGG - Intronic
1085536814 11:77226304-77226326 CTCCAAATACAGTCACACTGAGG - Intronic
1085574791 11:77592407-77592429 CTGCAAAAAGAGTTATGCTATGG + Intronic
1085598121 11:77829064-77829086 CTCTAAATACAGTCACATTAGGG - Intronic
1085712687 11:78844245-78844267 CTCCAAATACAGTCACATTGGGG - Intronic
1086219790 11:84428694-84428716 CTCCAAATACAGTCACACTGAGG + Intronic
1086865259 11:91972340-91972362 CTCCAAATACCATCACACTAGGG + Intergenic
1086894303 11:92294317-92294339 CTCCAAATATAGCCACGCTGAGG + Intergenic
1086925397 11:92634800-92634822 CTCCAAATACAGCCACACTGGGG - Intronic
1087215474 11:95488517-95488539 CTCCAAATACAGTCACATTAGGG - Intergenic
1088285245 11:108181114-108181136 CTGCAAATACAGTCCTGTTGAGG - Intronic
1088850195 11:113697928-113697950 CTCCAAATACAGTCACATTGAGG - Intronic
1089127829 11:116189925-116189947 CTCCAAATAAAATCAGGCCAGGG - Intergenic
1089672198 11:120064269-120064291 CTCCAAATGCAATCATACTGGGG - Intergenic
1089860673 11:121587541-121587563 CTCCAAATACAGTCAAATTGGGG + Intronic
1089900640 11:121979942-121979964 CTCCAATTACAGTCACATTAGGG + Intergenic
1090087993 11:123668028-123668050 CTCCAACTACAGTCCTCCTAAGG - Intergenic
1090181472 11:124704007-124704029 CTCCAAATACCATCATATTAGGG - Intergenic
1090318960 11:125824185-125824207 CACCAAGTACAGTCATGTTGGGG + Intergenic
1090601713 11:128379174-128379196 CTCCAAATACAGCCATGCTTAGG + Intergenic
1091057624 11:132433627-132433649 CTCCAAATACAGACATACTGGGG - Intronic
1091509829 12:1111050-1111072 CTCCAAATACAGTTCTGTAACGG + Intronic
1091977733 12:4838921-4838943 CTTCAAATACAGGCATCCTGAGG + Intronic
1092484094 12:8886812-8886834 CTCCAAATACAGTCACATTGGGG + Intronic
1092495285 12:8987230-8987252 CTCCAAATACAGTCACACTGAGG - Intronic
1093123023 12:15295490-15295512 CTCCAAGTCCAGTAATGCTGCGG - Intronic
1093197318 12:16144517-16144539 CTCCAAATACAATGATGTTATGG - Intergenic
1093412125 12:18879502-18879524 CTCCAAATACAGTCACACTCTGG + Intergenic
1093997225 12:25655319-25655341 CTCCAAATACAGTCGCACTGTGG + Intergenic
1094787238 12:33863108-33863130 CTCCAAGTGCAATAATGCTATGG + Intergenic
1095326149 12:40895646-40895668 CTTTAAATACTGTCATGTTAGGG + Intronic
1096120313 12:49084721-49084743 CTCCAAATACAGACACAGTAGGG + Intergenic
1097133790 12:56834914-56834936 CTCCAAATCCAGTCAGGTAATGG - Intergenic
1097669359 12:62517462-62517484 ATCCAAATACTGTCATGTTGGGG - Intronic
1097890956 12:64777456-64777478 CACCAACAACAGTCATGCCAAGG + Intergenic
1098008129 12:66020853-66020875 CTCCCAATATAGTCACGTTAGGG - Intergenic
1098547393 12:71726959-71726981 CTCCAAATATAGTCACATTAGGG - Intergenic
1098587347 12:72169806-72169828 CTCCAAATATAGTCATTCTTGGG + Intronic
1098954262 12:76672058-76672080 CTCCAAATACAGTCACACTGAGG - Intergenic
1099084280 12:78225757-78225779 CTCCAAATACAGTTATATTGGGG - Intergenic
1099279776 12:80629298-80629320 CTCCAAATACAGCCACACTGGGG + Intronic
1099381988 12:81966122-81966144 CTCCAAGTACATTCATGTTGTGG - Intergenic
1099673878 12:85731747-85731769 CTCCAAATACATTCACACTGGGG + Intergenic
1099787844 12:87289074-87289096 CTCCAAATACAGTCACATTAGGG - Intergenic
1100099107 12:91080766-91080788 CTCCAAATAAAGTCATTCTGAGG + Intergenic
1100130356 12:91485070-91485092 CTCCAAATACTGTGTTACTAGGG + Intergenic
1100594863 12:96062997-96063019 CTCCAAGTACAGTCAAACCAGGG + Intergenic
1100629388 12:96372341-96372363 CTCAAAATAGAGTCTTCCTAGGG + Intronic
1101558259 12:105831124-105831146 CTCCAAATACAGACACACTGGGG - Intergenic
1101579028 12:106025172-106025194 CTCCAAATACAGTCACATTGGGG - Intergenic
1101638347 12:106566322-106566344 CTCCAAATACAGTCACACTGGGG - Intronic
1102444023 12:112987496-112987518 CTCCAAAGACAATCAGGGTATGG - Intronic
1103156729 12:118691767-118691789 CTCCAAATACAGTCACAGTGGGG + Intergenic
1103259358 12:119573135-119573157 CTCCAAATACAGTCACATTCTGG + Intergenic
1104285904 12:127424495-127424517 CTCCAAATACAGTCACATTGGGG - Intergenic
1104410099 12:128550697-128550719 CTCCAAATATAGTCACACTGGGG + Intronic
1104634944 12:130432512-130432534 CTCCAAATAAAGTCACACTGGGG - Intronic
1104649730 12:130522824-130522846 CTCCAAATAGAGTCACCCTGGGG - Intronic
1105991597 13:25627420-25627442 CTCCAAATACAGCCACACTGGGG - Intronic
1106110629 13:26773465-26773487 CTCCAAATACAGCCATACTGAGG + Intergenic
1106501392 13:30332361-30332383 CTCCAAATACAGTCACCTTGGGG - Intergenic
1106512962 13:30427256-30427278 ATACAAATACACTCATGCAAAGG - Intergenic
1106593143 13:31114971-31114993 CTCCAAATACTGTCACACTGGGG + Intergenic
1106965740 13:35064635-35064657 CTCCAAAAACAGTCAGATTACGG - Intronic
1107146271 13:37063708-37063730 CTCCAAATACAGTGACACTGGGG + Intergenic
1107149475 13:37095156-37095178 CTCCAAATACAGTCACATTGGGG + Intergenic
1107157460 13:37186100-37186122 CTCCAAATACCATCATGCTGGGG + Intergenic
1107410574 13:40154220-40154242 CTCCAAATACAGTCATATTGGGG + Intergenic
1107939940 13:45374517-45374539 CTCCAAATACCATCATACTGGGG + Intergenic
1108086545 13:46799102-46799124 CTCCAAATACCATCACGTTAAGG + Intergenic
1108199955 13:48032948-48032970 CTCCAAATACCATCATTTTAGGG + Intergenic
1108477823 13:50838717-50838739 CTCCAAATACAGTCACATTGGGG - Intronic
1110357498 13:74584723-74584745 CTCCAAATATAGTCACATTAGGG + Intergenic
1110503149 13:76252860-76252882 CTCCAAATACAGTCACATTGGGG + Intergenic
1110727599 13:78843284-78843306 CTCCAAATACAGTCATATTAGGG + Intergenic
1111633844 13:90877823-90877845 ATCCAAATACAGTTATTCTTGGG - Intergenic
1111845280 13:93499913-93499935 CTCCACAGACACTCATCCTAAGG - Intronic
1111900832 13:94197645-94197667 CTCCAAATACAGTCAGATTGAGG + Intronic
1111953015 13:94725255-94725277 CTCCAAATATAGCCACTCTAGGG - Intergenic
1113089144 13:106598690-106598712 CTTCAAATACAGTCACACTCAGG - Intergenic
1113405057 13:110031352-110031374 CTCCAAATGCAGCCACGCCAGGG + Intergenic
1113816660 13:113176368-113176390 CTCCAGATACAGTCACACTGGGG - Intergenic
1114244708 14:20901742-20901764 CTCCAAATACAGTGACACTGGGG + Intergenic
1114247706 14:20929885-20929907 CTCCAAATACAGTGAGACTGGGG + Intergenic
1114766517 14:25377378-25377400 CTCCAAATGCAGTCACGTTGGGG + Intergenic
1114861810 14:26532044-26532066 CACAAAGTACAGTCATGGTAAGG + Intronic
1115166489 14:30453755-30453777 CTCTAAATACAGTCACACTGTGG + Intergenic
1115342500 14:32307571-32307593 CTCCAAATACAGTTATATTGGGG + Intergenic
1116429423 14:44828791-44828813 TTCCAAATACCGTCATATTAGGG - Intergenic
1117211455 14:53504995-53505017 CTCCAAATACAGTCACATTGAGG + Intergenic
1117294207 14:54364352-54364374 CTCCATATACAGTCATCCCTTGG + Intergenic
1117508768 14:56428016-56428038 CTCCAAATACAGTCACATCAGGG - Intergenic
1117901557 14:60538999-60539021 TTCCAAATAAAGTCACACTAGGG + Intergenic
1118085591 14:62412389-62412411 CTCCAAAGACAATCAAACTAGGG - Intergenic
1118501032 14:66362882-66362904 CTCCAAATAAAGTCATATTCTGG + Intergenic
1118628497 14:67681048-67681070 CTCTAAATACAGTCACACTGGGG - Intronic
1119340928 14:73876854-73876876 CTCCAAATAAAGTCACACTGGGG + Intronic
1120024828 14:79571002-79571024 CTCCAAATTCAGCCATATTAGGG + Intronic
1120051133 14:79867589-79867611 CTCCCAATACAGTCATGTTTGGG + Intronic
1120126554 14:80750863-80750885 CTCCAAATACAGTCACACTTGGG - Intronic
1120468747 14:84895772-84895794 CTCCAAATACAGTCACATTGGGG + Intergenic
1120483573 14:85082907-85082929 CTCCAAATACAGTCACCTTCTGG + Intergenic
1120710621 14:87789486-87789508 CTCCAAATACAGTCACGTTGCGG + Intergenic
1120824569 14:88943793-88943815 CTCCAAATACTATCATGTTGGGG + Intergenic
1122676875 14:103422897-103422919 CACCAAATACAGTCACACTGGGG - Intronic
1124880534 15:33638372-33638394 CTCCAAAGAAAGTCATTCTCTGG + Intronic
1125049472 15:35279846-35279868 CTCCAAATACAGTCACGTTGAGG - Intronic
1125120691 15:36155362-36155384 CTCCAAATACAGTCACAATGGGG + Intergenic
1125147062 15:36483420-36483442 ATCCAAATTCAGTCATGCACTGG + Intergenic
1125575238 15:40750885-40750907 CTCCAAGTCTGGTCATGCTAAGG - Intronic
1125885219 15:43224313-43224335 CTCCAAATACAGTCACATTGGGG + Intergenic
1126789323 15:52206431-52206453 CTCCAAATACAGCCACACTAGGG - Intronic
1126915534 15:53461934-53461956 CTGCAAATACAGTCACATTAGGG + Intergenic
1127484064 15:59403257-59403279 CTCCAAATACAGTCATATTGGGG - Intronic
1127571790 15:60250762-60250784 CTCCAAACACAGTCACATTAAGG + Intergenic
1128364614 15:66988928-66988950 CTCCAAACCCAGTAATGCTGTGG - Intergenic
1128672508 15:69585209-69585231 CTCCAATTACAGTCACACTGGGG - Intergenic
1128877143 15:71211582-71211604 CTCCAAATACAATCATACTGAGG + Intronic
1129209746 15:74060895-74060917 CTCCAAGCCCAGTTATGCTATGG - Intergenic
1129405205 15:75312422-75312444 CTCCAAATACAGCCATGCAGAGG - Intergenic
1129477314 15:75794868-75794890 CTCCAAGCCCAGTTATGCTATGG + Intergenic
1129654378 15:77514080-77514102 CTCCAAATACAGACACATTAGGG + Intergenic
1129703342 15:77780648-77780670 CTCCAAATACAGTCTCACTGGGG - Intronic
1129835379 15:78702166-78702188 CTCCAAGCCCAGTTATGCTATGG + Intronic
1129836985 15:78714864-78714886 CTGCAAATACAGCCATGCAGAGG - Intronic
1130162841 15:81418810-81418832 CTCCAAATACAGTCATATTGTGG - Intergenic
1130439700 15:83940575-83940597 CTCTAAATACCATCATGCTGGGG + Intronic
1130511936 15:84596405-84596427 CGCCAAACCCAGTAATGCTATGG - Intergenic
1130699208 15:86162250-86162272 CTCCAAATGCTAGCATGCTATGG + Intronic
1130793749 15:87186760-87186782 CTCCAAATACAGCCACACTGAGG - Intergenic
1131345804 15:91647119-91647141 CTCCAAATACAGCCACACTGCGG - Intergenic
1131539415 15:93263609-93263631 CTCCAAATACAGTCTTATTAGGG + Intergenic
1132800061 16:1747613-1747635 CTCCAAATACAGTCATGCTAGGG + Intronic
1133530131 16:6647605-6647627 CTCCAAATACAGCCACACTGAGG + Intronic
1133694665 16:8250455-8250477 CTCCAAATACAGTCACATTCTGG + Intergenic
1135253206 16:20918558-20918580 CTCCAAATTCAGTCATTCACGGG - Intronic
1135279666 16:21143260-21143282 CTCCAAATACCATCATGCTGGGG - Intronic
1135459473 16:22628907-22628929 ATCCAAATACAGTCAAACTGGGG - Intergenic
1136623887 16:31449678-31449700 CTTCAAATACAGTCACACTGGGG - Intergenic
1137527678 16:49250438-49250460 CTCCAAATACAGTCACGTTGGGG - Intergenic
1138142624 16:54581950-54581972 CTCCAAATACAATCATATTAGGG + Intergenic
1138231173 16:55337559-55337581 CTCCAAATACAGTCACATTAGGG + Intergenic
1138272647 16:55707081-55707103 ATGCAAATACATTCATGCCAAGG + Intergenic
1138854358 16:60670405-60670427 CTCCAAATACAGTCACATTGAGG + Intergenic
1139093562 16:63677977-63677999 TTCCAAATACAGTAATGTTTTGG - Intergenic
1139974323 16:70796829-70796851 CTCCAAATCCAGTCACACTGTGG - Intronic
1140710156 16:77670273-77670295 CTCCAAATACAGTCACAGTGGGG - Intergenic
1140764662 16:78145852-78145874 CTCCAGATGCAGTCATGTTGGGG + Intronic
1141017896 16:80467468-80467490 CTCCAAATACCATCATACTGGGG - Intergenic
1141023736 16:80523210-80523232 CTCCAAATCCAGTCACACTGGGG + Intergenic
1141222968 16:82089058-82089080 CTCCAAATACCATCACACTAGGG + Intronic
1142497120 17:311907-311929 CTCCAAATACAGTCACTCTGGGG - Intronic
1144105571 17:11981911-11981933 CTCCAAATACCATCATACTGGGG - Intronic
1144287976 17:13798102-13798124 CTCCAAATGCAGTCACACTGGGG - Intergenic
1144552183 17:16250443-16250465 CTCCAAATACAGTCACATTTTGG + Intronic
1145409522 17:22645970-22645992 CTCCAAATAGAGTCACACCAGGG - Intergenic
1146280424 17:31540998-31541020 CTCCAAATACAGTCACACTGGGG + Intergenic
1146297246 17:31659512-31659534 TTCCAAATACAGTCACATTAAGG + Intergenic
1148380870 17:47196094-47196116 GTCCAAATACAGCCACACTAGGG - Intergenic
1148478422 17:47944359-47944381 CTCCAAATACAGTCACATTGGGG + Intronic
1148676587 17:49449077-49449099 CTCCAAATACAGTCCCACTGTGG - Intronic
1149124622 17:53213251-53213273 CTCCAACTACATTCTTGCAAAGG + Intergenic
1149284797 17:55150470-55150492 CTCCAAATACAGCCACGCTGGGG + Intronic
1149357212 17:55852800-55852822 CTCCAGATACTATCATACTAGGG - Intergenic
1149503931 17:57177337-57177359 CTCCAAATACAGCCACGCTGAGG - Intergenic
1149621951 17:58052195-58052217 CTCCAAATAGAGCCATACTATGG + Intergenic
1149766625 17:59284277-59284299 CTTCAAATACAGTCACACTGGGG + Intergenic
1150043862 17:61891966-61891988 CTCTAAATACAGATATGGTAGGG - Intronic
1150163484 17:62919163-62919185 CTCCAAATACTGTCACGTTGGGG + Intergenic
1150457607 17:65320103-65320125 CTTCAAATACAGTCACATTAGGG + Intergenic
1150511463 17:65756937-65756959 CTCCAAATACAGTCAAATTGGGG - Intronic
1151331538 17:73412522-73412544 CTCCAAATACAGTCACATTCTGG - Intronic
1151861799 17:76769484-76769506 CTCCAAATACCATCATGTTTTGG + Intronic
1152771139 17:82170122-82170144 CTCCAAATACAGTCATGTTCGGG - Intronic
1152869922 17:82747887-82747909 CTCCAAATACAGGTATATTAGGG + Intronic
1153263235 18:3244390-3244412 CTCCAGATACAGTCACACTGGGG - Intergenic
1153434933 18:5059026-5059048 CTCCAAATACAGCCATACAAGGG - Intergenic
1153762610 18:8346522-8346544 CTCCAAATACAGTCACACTTGGG + Intronic
1153840293 18:9001299-9001321 CTCTAAATACAGTCATCTTGGGG - Intergenic
1154057042 18:11022657-11022679 CTCCAAATACAGTCACATTGTGG + Intronic
1154126279 18:11695033-11695055 GTCCAAATACAGTCATGTGGGGG + Intronic
1154512436 18:15122377-15122399 TTCGAAATACAGCCATGCAAAGG + Intergenic
1155028353 18:21962455-21962477 CTCCAAATACAGTCACATTGGGG + Intergenic
1155233409 18:23795875-23795897 CTCCAAATACAGTCACACTGGGG - Intronic
1155585743 18:27362375-27362397 CTCCAAATACCATCACACTAGGG + Intergenic
1155813532 18:30272014-30272036 CTCTAAATACAGCAATGCTGAGG + Intergenic
1155939709 18:31791059-31791081 CTCCAAATACAGTCACATTAGGG - Intergenic
1156233100 18:35174278-35174300 ATCTAAATACAGTCATGCTGGGG - Intergenic
1156260874 18:35444182-35444204 CTCCAAATACAGTCACATTTGGG + Intronic
1156536396 18:37868723-37868745 CTCCAAATACAGCCATACTGGGG + Intergenic
1156734456 18:40236431-40236453 CTCCAAATACCATCATGTTGGGG + Intergenic
1156891853 18:42199219-42199241 CCCCAAATACAGTCACACTGGGG + Intergenic
1157348592 18:46863817-46863839 CTCCAAATACAGTCACATTGGGG - Intronic
1157840867 18:50957136-50957158 CTCCAAATACAGTCACATTGAGG + Intergenic
1158028613 18:52934663-52934685 CTCCAAATACAGTCACATTGGGG - Intronic
1158303121 18:56075183-56075205 CTCCAAATACAGTTACATTAGGG + Intergenic
1158799870 18:60893750-60893772 CTCCAAATACAGTCACATTGTGG - Intergenic
1159449225 18:68578298-68578320 CTCCAAATACAGTCACATCAGGG - Intergenic
1159775213 18:72597256-72597278 CTCCAAACACAGTAAAGCTGTGG + Intronic
1159964738 18:74584054-74584076 CTCCAAATACAGACACACTGGGG + Intronic
1160137156 18:76282214-76282236 CTCCAAACACAATCATGTTGTGG + Intergenic
1160182798 18:76650065-76650087 ATCCAAATAAATTCATGCCAGGG - Intergenic
1160621682 18:80175539-80175561 CTCCAGATACAGTCAGACTGAGG + Intronic
1160666265 19:330622-330644 CTCCAAATATAGTCATGTTGGGG - Intronic
1162150773 19:8644062-8644084 CTCCAAATTCAGTCACACTGGGG - Intergenic
1162594850 19:11620692-11620714 CTCCACATACAGTCATGGTTTGG - Intergenic
1162991805 19:14307773-14307795 CTCTAAATACAGCCACACTAGGG + Intergenic
1163689779 19:18732207-18732229 CTCCAAATACAGCCTCGCTGGGG - Intronic
1164920324 19:32084292-32084314 CTCCACATACAGTCTTGCACCGG + Intergenic
1164961548 19:32435279-32435301 CTCCAAGAACAGTCATATTAGGG + Intronic
1165171715 19:33897031-33897053 CTCCAAATACAGTCACACTGGGG - Intergenic
1165281244 19:34799581-34799603 CTCCAAATATAGTCACACTGGGG - Intergenic
1166395316 19:42435438-42435460 CTCCATATACAGTCATTCTGAGG - Intronic
1166579979 19:43887883-43887905 TTCCAAATACAGACATACTGTGG + Intronic
1168411971 19:56146021-56146043 CTCCAAATACGGTCACACTGGGG + Intronic
1168463488 19:56582604-56582626 GTCCAAATACAGTCATGTTGGGG - Exonic
1168477827 19:56690261-56690283 CTCAAAATACAGTCATGGCCGGG - Intergenic
1168521630 19:57055742-57055764 CTCCAAATACAGTCACATTGGGG + Intergenic
925144430 2:1571458-1571480 CCCCAAATGCAGTCATCCTGGGG + Intergenic
925273271 2:2630517-2630539 CTCCAAATACAATCATATTGAGG - Intergenic
925509852 2:4613297-4613319 CTTCAAATACAGTCATATTTTGG + Intergenic
925721584 2:6833598-6833620 CTCCAAATGCAGCCACTCTAGGG + Intergenic
925822900 2:7817988-7818010 CTCCAAATACAGTCACATTAGGG + Intergenic
925865481 2:8222766-8222788 CTCCAAACACAGCCATGTTGGGG + Intergenic
926049706 2:9737022-9737044 CTCCAAATACAGTCAGTCCTGGG - Intergenic
926352161 2:12005683-12005705 CTTCAAATACAGTCACATTAGGG + Intergenic
926384643 2:12324114-12324136 CTCCAAATACAGTCACACTGGGG + Intergenic
926392270 2:12405566-12405588 CTCCAAATACAGTCATATCGGGG - Intergenic
926627732 2:15107107-15107129 CTTCAAATACAGTCACACTGGGG - Intergenic
926984743 2:18610622-18610644 CTCCAAACACAGTCTTGCTCTGG - Intergenic
927189116 2:20504524-20504546 CTCCAAATACAATCACATTAGGG + Intergenic
927245875 2:20956823-20956845 CTCCAAATACAGTCACATTCTGG - Intergenic
927327374 2:21820645-21820667 CTCCAAATATAGTCACATTAGGG + Intergenic
927365247 2:22287358-22287380 CTCCAAATACAGTCACATTGGGG + Intergenic
927423403 2:22955890-22955912 CTCCAAATACAGTCATAGTGGGG + Intergenic
927450206 2:23202822-23202844 CTCCAAATACTGTCATGTTAGGG + Intergenic
927618381 2:24623889-24623911 CTCCAAGTACAGTCACACTGGGG + Intronic
927910044 2:26890977-26890999 CTCCAAATACAGCCACACTGGGG + Intronic
928035566 2:27819388-27819410 CTCCAAATACAGTCACATTGGGG + Intronic
928246394 2:29632342-29632364 CTCCAAATACAATCATACTGGGG - Intronic
928868369 2:35945813-35945835 CTCCAAATACAATCACACTGGGG + Intergenic
929029521 2:37637413-37637435 CTCCAAATATAGTCACACTGAGG + Intergenic
929034902 2:37681290-37681312 CTCCAAATACAGTCATTTTAAGG - Intronic
929412070 2:41708060-41708082 CTCCAAATACAGTTACACTGGGG + Intergenic
929431904 2:41894172-41894194 CTCCAAACACAGTCATTCAGAGG - Intergenic
930106566 2:47645023-47645045 CTCCAATTACAGTCACCCTGGGG + Intergenic
930609353 2:53523978-53524000 CTCCAAATACCATCATACTGGGG + Intergenic
930697590 2:54427646-54427668 CTCCAAATACAGTCACTTTTGGG + Intergenic
931447057 2:62335599-62335621 CTCCAAATACAGTCGAATTAGGG - Intergenic
931927167 2:67086244-67086266 CTCCAAATACAGTTACATTAAGG - Intergenic
931927344 2:67087544-67087566 CTCCAAATACAGTTACATTAAGG + Intergenic
931985358 2:67736474-67736496 CTCCAAATACAGTCACATTCTGG + Intergenic
932314745 2:70772419-70772441 CTCCAAATACAGTCACATTGTGG - Intergenic
932825487 2:74935126-74935148 CTCCAAATACAGTCATATTGGGG - Intergenic
933783792 2:85822089-85822111 CTCCAAATACAGTCACGTGGGGG - Intergenic
934517446 2:94997749-94997771 CTCCAAATACAGTTATATTGGGG - Intergenic
934569871 2:95362499-95362521 CTCCAAATACAGTCACACTGGGG + Intronic
935004721 2:99061789-99061811 CTCCAAATATAGTCACACTAGGG - Intronic
935040058 2:99417442-99417464 GTCCAAATACAGTCACACTGTGG - Intronic
935301031 2:101694157-101694179 CTCCAAACACAGCCACACTAGGG - Intergenic
935563201 2:104579190-104579212 CTCCAAATACAGTCACAATGGGG + Intergenic
935660795 2:105465243-105465265 CTCCAAATACAGTCATACTGGGG + Intergenic
935698126 2:105787348-105787370 CTCCAAATATAGTCACACTGGGG - Intronic
935802907 2:106716415-106716437 CTCCAAATACCATCACGCTGGGG - Intergenic
935858501 2:107301406-107301428 CTGCAAAGACAGTCATGCCTGGG + Intergenic
937131557 2:119517889-119517911 CTCCAAATACAGCCACCCTGGGG - Intronic
937547695 2:123043965-123043987 CTCCAAATACAGTCATGCTGGGG + Intergenic
938626090 2:133111086-133111108 CTCCAAATACAGTCACATCAGGG + Intronic
939093715 2:137808164-137808186 CTCCAAATACAATCATACTGAGG + Intergenic
939256575 2:139751247-139751269 CTCCAAATACAGTCACATTGTGG + Intergenic
939332991 2:140788789-140788811 CTCCAAATACAGTCACACTGAGG - Intronic
939444932 2:142296988-142297010 CTCCAAATACAGTCACAGTGGGG + Intergenic
939608492 2:144281579-144281601 CTCCAAATACAGTTATTCTGAGG - Intronic
939672295 2:145027563-145027585 CTACAAATACAGAGATTCTATGG + Intergenic
939899412 2:147833638-147833660 CTCCAAATACTATTATGCTAGGG - Intergenic
940159095 2:150692563-150692585 CTCCAAATACTGTCACACTGTGG - Intergenic
940248335 2:151644791-151644813 TCCCAAATACAGTCATGCATTGG + Intronic
940418322 2:153448849-153448871 CTCCAAATACAGTTATATTTAGG - Intergenic
940468789 2:154065643-154065665 CCCCAAACCCAGTAATGCTATGG - Intronic
940637565 2:156318050-156318072 CTCCTAACATAGTCTTGCTATGG + Intergenic
940722120 2:157293443-157293465 CTCCTAATACTGTCATCTTAGGG + Intronic
942497099 2:176551233-176551255 CTCCAAATACAGTCACATTGGGG + Intergenic
942512941 2:176722226-176722248 CTCCAAATATAGTCACCCTGGGG - Intergenic
942942065 2:181630451-181630473 CTCTAAATACAGTCACACTGGGG - Intronic
943099407 2:183470664-183470686 CTCCAAACTCAGTAATGCTGTGG + Intergenic
943165778 2:184323893-184323915 CTCCAAATATAGTCATGTTGTGG + Intergenic
943259631 2:185642498-185642520 CTCCAAATAAAGTCATATAATGG + Intergenic
943489295 2:188530470-188530492 CTTCAAATATAGTCATATTAGGG - Intronic
943784409 2:191861272-191861294 CTCCAAATACAGTCACCTTGGGG + Intergenic
943849488 2:192699170-192699192 CTGCAAATACATCCTTGCTAGGG + Intergenic
944233197 2:197416378-197416400 CTCCAAATACAGTCACACTGGGG - Intronic
944635077 2:201668307-201668329 CTCTAAATACAGCCATACTGAGG - Intronic
944721815 2:202430221-202430243 CTCCAAATATAGTCACACTGAGG + Intronic
944861295 2:203818179-203818201 CTCCAAATAGAGACACGCTGGGG - Intergenic
945558189 2:211305125-211305147 CTCCAAATACAGTCACACTGGGG + Intergenic
945626191 2:212209642-212209664 CTCCAAATGTAGTCACTCTAAGG - Intronic
945876180 2:215280317-215280339 CTCTAAATATAGTCATGTTGGGG - Intergenic
945899282 2:215519670-215519692 CTCCAAATACAGTCACATGAAGG + Intergenic
946441606 2:219701665-219701687 CTTCCAATACAGTAATGATAAGG + Intergenic
946467579 2:219925691-219925713 CTCCAAATACAGTCACATTTGGG - Intergenic
946570396 2:221018141-221018163 CTCCAATTCCACTCCTGCTATGG + Intergenic
946858670 2:223978836-223978858 CTCCAAATACAGTTACGTTAGGG - Intronic
946866622 2:224046678-224046700 CTTCAAATACAGTCACATTAGGG + Intergenic
947052875 2:226066424-226066446 CTCCAAATACCATCATGTTGGGG + Intergenic
947133726 2:226955862-226955884 CTCCAAATACAGTCACATTGGGG + Intronic
947216413 2:227754092-227754114 CTCCAAATATAGTCACATTAGGG + Intergenic
947817967 2:233050763-233050785 CTCCAAATACAGTTACACTGGGG - Intergenic
948159985 2:235815450-235815472 CTCCAAATACAGTCCCACTGCGG + Intronic
948246179 2:236488270-236488292 CTTCAAACACAATCCTGCTAAGG + Intronic
1169451216 20:5713239-5713261 CTCCAAACACAGTCATATTGTGG - Intergenic
1169468441 20:5862131-5862153 CTCCAAATATAGTCATGTTGGGG + Intronic
1169713256 20:8588458-8588480 CTCCAAATAAAGTCACATTAGGG - Intronic
1169938750 20:10914230-10914252 CTCCAAATACAGTCACACTGAGG - Intergenic
1170419697 20:16180612-16180634 CTCCAAATGCAGCCACACTAGGG + Intergenic
1170504332 20:17009132-17009154 CTCCAAATGCAGTCACATTAGGG + Intergenic
1170574362 20:17651487-17651509 ATTACAATACAGTCATGCTAGGG + Intronic
1170658081 20:18309202-18309224 CTCCAAATACAGTCACATTAGGG + Intronic
1172950163 20:38718332-38718354 CTCCAAATACAGTCACATTGAGG + Intergenic
1172998226 20:39086531-39086553 CTCCAAATACAGTCACATTGAGG - Intergenic
1173472919 20:43337550-43337572 CTCTAAAAAAAGTCATGTTAAGG - Intergenic
1174533650 20:51234243-51234265 CTCCAAATACAGTCACATTCTGG + Intergenic
1174887610 20:54352807-54352829 CTCCAAATACTGTCATGTTGGGG + Intergenic
1174971638 20:55282463-55282485 CTCCAAATACAGTCACTCTAGGG + Intergenic
1175712446 20:61231995-61232017 CTCTGAATACCGTCATGCTGGGG - Intergenic
1175968603 20:62672702-62672724 CTCCAAACACAGCCATCCTGGGG - Intronic
1176425265 21:6544789-6544811 CTCCAAATACAGTCACACTGGGG + Intergenic
1176925824 21:14747394-14747416 CTCCAAATATAGTCACATTAGGG + Intergenic
1176971264 21:15268744-15268766 CTCCAAATACAGCCACACTGTGG - Intergenic
1177022887 21:15885073-15885095 CTCCAAACACAGTCATGTTAGGG + Intergenic
1177455109 21:21327745-21327767 TTTCAAATACAGTCATTCTGGGG + Intronic
1177521477 21:22233377-22233399 CTCCAAATATAGTCATATTAGGG - Intergenic
1177591648 21:23177878-23177900 CTCCAAATACAGTCTTGTTGAGG + Intergenic
1177734264 21:25069604-25069626 TTTCAAATACAGTCATCCTGAGG - Intergenic
1177774559 21:25553615-25553637 CTCCAAATACAATCATATTGGGG - Intergenic
1177949041 21:27510854-27510876 CACCAAATACAGTCACACTGAGG + Intergenic
1177993468 21:28066877-28066899 CTAGAAAAACAGTCATGCAAGGG + Intergenic
1178014781 21:28331803-28331825 CTCTAAATACAGCCATACTAGGG - Intergenic
1178223374 21:30686213-30686235 CTCCAAATACAGTCATATTAGGG + Intergenic
1178413612 21:32386186-32386208 CTCCAAATACTGTCTTTTTAGGG - Intronic
1179221205 21:39409035-39409057 CTCCAAATATAGCCATACTGGGG - Intronic
1179241379 21:39596133-39596155 CTCCAAATACAGTCACATTGGGG - Intronic
1179244480 21:39619402-39619424 CTCCAAATACAGTCACATTGGGG + Intronic
1179383943 21:40924510-40924532 GTCCAAATACAGAAATTCTATGG + Intergenic
1179700756 21:43153106-43153128 CTCCAAATACAGTCACACTGGGG + Intergenic
1180050540 21:45329158-45329180 CTCCAAATACAGTCACCTTCTGG + Intergenic
1180122990 21:45766310-45766332 CTCCAAAAGCAGTCATACTAGGG - Intronic
1181139713 22:20795667-20795689 CCCCAAATACATTCATGGTGGGG - Intronic
1181349321 22:22244140-22244162 CTCCAAATACAGGCACACTGGGG + Intergenic
1181361657 22:22342595-22342617 CTCCAAATACAGTAATATTGGGG - Intergenic
1181677183 22:24463074-24463096 CTCCAAATACAGTCACCCTGGGG - Intergenic
1181717063 22:24738652-24738674 TTCCAAGCACAGTAATGCTATGG - Intronic
1182233248 22:28855040-28855062 CTCCACATCCAGTCATGTTGGGG + Intergenic
1182384380 22:29923802-29923824 CTTCAAATACAGTCATATCAGGG + Intronic
1182493307 22:30688707-30688729 TTCCAAATACAGTCACACTGGGG + Intergenic
1183046246 22:35222771-35222793 CTCCAAATACAGTCACATTAGGG - Intergenic
1184536751 22:45092758-45092780 CTCCAAATACAGTCACCCTGAGG - Intergenic
1185086041 22:48741537-48741559 CTCCAAATACATTCAGACTGGGG - Intronic
1185092703 22:48784971-48784993 CTCCAAATACGGTCACACTGGGG - Intronic
1185163891 22:49245862-49245884 CTCCAAATACAGTCAAACTGGGG + Intergenic
1185198194 22:49485802-49485824 CTCCAAATACAGCCACACTGGGG - Intronic
949091538 3:34990-35012 CTCCAAATACAGTCATATTGGGG - Intergenic
949365434 3:3275433-3275455 CTCCAAATGCAGTAGTGCTAAGG - Intergenic
949769186 3:7560012-7560034 TTCCAAATACAGTCATATTGGGG + Intronic
949798030 3:7872249-7872271 CTCCAAATACAGTCACATTGGGG - Intergenic
950626365 3:14250271-14250293 CTCCAAATATAGACATACTGGGG - Intergenic
950884772 3:16353620-16353642 CTCCAAATACAGCCAAACTAGGG - Intronic
951148216 3:19254991-19255013 CTCCAAATACAATCATATTGGGG - Intronic
951337407 3:21441598-21441620 ATCCAAATACCATAATGCTAAGG + Intronic
951411832 3:22375271-22375293 CTCCACATAAAGTCATTATAAGG + Intergenic
951770974 3:26257458-26257480 CTCCAACTACAGTGAAGCTCTGG - Intergenic
952135592 3:30415657-30415679 CTCCAAATATAGTCATATTTGGG - Intergenic
952333737 3:32387249-32387271 CTCCAAATACAGTCACACTTGGG - Intergenic
953026782 3:39149939-39149961 CTCCAAATACCGTCACACTGGGG - Intronic
953063690 3:39449799-39449821 CTCCTAATACTGTCATGCTGGGG - Intergenic
953592174 3:44268776-44268798 CTCCAAATATAGTCATATTGAGG + Intronic
953628458 3:44590527-44590549 CTCCAAATACAGTCACATTGGGG + Intronic
953923358 3:46967269-46967291 CTCCACACACAGTCATCCAAGGG + Intronic
953967595 3:47321681-47321703 CACCAAATACATGCATGGTATGG + Intronic
954339958 3:49945531-49945553 TTCCAAATACAGTCACACTGGGG - Intronic
954806126 3:53221929-53221951 CTCCAAATACAGTCACATTAGGG - Intergenic
955293811 3:57717020-57717042 CTCCAAATACAGTCACATTGGGG + Intergenic
955459229 3:59162103-59162125 CTCCAAATACAGTCATATTAGGG - Intergenic
955615873 3:60805899-60805921 CTCCAAATACAGTCACATTAGGG + Intronic
955716813 3:61838027-61838049 CTCCAAATACAGCCCTGTGAGGG + Intronic
955946463 3:64199113-64199135 CTGCAAAGACAGTCATGTTCTGG - Intronic
955979761 3:64512961-64512983 CTCCAAATACAGTCACATTAGGG - Intergenic
956053478 3:65274401-65274423 CTTCAAATTCAGTGATGTTAAGG + Intergenic
956060665 3:65345038-65345060 CTCCAAATACAGTCACATTGGGG - Intergenic
956133641 3:66077667-66077689 CTCCAAGTACAATCATATTAGGG - Intergenic
956144692 3:66180833-66180855 CTCCAAATACAGTCACACTGGGG - Intronic
956192867 3:66623619-66623641 CTCCAAATACTGTCATACTTGGG + Intergenic
956390218 3:68764098-68764120 CTCCAAATACAATCCTACTGAGG - Intronic
956629998 3:71307187-71307209 GTCCAAATACAGTAATAATATGG - Intronic
957135307 3:76280289-76280311 CTCCAGATACAGTCACACTGGGG - Intronic
957260774 3:77898320-77898342 CTCCAAATACCCTCATGATATGG - Intergenic
957432074 3:80123733-80123755 TTCCAAATACAGTCATATTGGGG + Intergenic
957655225 3:83065275-83065297 CTCCAAATACAGTCACACTGGGG + Intergenic
957679635 3:83417368-83417390 CTCCAAATACAGTCACACTGGGG - Intergenic
957918681 3:86720351-86720373 CTCCAAATACAGTCACATTGGGG - Intergenic
958052903 3:88370765-88370787 CTCCAAATACAGTCACATTGGGG - Intergenic
958141315 3:89565500-89565522 CCCCAAATCCAGTAATGCTATGG - Intergenic
958158111 3:89781707-89781729 CTTCAAATACAGTCATGTCCCGG + Intergenic
959131013 3:102356028-102356050 CTCCAAATTCAGTCACACTGGGG + Intronic
959255681 3:104009725-104009747 CTCACAATACAGTCTTTCTAAGG - Intergenic
960070811 3:113428076-113428098 ATCCAAATACACGCATCCTAAGG - Intronic
960137105 3:114116533-114116555 CTCCAAATACAGTCACATTGGGG + Intergenic
960543004 3:118881454-118881476 CTCCAAATACAGTCACATTTCGG - Intergenic
960884543 3:122381324-122381346 CTCCAGATACAGTCATGTTGGGG - Intronic
961317942 3:126053154-126053176 CTCCAAATACAGTCATGTTTTGG - Intronic
961725563 3:128926705-128926727 CTCCAAATAGAGCCAGGCTGGGG - Intronic
962040703 3:131704879-131704901 CTCCAAATACAGTGACTCTGGGG - Intronic
962203830 3:133419236-133419258 CTCCAAATACAGTCACATTCTGG + Intronic
962640917 3:137385598-137385620 CTCCAAATACAGCCACCCTAGGG + Intergenic
962682052 3:137810516-137810538 CTCCAAATACAGTCACACTGGGG - Intergenic
962902730 3:139775280-139775302 CTCCAAATATAGTCATATTGGGG - Intergenic
963526724 3:146424367-146424389 CTCCAAATACAGTCACATTGCGG + Intronic
963830767 3:150006664-150006686 CTCCAAATACCGTCACACTGAGG - Intronic
964105277 3:153032682-153032704 CTCCAAAGTCTCTCATGCTATGG + Intergenic
964441834 3:156719286-156719308 CTCCAAATACCATCATACTGGGG - Intergenic
964634570 3:158845104-158845126 CTCCAAATACAGTCACGTTGGGG - Intergenic
964809925 3:160652478-160652500 CTCCAAATACAGTCACGTGGGGG - Intergenic
965045739 3:163574163-163574185 CTGCAAGTCCAGTCATGCTGTGG - Intergenic
965220677 3:165922662-165922684 CCCCAACTTCAGCCATGCTATGG + Intergenic
965708965 3:171537294-171537316 CTCCAAATACAGTCACACTGGGG + Intergenic
965967401 3:174509821-174509843 CTCCAAATACAGTCAGATTGAGG + Intronic
966077926 3:175961189-175961211 CTCCAAATACACTCACACTGGGG + Intergenic
966282338 3:178246414-178246436 CTTCAAATACAGTCATATTGGGG + Intergenic
966535877 3:181033082-181033104 CTCCAAATACAGTCATATTGGGG + Intergenic
966880620 3:184348166-184348188 CTCTAAGTACTGTCATGCCATGG - Intronic
969044728 4:4328337-4328359 CTCCAAATACAGTCACCTTTGGG - Intergenic
970124146 4:12790428-12790450 CTCCAAATACTGTCACACTGGGG + Intergenic
970347248 4:15164485-15164507 ATCCAAATACAGTCACTCTGAGG - Intergenic
970725255 4:19036378-19036400 CTCCAAATACAATCACTTTAGGG - Intergenic
970770543 4:19607032-19607054 CTCCAAATACAGTCACATTGGGG + Intergenic
971456480 4:26850141-26850163 CTCCAAATATAGTCACACTCTGG - Intergenic
971554351 4:27994315-27994337 CTCCAAATACAGTCACATTCTGG + Intergenic
972381122 4:38521454-38521476 CTCCAAATAAAGTCATACTGAGG - Intergenic
972619953 4:40737681-40737703 CTCCAAAAACAATCAAGCTTAGG + Intergenic
972638742 4:40907225-40907247 CTCCAAATACAGTCACATTGGGG - Intronic
972952625 4:44347048-44347070 CATCAAATACAGCCATGTTATGG + Intronic
972973673 4:44607492-44607514 CTCCAAATACAGTGACACTGGGG + Intergenic
973139669 4:46750932-46750954 CTCCAAATACAGACACACTGAGG + Intronic
973962266 4:56123525-56123547 CTCCAAATACAGTCACGTTGAGG + Intergenic
974778795 4:66524204-66524226 CAACAAATACATTAATGCTATGG + Intergenic
974865928 4:67580568-67580590 CTCCAAATAAAGACTTGCTAGGG + Intronic
975312534 4:72918583-72918605 TTCCAAAGACAGTCACACTAGGG - Intergenic
975994669 4:80300743-80300765 CTCCAAATACAGTTATATTAGGG - Intronic
977638568 4:99329424-99329446 CTCCAAATACAATCACACTGGGG - Intergenic
977644437 4:99396114-99396136 CTCCAAGTTCAGTTATGCTGTGG - Intergenic
978480580 4:109185633-109185655 CTCCAAATACAGCCACACTGGGG - Intronic
979672086 4:123370750-123370772 CTCCAAATACAGTCATATTGGGG - Intergenic
979704300 4:123703278-123703300 CTCCAAATACAGTCATATTGGGG - Intergenic
979729552 4:124007845-124007867 CTCCAAATATAGTCATATTGTGG - Intergenic
980440092 4:132831293-132831315 CTCCAAATACAATCATATTGGGG + Intergenic
980531058 4:134055173-134055195 CTCCAAATAAAGTCATATTGAGG - Intergenic
980847445 4:138341117-138341139 CTCCAAATACAGTCAGTCTGAGG + Intergenic
980905657 4:138946355-138946377 CTCCAAATACAGACACACTGAGG - Intergenic
980975207 4:139604572-139604594 CTCCAACTACAGTCACACTAGGG - Intronic
981028757 4:140102622-140102644 CTCCAAATACAGTCACATTGAGG + Intronic
981305888 4:143246791-143246813 CTCCAAATATAGTCACATTAGGG + Intergenic
981564863 4:146089387-146089409 CTCCAAATACAGTCATGTTGGGG + Intergenic
981788268 4:148505217-148505239 CTCCAAATACAGTCACAATGGGG - Intergenic
982089354 4:151867050-151867072 CTCCAAATACAGTCACTTTCAGG + Intergenic
982382096 4:154760243-154760265 CTCCAAATACCATCACACTAGGG - Intergenic
982808960 4:159802551-159802573 CTCCAAATACAGTCACACTGGGG - Intergenic
984166227 4:176306159-176306181 CTCCAAATACAATCACACTGAGG - Intergenic
984539429 4:181019355-181019377 CTCCAAATACAGTTACTTTAGGG + Intergenic
984632172 4:182072871-182072893 TTCCAAATACTGTCATGTTGGGG - Intergenic
985185211 4:187307026-187307048 ATCCAAATACAGTCACACTGGGG - Intergenic
985362740 4:189192821-189192843 CTCCAAATACAGTTGTCCTGAGG - Intergenic
985391255 4:189492668-189492690 CTCAAAGTTCACTCATGCTATGG + Intergenic
985518983 5:362039-362061 CTCCAAATACAGCCAAACTAGGG - Intronic
985724430 5:1508352-1508374 CTCCAAATACAGTCACCCTCTGG - Intronic
986274445 5:6261193-6261215 CTCCAAATACAGTCATAGTCTGG + Intergenic
986420209 5:7572905-7572927 CTCCAAATATAGTCCTATTATGG - Intronic
986448779 5:7846598-7846620 CTCCTAATACTGTCATGTTGGGG + Intronic
986463108 5:7993441-7993463 CTCCAAATATAGTCATATTAGGG + Intergenic
986560359 5:9054426-9054448 CTCCAAATGCAGCCCTGCGAGGG - Intronic
986647393 5:9930699-9930721 CTCCAAATACAGTCACACTAGGG + Intergenic
986713304 5:10503262-10503284 CTCCAAATACAGTCACATTGGGG + Intergenic
986932937 5:12850166-12850188 TTCCAATTACATTCAAGCTATGG - Intergenic
986980107 5:13437584-13437606 CTCCAAATGCAGTCACATTATGG + Intergenic
987107020 5:14649502-14649524 CTCCAAATACAGTCACATTGGGG - Intergenic
987840597 5:23218528-23218550 CTCCAAATATAGCAGTGCTATGG + Intergenic
987888156 5:23837934-23837956 CTCCAAATACAGTCACATTAGGG - Intergenic
988115813 5:26888975-26888997 CTCCAAATACAATGACACTAGGG + Intronic
988491199 5:31706953-31706975 CTCCAAACATGGTCATGCTGGGG - Intronic
988712000 5:33788116-33788138 CTCGAACTACAGTCTTGCTCTGG + Intronic
988833912 5:35013236-35013258 CTCCAAATACAGTCTTATTCAGG - Intronic
989310906 5:40016973-40016995 CTTCAAATACAGTCTTGCGGGGG - Intergenic
989724350 5:44570339-44570361 CTCCAAATACAGTCATATGGGGG + Intergenic
989756238 5:44958954-44958976 CTCCAAATGCAGTCATATTGAGG - Intergenic
989974278 5:50564511-50564533 CTCCAAATATAGTCATAATGAGG + Intergenic
990064277 5:51693097-51693119 CTGCAGATACTGTCATGCTGGGG + Intergenic
990460826 5:56029428-56029450 CTCCAAATACAGCCACACTGGGG - Intergenic
990827582 5:59919345-59919367 CTCCAACTACAGTCATTCTTAGG + Intronic
991566491 5:68010362-68010384 CTCCAAATACAGTCACGTTGGGG + Intergenic
991636687 5:68713006-68713028 CTCCAAATACAGTCACATTCTGG + Intergenic
992093768 5:73341634-73341656 CTCCAAATACAGTCACAGTGTGG + Intergenic
992200227 5:74376307-74376329 CTCCAAATACAGTCACATTGGGG - Intergenic
992910590 5:81392995-81393017 CTCCAAATAGAGTCACACCAGGG + Intronic
993239995 5:85370129-85370151 CTCCAACTACAGTCATATTGGGG - Intergenic
993526449 5:88971608-88971630 CTCCTAATACAGTCATGTTGGGG - Intergenic
993631392 5:90290141-90290163 CTCCAAACACAGTCACATTAGGG + Intergenic
995209029 5:109515788-109515810 CTCCAAATATAGTCATATTGGGG + Intergenic
995322446 5:110851782-110851804 CACCAAATACAGTCATATTGGGG - Intergenic
995480940 5:112592074-112592096 CTGCAAATATAGTCAAGGTAAGG - Intergenic
995956692 5:117785074-117785096 CTTCAAATACAGTCATTTTGGGG - Intergenic
996069252 5:119116152-119116174 TTCAAAAGACAGTCATCCTAAGG - Exonic
996081206 5:119260306-119260328 CTCCAAATACAGTCACAGTGGGG - Intergenic
996219305 5:120910121-120910143 CTCCAAATACAGTCACATTGTGG + Intergenic
996369587 5:122739135-122739157 ATCCAAATACAGTCACACTGGGG + Intergenic
996771583 5:127092270-127092292 CTCCAACTACAGTCATTCTGAGG - Intergenic
997786972 5:136722465-136722487 CTCCAAATACAGTCACACTAGGG + Intergenic
997806877 5:136926948-136926970 CTCCAAATACAGTCATATTGGGG - Intergenic
998442009 5:142170522-142170544 CTCCAATTACAGTCATGTTGAGG + Intergenic
998638541 5:143983994-143984016 CTCCAAAGACAGTCACACTGGGG + Intergenic
998825870 5:146100817-146100839 CTCCAAATACATTCACACTGGGG - Intronic
999019834 5:148153175-148153197 CTCCAAATACAGTCACATTAGGG + Intergenic
999130104 5:149275899-149275921 CTCCAAATACAGTCACACTTGGG + Intronic
999469473 5:151839592-151839614 CTCCAAATACAGTCATAATGGGG - Intronic
999840360 5:155418496-155418518 CTCCAAATACAGTCACATTAAGG + Intergenic
999878072 5:155830437-155830459 CTCCAAATGCAGTCATTTTATGG + Intergenic
999902566 5:156100939-156100961 CTCCAAATACCATCATATTAGGG - Intronic
1000067127 5:157704187-157704209 CTCCAAATACAGCCACACTGGGG - Intergenic
1000097565 5:157985214-157985236 CTCCAAATACAGTCACATTGGGG - Intergenic
1000408731 5:160916213-160916235 CCCCAAATCCAGACATGATAAGG - Intergenic
1000662732 5:163956252-163956274 CTCCAAATAGAGTCATATTGGGG - Intergenic
1000724008 5:164745805-164745827 CTCCTAATACAGTCATACTGGGG + Intergenic
1000820854 5:165981694-165981716 CACCAAACACAGTCATTCTGAGG + Intergenic
1001072849 5:168601687-168601709 CTCCAAATACAGCCACCCTGGGG + Intergenic
1001541009 5:172539419-172539441 CTCCAAATACCATCATCTTAGGG - Intergenic
1001805458 5:174581879-174581901 GTCCCAATAGAGTCATGTTAGGG + Intergenic
1001833583 5:174810652-174810674 CTCCAAACACAGTCACATTAGGG + Intergenic
1001864770 5:175093887-175093909 CTCCAAACACAGTCACGTTGGGG + Intergenic
1002583311 5:180223968-180223990 CTCCAAATACAGTCACATTGAGG + Intergenic
1002833312 6:843795-843817 CTCCAAATACAGTCACATTAGGG + Intergenic
1003458353 6:6305816-6305838 ATCCAAATACAGAGAAGCTAGGG + Intronic
1003521779 6:6864258-6864280 CTCCAAATACCATCAAGCTGAGG - Intergenic
1003536470 6:6979923-6979945 CTCCAAATATAGTCACACTGGGG + Intergenic
1003693390 6:8377209-8377231 CTCCAAATACACTCACACTCTGG - Intergenic
1004038623 6:11951191-11951213 CTCCAAATACAGTCACACTGGGG + Intergenic
1004158292 6:13190419-13190441 CTCCAAATACAGTCACATTGGGG + Intronic
1004300640 6:14454269-14454291 CTCCAAATATAGTCATATTGGGG + Intergenic
1004627811 6:17393555-17393577 CTCCAAATACAGACGAGCTGAGG - Exonic
1004981404 6:21028651-21028673 CTCCAAATACAGTCACACTGGGG + Intronic
1005006525 6:21292690-21292712 CTCCAAATACAGCCACACTGGGG + Intergenic
1005047124 6:21653183-21653205 CTCCAAATATAGTCACACTGGGG + Intergenic
1005352780 6:24953002-24953024 CTCCAAATACAGCCACACTGGGG - Intronic
1005562605 6:27055922-27055944 CTAAAACTACACTCATGCTAAGG + Intergenic
1008039700 6:46784015-46784037 CTCCAAATATAGCCACACTAGGG + Intergenic
1008166050 6:48139680-48139702 CTCCAAATACAATCACATTAGGG + Intergenic
1008644070 6:53495453-53495475 CTCCAAATACCCTCATACTAGGG - Intergenic
1008779574 6:55086698-55086720 CTCCAAATACAGTCACATTAGGG - Intergenic
1009446250 6:63745789-63745811 CTCCAAATACTGTCACACTGGGG - Intronic
1009557177 6:65186767-65186789 CTTCAAGTACTGTGATGCTATGG - Intronic
1009584421 6:65579756-65579778 CTCCAAATATAGTCACACTAAGG + Intronic
1009630301 6:66190276-66190298 CACAAAATACAGTCATATTAAGG + Intergenic
1009729031 6:67575150-67575172 CTCCAAATACAGTCACATTGGGG + Intergenic
1010554085 6:77257748-77257770 CTCCAAATGCAGTCACACTGGGG + Intergenic
1010862154 6:80926284-80926306 CTCCAAATGCAGTCATATTAGGG - Intergenic
1010870719 6:81034842-81034864 CTCCAAATACGGTCACATTAAGG - Intergenic
1011138423 6:84125504-84125526 CTCCACATACAGTCACATTAAGG - Intronic
1011324977 6:86140663-86140685 CTCCAAATGCAGTCATATTGGGG + Intergenic
1011349351 6:86405446-86405468 CTCCAAATGCAGTCACACCAAGG - Intergenic
1011656914 6:89560445-89560467 TTCCAAATACAGTCACACTGGGG + Intronic
1011705056 6:89992891-89992913 CTCCAAATAGAATCATACTGGGG - Intronic
1012236859 6:96828370-96828392 CTCCAAATATAGTCATATTGGGG + Intronic
1012457523 6:99424014-99424036 CTCCAAATACAGTCACGTTCTGG + Intronic
1012617137 6:101291130-101291152 CTCCAAATACAGTCACATTCTGG - Intergenic
1012695780 6:102381650-102381672 CTCCAAACACAGTCACACTGGGG - Intergenic
1012768568 6:103399968-103399990 CTCTAAATACAGTCACATTATGG - Intergenic
1012938834 6:105396461-105396483 CTCCATATACCATCATGCTCTGG + Intronic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1013655155 6:112238969-112238991 CTCCAAATACAGTCACATTAGGG - Intronic
1013991708 6:116261410-116261432 CACCAAAAACAGTCAAGCTGAGG - Intronic
1014121846 6:117734935-117734957 CTCCAAATACAGTCACATTTGGG + Intergenic
1014356277 6:120414255-120414277 CTCCAAATACAGTCACATTGCGG + Intergenic
1014823813 6:126024627-126024649 CTTCAAATACAGTCATATTGAGG + Intronic
1015423817 6:133041156-133041178 CTCCAAATACAGCCACACTGAGG - Intergenic
1015469272 6:133585387-133585409 CTCCAAATACAGTCACACGGAGG - Intergenic
1015793249 6:136985463-136985485 CTCCAAATACAGTCACATTAAGG - Intergenic
1016134634 6:140524438-140524460 CTCCAAATACAGACATACTGAGG + Intergenic
1016301323 6:142635072-142635094 CTCCAAATACAGTCACATTGTGG + Intergenic
1016431964 6:143994741-143994763 CTCCAAATACAGTCACATTAGGG - Intronic
1016701001 6:147054176-147054198 CTTCAAATACAGTCATGCTGGGG - Intergenic
1017084924 6:150705015-150705037 CTCCAAATACAGTCACTTTGGGG + Intronic
1017213616 6:151883603-151883625 TTCCAAATATAGTCATACCAGGG + Intronic
1018625176 6:165771033-165771055 CTCTAAATCCAGTCCTGCAATGG - Intronic
1018696496 6:166395563-166395585 CTCCAGATACACTCAGGCAACGG - Intergenic
1018705072 6:166458106-166458128 CTCCAAATACAGTTACACTTGGG - Intronic
1019085209 6:169469047-169469069 ATCCAAACACAGTCATACTGGGG + Intronic
1021599829 7:22354595-22354617 CTCCAAATAATGTCATGTTTGGG - Intronic
1022385947 7:29899213-29899235 CTCCAAATACCATCATACTGGGG + Intronic
1022541893 7:31145531-31145553 CTCCAAACCCAGTAATGCTGTGG + Intergenic
1022866311 7:34425244-34425266 CTCCAAATACAGTCACATTCTGG + Intergenic
1024027438 7:45424621-45424643 CTCCAAATACAGTGAGACTGGGG + Intergenic
1024210266 7:47197323-47197345 CTCCAAATATAGTTATATTAGGG - Intergenic
1024441340 7:49421896-49421918 CTCCAAATACAGTCATCTTGAGG - Intergenic
1026073578 7:67144927-67144949 CTCCAAATACAATCAGTCGATGG + Intronic
1026125764 7:67578220-67578242 CTCTATATACAGTCACGTTAGGG + Intergenic
1026276703 7:68885123-68885145 CTTCAAGTACAGTCATGCTGGGG + Intergenic
1027459922 7:78439478-78439500 CTCCAAATGCTGTCATACAAAGG - Intronic
1027460211 7:78442433-78442455 CTCCAAAGAAGGTCATTCTAGGG - Intronic
1027545694 7:79524848-79524870 TTCTAAATACAGTCATGCACTGG + Intergenic
1027673849 7:81134698-81134720 CTCCAAATACAGTCACAGTGGGG + Intergenic
1027949981 7:84803459-84803481 CTCCAAATAAAATCATGTTGGGG - Intergenic
1027969576 7:85061604-85061626 TTCCAGATACAGTCAGCCTATGG - Intronic
1027986068 7:85291978-85292000 CTCCAAATTCAGTCATGTTTGGG - Intergenic
1028202321 7:87976271-87976293 CTCCAAACACAGTCATGTTGGGG - Intronic
1028340459 7:89712975-89712997 CTCCAAACACAGTCAAGTTCTGG - Intergenic
1028978049 7:96935928-96935950 CTCCAAATACAGTCACATTTGGG - Intergenic
1029007423 7:97225409-97225431 CTCCAAAGACAGTCACACTGGGG + Intergenic
1029199438 7:98828802-98828824 CTCCGAATACAGCCACACTAGGG - Intergenic
1029955483 7:104634467-104634489 CTCCAAATACAGTCACATTAGGG + Intronic
1029982937 7:104896147-104896169 CTCCAAATACAGTCGTATTGGGG + Intronic
1030177204 7:106666947-106666969 CTCCAAATACAGTCACACTGGGG - Intergenic
1030240593 7:107318808-107318830 CTCCAAATACAGTTACACTGGGG + Intronic
1031188297 7:118512230-118512252 CTCCAAATATAGTCATCTTGGGG - Intergenic
1031199666 7:118664378-118664400 CTCCAAATACAGTCATGTTGCGG + Intergenic
1031576823 7:123424423-123424445 CTCCAAATATAGTCATATTAGGG + Intergenic
1031640442 7:124157172-124157194 CTCCAAATATAGCCACACTACGG - Intergenic
1031738130 7:125393102-125393124 CTCCAAATACTATCACGCTGGGG + Intergenic
1032420714 7:131776953-131776975 CTCCAAATATAGTAACACTAGGG + Intergenic
1032837076 7:135684361-135684383 CTCCACATAGTGTCCTGCTAAGG - Intronic
1032860688 7:135876387-135876409 CTACAAATATAGCCATACTAGGG - Intergenic
1034288518 7:149907987-149908009 CTCCAAATACAGTCACATTGAGG - Intergenic
1034662555 7:152784880-152784902 CTCCAAATACAGTCACATTGAGG + Intronic
1035097979 7:156371522-156371544 CTCCAAATACAGCCATACTGTGG + Intergenic
1035844396 8:2847631-2847653 CTCCAAATACAGTCACCCTGGGG - Intergenic
1036065780 8:5380050-5380072 CTCCAAATACAGCCACACTGAGG - Intergenic
1036190662 8:6667074-6667096 CTCCACATACAGTCACACTAGGG + Intergenic
1037611766 8:20481846-20481868 CTCCAAATACAGTCACAATGGGG - Intergenic
1037660831 8:20925423-20925445 CTCCAAATACAGTCATATTTTGG + Intergenic
1037677547 8:21064764-21064786 CTCCAAATAGAGTCAGACTGGGG - Intergenic
1038099146 8:24352574-24352596 CTCCAAATACCATCATTCTGGGG + Intronic
1038178592 8:25204936-25204958 CTCCAAATACCATCACACTAGGG - Intronic
1038485621 8:27933026-27933048 CTCCAAATACAGTCACATTGGGG + Intronic
1038529294 8:28304662-28304684 CTCCAAACACAGTCACACTAGGG + Intergenic
1038546230 8:28427598-28427620 CTCCAAATACAGTCACATTCTGG - Intronic
1039219292 8:35310831-35310853 CTCCAAATATGCTCATGCTGAGG + Intronic
1039455530 8:37703463-37703485 ATCCAAATACAGTCATTAAAGGG + Intergenic
1039460925 8:37743539-37743561 CTCCAAATACAGTCACATTGGGG + Intronic
1039631695 8:39119818-39119840 CTCCAAATATAGTCACATTAGGG - Intronic
1040982631 8:53259790-53259812 GTCCAAATACAGTCTTTTTATGG - Intergenic
1041270971 8:56108636-56108658 CTCCAAATAAAGAAATGCTCAGG - Intergenic
1041324534 8:56650889-56650911 CTCCAAATACCATCATATTAGGG + Intergenic
1041522271 8:58769648-58769670 CTCCAAATACAGTCACACTGGGG + Intergenic
1041567070 8:59290681-59290703 CTCCAAATACAGTCACATTGGGG + Intergenic
1041627264 8:60044795-60044817 CTCCAAATACAGTCACACTGGGG - Intergenic
1041775942 8:61522920-61522942 CACCAAATACAGTCACACTGGGG + Intronic
1042230793 8:66552488-66552510 CTTCAAATACAGCCATGCCAGGG - Intergenic
1042456699 8:69013658-69013680 CTCCAAAGACAGTTATACTGGGG - Intergenic
1042778032 8:72456981-72457003 CTCCAATTACAGTCACACTGGGG - Intergenic
1043037217 8:75213197-75213219 ATCCAAATACAGTCATTTTGGGG + Intergenic
1043052129 8:75397188-75397210 CTCCAAATACAGTCATGCTAAGG + Intergenic
1043141262 8:76593138-76593160 CTCCAAATACAGTCATATTGGGG + Intergenic
1043289250 8:78576129-78576151 CTCCAAATGCAGTCACACTGAGG + Intronic
1043397253 8:79851059-79851081 CTCCAAATATAGCCACACTAGGG - Intergenic
1043692318 8:83169478-83169500 CTCTAAATACAGTCATGTTCTGG - Intergenic
1043984597 8:86679398-86679420 CTCCAAATTCAGTCACATTAGGG - Intronic
1044116215 8:88337399-88337421 CTCCAAATACCATCATACTGGGG + Intergenic
1044547591 8:93476905-93476927 CTCCAACTACAGTCACATTAGGG - Intergenic
1044790721 8:95844264-95844286 CTCCAAATACAGTCACATTCTGG + Intergenic
1045366954 8:101485230-101485252 CTCCAAATACACTCACGTTCTGG - Intergenic
1045474430 8:102540978-102541000 CTCCAAATACAGTTACGTTGGGG + Intergenic
1045793868 8:106020104-106020126 CTCCAAATACAGTCATATTGGGG - Intergenic
1045877311 8:106997002-106997024 CTCCAAATACAGAGTTGCTAAGG + Intergenic
1046120680 8:109842555-109842577 CTCCAAATTCAGTCACACTAGGG - Intergenic
1046304692 8:112349908-112349930 CTCCAAATACAGTCACATTAGGG - Intronic
1046615940 8:116477420-116477442 CTCCAAATACAGTCACACTGGGG - Intergenic
1046673319 8:117081524-117081546 TTCCAAATACAGTCATGTTGAGG + Intronic
1047147052 8:122214113-122214135 CTCCAAATATAGTCACACTGAGG - Intergenic
1047184997 8:122624837-122624859 CTCCAAATACAATCACATTAGGG + Intergenic
1047451423 8:124968357-124968379 CTCCAAATACAGCCACACTGGGG + Intergenic
1047574753 8:126140548-126140570 CTCCAAATACAGTCACATTGAGG + Intergenic
1047597821 8:126396388-126396410 CTTCAAATACAGTCACACTGTGG - Intergenic
1047663340 8:127062497-127062519 CTCCAAATACGGTCACACTCTGG + Intergenic
1048027372 8:130599042-130599064 CTCCAAATACAGTCACATTCTGG - Intergenic
1048037004 8:130686264-130686286 CTCCATTTACAGTTATACTATGG + Intergenic
1048076331 8:131075292-131075314 CTCCAAATATAGTCACTCTGGGG - Intergenic
1048128816 8:131668868-131668890 CTCCAAATACAGTCATACTGGGG + Intergenic
1048335952 8:133502325-133502347 CTCCAAATACAGTCATCTTGAGG - Intronic
1048399039 8:134046098-134046120 CACCAAATACAGCCACCCTAGGG + Intergenic
1048577327 8:135703321-135703343 CTCCAAATACAGTCACATTGAGG - Intergenic
1048841709 8:138572468-138572490 CTCCAAATATACTCATGTTGAGG + Intergenic
1049156681 8:141071483-141071505 CTCCAAGCACAGTCATACTGGGG + Intergenic
1049158190 8:141080033-141080055 CTCCAAATACAGTCACTTTGGGG - Intergenic
1050032874 9:1404856-1404878 CTCCATATACAGTCATATTCTGG + Intergenic
1050072188 9:1827027-1827049 CTCCAAACACAATCATACTGGGG - Intergenic
1050114047 9:2244753-2244775 CTCCAAATACAGTCACATTAGGG - Intergenic
1050190375 9:3019019-3019041 CTCCAAATACAGCCACACTGGGG + Intergenic
1050385751 9:5088886-5088908 CTCCAAATACAGTCATATTGGGG + Intronic
1050787436 9:9423224-9423246 CTCCAAATACCATCATGTTGGGG - Intronic
1051739608 9:20238773-20238795 CTCCAAATATAGTCATGCTGGGG - Intergenic
1051788404 9:20771985-20772007 CTCCAAATACAGTCACTTGAGGG + Intronic
1051914752 9:22195049-22195071 CACCAACAACAGTCATGCTGAGG - Intergenic
1052649531 9:31283578-31283600 CTCCAAATACAGTCACATTAAGG - Intergenic
1052736432 9:32347093-32347115 CTCCAAATAAAGAGATGATACGG - Intergenic
1052891933 9:33709510-33709532 CTCCAAATATAGTCACATTATGG - Intergenic
1053089857 9:35265204-35265226 GTCCAAATACAGTCAAACTGGGG - Intronic
1053449248 9:38179629-38179651 CTCCAAATACAGTCACATTCTGG + Intergenic
1053507340 9:38654439-38654461 CTCAAAATACAGTCGTGATTGGG - Intergenic
1054981449 9:71211022-71211044 TTCCAAATACAGTCACGTTGAGG + Intronic
1055011520 9:71571475-71571497 CTCCAAATGCCATCATGCTGGGG + Intergenic
1055661505 9:78508344-78508366 CCCCAAATACAGTCACCCTAGGG - Intergenic
1055690467 9:78824599-78824621 CTCCAAATACAGCCACACTGGGG + Intergenic
1056277925 9:85011415-85011437 CTCCAAATAGAGTCATACTAAGG - Intronic
1056328733 9:85504068-85504090 CTCCAAATTCAGTCACACTCTGG + Intergenic
1056604965 9:88077988-88078010 CTCCAAATGCAGTCACACTAGGG + Intergenic
1056642718 9:88385256-88385278 CTCTAAAAAAAGTCAAGCTAGGG - Intergenic
1056939403 9:90942056-90942078 CTCCAAATGCAGTCACACTGGGG + Intergenic
1057159091 9:92873031-92873053 CTCCAAATACAGTTACATTAGGG - Intronic
1057423004 9:94927286-94927308 CTCCAAATACAGTCACACCGGGG + Intronic
1057589646 9:96361290-96361312 CTCCAAATACAGTCACATTGGGG - Intronic
1057707057 9:97402394-97402416 CTCCAAATACCATCATACTGGGG + Intergenic
1058383263 9:104403325-104403347 CTCCAAATACAGCCACATTAGGG + Intergenic
1058560323 9:106221662-106221684 CTCCTAATACCATCATGTTAAGG - Intergenic
1059179356 9:112197388-112197410 CTCCAAATGCAGTCACGTTGTGG - Intergenic
1059496975 9:114718015-114718037 CTCCAAATACAGTCACCTTGGGG - Intergenic
1059753953 9:117274893-117274915 CTCCTAATACAGTCACGTTAGGG + Intronic
1059754065 9:117275929-117275951 CTCCTAATACAGTCACATTAGGG + Intronic
1060345054 9:122808656-122808678 CTCCAAATACAGTCACTTTGGGG + Intronic
1060496341 9:124121975-124121997 CTTCAAATACAGTCACACTGGGG + Intergenic
1061907424 9:133705780-133705802 CTCCAAATAGAGTCACGTCAGGG - Intronic
1185887494 X:3796048-3796070 CTCCAAATACAGCCACATTAGGG + Intergenic
1186155326 X:6719364-6719386 CTCCAAATACAGTCACATTGCGG + Intergenic
1186188629 X:7046179-7046201 CTCCAAATACAGACACATTACGG - Intergenic
1186654886 X:11601565-11601587 ATCCAAATAAAAGCATGCTATGG + Intronic
1187073054 X:15907661-15907683 CCCCAAATACAGTCACACTGGGG + Intergenic
1187582326 X:20621289-20621311 CTCCAAATACAGTCACATTGGGG + Intergenic
1188189124 X:27152507-27152529 CTCCAAATACAGTCACACTGAGG + Intergenic
1188287004 X:28339343-28339365 CTCCAAATACAGTCACATTGGGG + Intergenic
1188481208 X:30638681-30638703 CTCCTAATACAGTCAGGCTACGG + Intergenic
1188511720 X:30943541-30943563 CTATAAATACACTCATACTAGGG - Intronic
1188823704 X:34804298-34804320 CTCAAAACACAGTAATGTTAGGG + Intergenic
1189420188 X:40850494-40850516 CTCCAAATACAGTCACATTGAGG + Intergenic
1189625748 X:42895149-42895171 TTCCAAATACAGCCATACTGGGG + Intergenic
1189640179 X:43060383-43060405 CTCCAAACACCGCCACGCTAGGG + Intergenic
1189896501 X:45662142-45662164 CTCCAAATCAAGTCATCCTCTGG + Intergenic
1190018435 X:46849835-46849857 CTCCAAATACAGCCATGTGTAGG - Intronic
1190033985 X:47003384-47003406 CTCCAAATACAGTCACATTGGGG + Intronic
1190104586 X:47550305-47550327 CTCCAAATATAGCCACACTAGGG + Intergenic
1190105031 X:47553811-47553833 CTCAAAATACAGTCACACTGGGG + Intergenic
1190217569 X:48490164-48490186 CTCCAAATACAGTCACATTGAGG - Intergenic
1190372502 X:49756393-49756415 CTCCAAATACAGTCGTATTGGGG + Intergenic
1190489452 X:50966936-50966958 CTCCAAATATAATCACACTAGGG - Intergenic
1190857992 X:54316161-54316183 CTCCAAATACAGTCACATTGGGG - Intronic
1191233261 X:58114259-58114281 CTGCAAATTCAGGCATTCTAAGG + Intergenic
1191752320 X:64556293-64556315 CTCCAAATACAGTCAGATTGGGG - Intergenic
1192251211 X:69415374-69415396 CTCCAAATACAGTCACATTGGGG + Intergenic
1192338882 X:70245398-70245420 CTCCAAATACTGCCATACTTGGG + Intergenic
1192622266 X:72690379-72690401 CTCCAAATATAGTCATATTAGGG - Intronic
1193034197 X:76931828-76931850 CTCCGAATACAGTCACACTGAGG + Intergenic
1193238186 X:79134164-79134186 CTCCAAATACAGTCACATTGAGG + Intergenic
1194197895 X:90918121-90918143 CTCCAAATACACTCATATTGTGG + Intergenic
1194340539 X:92700154-92700176 CACCAAATTCAGTAATGCTGTGG + Intergenic
1194594997 X:95847047-95847069 CTCCAAATACAGTCACATTGGGG + Intergenic
1194602992 X:95946622-95946644 CTCCAAATGCAGTCACATTAGGG - Intergenic
1194819406 X:98487717-98487739 CTCCAAATACAGTCACATTGGGG + Intergenic
1195276865 X:103289749-103289771 CTCCAAATACAGCCACACTGGGG - Intergenic
1195347655 X:103966584-103966606 CTCCAGATACAATCATGCTAGGG - Intronic
1195359787 X:104072257-104072279 CTCCAGATACAATCATGCTAGGG + Intergenic
1195536967 X:106020020-106020042 CTCCAAATACAGTCACTTTGGGG - Intergenic
1195537949 X:106030151-106030173 CTCCAAATACAGCCACTCTGGGG - Intergenic
1195821674 X:108951846-108951868 CTACAAATACAGTAACACTAGGG + Intergenic
1196151180 X:112376175-112376197 CTCCAAATCCAGTAGTGCTAAGG + Intergenic
1197270910 X:124423863-124423885 CTACAAATACAGTCACACTGGGG - Intronic
1197460478 X:126735297-126735319 TTCAAAATACAGTCATGCCTTGG + Intergenic
1197514549 X:127410289-127410311 CTGCAAATCCAGTAATGCTGTGG + Intergenic
1197589770 X:128394073-128394095 CTCTAAATATAGTCATATTATGG - Intergenic
1198062046 X:133055920-133055942 CTCCAAATACAGTCGTATTGGGG + Intronic
1198420670 X:136468485-136468507 CTCCAAATATAGTCACATTAGGG - Intergenic
1198586793 X:138130600-138130622 CTCCAAATACAGTCACATTATGG - Intergenic
1199181894 X:144867077-144867099 CTCCAAATACCCTCATATTAGGG - Intergenic
1199691171 X:150310092-150310114 CTCCAAACACCATCATGCCAGGG + Intergenic
1199872090 X:151907708-151907730 CTCCAAATACAGAAATACTGGGG + Intergenic
1199951495 X:152709786-152709808 CTCCAAATACAGACACCCTGGGG + Intergenic
1199958188 X:152758654-152758676 CTCCAAATACAGACACCCTGGGG - Intergenic
1200543843 Y:4494701-4494723 CTCCAAATACACTCATATTGTGG - Intergenic
1200648894 Y:5816890-5816912 CACCAAATTCAGTAATGCTGTGG + Intergenic
1200774857 Y:7161037-7161059 CTCCAAATACAGCCACATTAGGG - Intergenic
1201598009 Y:15693897-15693919 CTCCAAATAAAGTCACAATATGG - Intergenic
1201692434 Y:16781875-16781897 CTCCAGGTCCATTCATGCTATGG - Intergenic
1201965064 Y:19723709-19723731 CTCAAACTACAGTAATCCTAGGG + Intronic
1202016957 Y:20419719-20419741 CTCAAAATCCAGTCATGTTTTGG + Intergenic