ID: 1132802371

View in Genome Browser
Species Human (GRCh38)
Location 16:1760782-1760804
Sequence TTGGCTGATCAAAGGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132802371_1132802383 13 Left 1132802371 16:1760782-1760804 CCTCCAGCCCTTTGATCAGCCAA 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1132802383 16:1760818-1760840 CCCCCGGAGAGCTGTATGTTGGG 0: 1
1: 0
2: 0
3: 6
4: 64
1132802371_1132802381 12 Left 1132802371 16:1760782-1760804 CCTCCAGCCCTTTGATCAGCCAA 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1132802381 16:1760817-1760839 GCCCCCGGAGAGCTGTATGTTGG 0: 1
1: 0
2: 0
3: 3
4: 78
1132802371_1132802385 14 Left 1132802371 16:1760782-1760804 CCTCCAGCCCTTTGATCAGCCAA 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1132802385 16:1760819-1760841 CCCCGGAGAGCTGTATGTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 83
1132802371_1132802379 -3 Left 1132802371 16:1760782-1760804 CCTCCAGCCCTTTGATCAGCCAA 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1132802379 16:1760802-1760824 CAAGGTTTGGCCACGGCCCCCGG 0: 1
1: 0
2: 1
3: 10
4: 118
1132802371_1132802377 -10 Left 1132802371 16:1760782-1760804 CCTCCAGCCCTTTGATCAGCCAA 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1132802377 16:1760795-1760817 GATCAGCCAAGGTTTGGCCACGG 0: 1
1: 0
2: 1
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132802371 Original CRISPR TTGGCTGATCAAAGGGCTGG AGG (reversed) Intronic
900475936 1:2876428-2876450 TTGGCTGATGGAAGGGTTGGGGG + Intergenic
901208170 1:7509092-7509114 ATGGCTGAGCAGAGAGCTGGAGG + Intronic
902056961 1:13608987-13609009 TTTGCTGACCTAAGGGCTAGAGG - Intronic
902439345 1:16419268-16419290 TTAGCATATCCAAGGGCTGGAGG + Intronic
903542470 1:24104798-24104820 TTGGCTTCCCAAAGTGCTGGAGG + Intronic
906545247 1:46615738-46615760 CTGGCTCATCAATGGTCTGGTGG + Intronic
908176687 1:61562797-61562819 GTGCCTTATAAAAGGGCTGGAGG - Intergenic
908608066 1:65822642-65822664 ATGCCTTATAAAAGGGCTGGAGG + Intronic
909717284 1:78724755-78724777 TTCTCTTATAAAAGGGCTGGAGG + Intergenic
910476174 1:87609737-87609759 GTGCCTTATAAAAGGGCTGGAGG - Intergenic
911754819 1:101541295-101541317 TTGATTGACCAAAGGGGTGGGGG - Intergenic
912582714 1:110734873-110734895 TTGGCTTAACAAAGGGCAAGTGG + Intergenic
912655950 1:111486550-111486572 TTGGCGGATGAATGGGCTTGGGG - Intronic
912757399 1:112335846-112335868 TTGGCTATTCAAATGCCTGGAGG - Intergenic
913658550 1:120985084-120985106 TTGGATAATAAAAGGGATGGTGG - Intergenic
914009918 1:143768204-143768226 TTGGATAATAAAAGGGATGGTGG - Intergenic
914648537 1:149676865-149676887 TTGGATAATAAAAGGGATGGTGG - Intergenic
917106582 1:171498406-171498428 GTGCCTTATGAAAGGGCTGGAGG - Intronic
918455955 1:184714815-184714837 TTGGCTGCTCAAAGGCAGGGTGG + Intronic
920347968 1:205318843-205318865 TTGGCTGAGGGAAGGGCAGGTGG - Intronic
921054194 1:211531796-211531818 TGGGGTGAGCAAAGGCCTGGAGG + Intergenic
921816497 1:219569857-219569879 TTGGCCTCTCAAAGTGCTGGGGG - Intergenic
924626322 1:245698967-245698989 GTGGCTGATGAAGGAGCTGGAGG + Exonic
1063132303 10:3188822-3188844 GTGCCTTATGAAAGGGCTGGAGG - Intergenic
1065587894 10:27238186-27238208 CGGGCTGATCACGGGGCTGGCGG - Intronic
1068885297 10:62091598-62091620 TTTGCTGATCAAAGGGGGTGGGG - Exonic
1069821704 10:71232498-71232520 TTGGCTCAGCACGGGGCTGGAGG + Intronic
1072603759 10:96959067-96959089 GTGGCTCATCACACGGCTGGTGG + Intronic
1073096477 10:100983354-100983376 ATGGCTGGTCACAGGGCAGGAGG - Exonic
1075752535 10:124784994-124785016 TTGGCTCCCCAAAGTGCTGGGGG - Intronic
1076049801 10:127323390-127323412 GTGGCTGAGCAAAGTGCTTGTGG + Intronic
1077275450 11:1704703-1704725 GTGCCTCATTAAAGGGCTGGGGG - Intergenic
1077686580 11:4297893-4297915 TGAACTTATCAAAGGGCTGGAGG + Intergenic
1077691733 11:4349083-4349105 TGAACTTATCAAAGGGCTGGAGG + Intergenic
1081530952 11:43959015-43959037 GTGCCTTATAAAAGGGCTGGAGG - Intergenic
1082874327 11:57972665-57972687 TTGGATTATCAAATGCCTGGGGG - Intergenic
1082928827 11:58578952-58578974 TTGGCTGAAGGAAGGGGTGGGGG + Intergenic
1083043207 11:59708184-59708206 GTGCCTTATAAAAGGGCTGGAGG - Intergenic
1083675043 11:64320549-64320571 TTGTCTGATCAAAGGTGTTGAGG + Intronic
1084184398 11:67464105-67464127 TTGAGTCATCCAAGGGCTGGGGG + Exonic
1084194700 11:67517852-67517874 GTGCCTTATAAAAGGGCTGGGGG + Intergenic
1086074655 11:82837012-82837034 GTGCCTCATAAAAGGGCTGGAGG + Intronic
1088233750 11:107700664-107700686 TTTGCAGTTCAAAGGGATGGGGG + Intergenic
1090958923 11:131538565-131538587 GTGCCTGATCACGGGGCTGGAGG + Intronic
1090989695 11:131804842-131804864 GTGCCTTGTCAAAGGGCTGGAGG + Intronic
1091674203 12:2476731-2476753 TTGTCTTAGCAAAGGGATGGTGG - Intronic
1098608261 12:72421266-72421288 TTGGGAGATCCTAGGGCTGGAGG + Intronic
1098968160 12:76817222-76817244 TTGGCTGATCCCAGGTCTGAAGG + Intronic
1100121619 12:91375263-91375285 TTGGCTGGGCAAAGGGAAGGCGG + Intergenic
1100342822 12:93697272-93697294 GTGCCTGACTAAAGGGCTGGAGG + Intronic
1101364505 12:104059280-104059302 TTGGTGGATCAAAGTCCTGGAGG - Intronic
1103155467 12:118680831-118680853 TTGGCTGACAAAATGACTGGAGG + Intergenic
1103602856 12:122065091-122065113 CTGACTGAGCAGAGGGCTGGAGG + Intergenic
1104670380 12:130676124-130676146 TTGGTTGCTCACAGCGCTGGTGG - Intronic
1107011299 13:35673682-35673704 TTGGTTTTTCAAAGTGCTGGGGG - Intergenic
1108379479 13:49842378-49842400 TAGCCTTATAAAAGGGCTGGAGG + Intergenic
1108984924 13:56574914-56574936 ATGCCTTATAAAAGGGCTGGAGG - Intergenic
1109445108 13:62427050-62427072 TTGGCTGATAACAGGACAGGAGG - Intergenic
1118946414 14:70391892-70391914 CTGGCTGAACAAAGGGCTTCAGG - Intronic
1119853581 14:77883338-77883360 TTTTCTGCTGAAAGGGCTGGGGG + Intronic
1120721356 14:87892713-87892735 GTGCCTTATGAAAGGGCTGGAGG - Intronic
1120854449 14:89200753-89200775 GTGTCTTGTCAAAGGGCTGGAGG - Intronic
1122076876 14:99241580-99241602 TTGGCCGCTCCAAGGGCAGGAGG - Intronic
1122911058 14:104827764-104827786 CTGGCTGAGCAAAGGACAGGAGG - Intergenic
1124455292 15:29836766-29836788 TGACCTGATAAAAGGGCTGGAGG + Intronic
1127257192 15:57302369-57302391 TTTGGTGTTCACAGGGCTGGGGG - Intergenic
1127841555 15:62836163-62836185 CTGGCTGATGGAAGGCCTGGTGG - Intronic
1129823404 15:78619570-78619592 TTGGCTTCTAAGAGGGCTGGTGG - Intronic
1132802371 16:1760782-1760804 TTGGCTGATCAAAGGGCTGGAGG - Intronic
1133232886 16:4374681-4374703 TGAGCTGATCAATGGGCAGGCGG - Intronic
1133792621 16:9020783-9020805 GTGCCTTATAAAAGGGCTGGAGG + Intergenic
1133985296 16:10663764-10663786 TTGGTTGTTGAAATGGCTGGGGG - Intronic
1134745840 16:16587633-16587655 TTGGATCCTCCAAGGGCTGGCGG - Intergenic
1134999639 16:18766109-18766131 TTGGATCCTCCAAGGGCTGGCGG + Intergenic
1141765112 16:86053002-86053024 CTGCCTGAGCAAAGGCCTGGAGG + Intergenic
1144191896 17:12854051-12854073 TTGGCAGAACAAAAGGCAGGTGG + Intronic
1144782964 17:17817074-17817096 CTGGCTGCTCAATGGGCTGTTGG - Exonic
1151297497 17:73196144-73196166 GTGCCTCATAAAAGGGCTGGAGG - Intronic
1151427287 17:74039226-74039248 ACAGCTGATCAGAGGGCTGGGGG - Intergenic
1151744488 17:76004602-76004624 TTGGCCTCTCAAAGTGCTGGGGG + Intronic
1153674815 18:7447516-7447538 GTGCCTGTTAAAAGGGCTGGAGG - Intergenic
1153844246 18:9034050-9034072 TTGCCTTATAAAAGGGCTGAGGG + Intergenic
1156991074 18:43408034-43408056 CTAGTTGATCAAAGGGCTTGAGG - Intergenic
1157980982 18:52380118-52380140 GTGACTTATAAAAGGGCTGGAGG - Intronic
1158009986 18:52717487-52717509 GTGGCTGAACACTGGGCTGGGGG - Intronic
1158952255 18:62505305-62505327 TCTGCTGAACAGAGGGCTGGAGG - Intergenic
1160219241 18:76960531-76960553 TCATCTGAACAAAGGGCTGGAGG - Intronic
1160789773 19:918043-918065 TCAGCTGAACAAAGGGCTGGGGG + Intronic
1161165913 19:2787276-2787298 TGGGCTGGACAAAGAGCTGGGGG - Intronic
1161305675 19:3566243-3566265 CTGGCAGAACACAGGGCTGGTGG - Intronic
1161797274 19:6394255-6394277 TTGGCTAAGCAAAGGGAAGGCGG + Intergenic
1161861489 19:6801577-6801599 TTGCCTGATGAAGGGGCTGATGG + Intronic
1162767429 19:12928516-12928538 TGGGGTGAGCACAGGGCTGGGGG - Exonic
1162925576 19:13929365-13929387 CGGGCTGATCTAAGGGGTGGAGG - Exonic
1162939965 19:14003236-14003258 TTGGCCTCTCAAAGTGCTGGGGG + Intronic
1163132152 19:15281222-15281244 TTGGCTGGTCCAAGGGGTGGGGG - Intronic
1168280711 19:55304085-55304107 TGGGCTGCTTAGAGGGCTGGAGG - Exonic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
925305018 2:2842107-2842129 TTGGCTGAGCAGAGGGCTGCAGG + Intergenic
929277487 2:40041900-40041922 CTGGCTGATCATAAGGCTGATGG - Intergenic
930410473 2:51019120-51019142 TTCGCTTATCAAAGGGATGCTGG - Intronic
931140580 2:59453196-59453218 TTCCCTTATTAAAGGGCTGGAGG + Intergenic
932193594 2:69763209-69763231 ATGGCTGATCCAAGGGGAGGAGG + Intronic
934675813 2:96248981-96249003 TTGGCTGATCTCAGAGCTGGAGG - Exonic
935244617 2:101207302-101207324 TTGGCTTCCCAAAGTGCTGGGGG + Intronic
939175761 2:138745930-138745952 TTGGGTGATAACACGGCTGGTGG + Intronic
940029608 2:149247691-149247713 TTGGCTGGGGAAAGGGCAGGGGG - Intergenic
941030000 2:160500120-160500142 GTGACTTATAAAAGGGCTGGAGG + Intergenic
941162849 2:162054603-162054625 GTGCCTTATAAAAGGGCTGGAGG + Intronic
942191867 2:173478310-173478332 TTGACTGATCAAAGGAATGCAGG + Intergenic
942219314 2:173754111-173754133 GTGCCTTATAAAAGGGCTGGAGG + Intergenic
942241869 2:173970273-173970295 GTAACTGATCAAAGGGCTGGAGG + Intergenic
942542077 2:177024924-177024946 TCAGCTGATCAAAGGGAAGGAGG + Intergenic
942562002 2:177229719-177229741 GTGGCTGAAGAAAGGGATGGGGG - Intronic
944167076 2:196734462-196734484 GTGCCTCATTAAAGGGCTGGAGG + Intronic
944861997 2:203823992-203824014 TTGGCTGTTGAGATGGCTGGTGG + Intergenic
944978004 2:205079516-205079538 ATGCCTTATAAAAGGGCTGGAGG - Intronic
946049103 2:216846893-216846915 GTGCCTTATAAAAGGGCTGGAGG - Intergenic
1169269979 20:4191783-4191805 TTGGCCTCTCAAAGTGCTGGGGG - Intergenic
1170668893 20:18411974-18411996 GTGCCTTATGAAAGGGCTGGAGG - Intronic
1173189394 20:40864637-40864659 TTGGCTGAAGGAAGGGATGGAGG + Intergenic
1173904484 20:46616224-46616246 TTGCTTGAACAAAGGGCTGGGGG - Intronic
1175835629 20:61992471-61992493 TTGGCTGCCCCAAGGGCTTGGGG - Intronic
1176520277 21:7819106-7819128 TTGGCTGTTGTAAGGGGTGGGGG - Exonic
1181623947 22:24109623-24109645 GTAGCTGAGCAAAGGGTTGGTGG + Intronic
1181689711 22:24551962-24551984 GTGCCTTATAAAAGGGCTGGAGG + Intronic
1182109935 22:27715774-27715796 TGAGCTGATCCCAGGGCTGGGGG - Intergenic
1182777670 22:32842893-32842915 GTGGGTGATCAAAGGGATGTGGG + Intronic
1184161226 22:42698473-42698495 TGGGCTGGACACAGGGCTGGAGG - Intronic
1184459780 22:44630632-44630654 TTGGATGAGCTATGGGCTGGCGG + Intergenic
951346548 3:21553519-21553541 TTGGCTGATCATAGTGTTGGTGG + Intronic
952169296 3:30788503-30788525 CTGACTGATCAAAAGGCTGAAGG + Intronic
952851427 3:37732836-37732858 GTGGCTGGTGGAAGGGCTGGGGG - Intronic
954614840 3:51964279-51964301 CTGCCCAATCAAAGGGCTGGGGG + Intronic
956352645 3:68354840-68354862 CTGGCTTATAAAAGGGCTTGAGG - Intronic
957349592 3:79006132-79006154 TTAGCTCATCAAAGGGCTCGTGG + Intronic
958897579 3:99846162-99846184 TTGGCTGTCCCAAGTGCTGGTGG - Intronic
959162683 3:102739891-102739913 TTGGCTGTTGAAAGTGATGGGGG + Intergenic
960114316 3:113878353-113878375 ATGGTTGATCCCAGGGCTGGGGG - Intronic
960347738 3:116555616-116555638 GTGACTTATCAAGGGGCTGGAGG + Intronic
964060699 3:152518736-152518758 TTGGCTTATCCAAGGTCTGAAGG + Intergenic
966155380 3:176910670-176910692 TTGGCTAATGACAGTGCTGGTGG - Intergenic
967893359 3:194378893-194378915 AGGGCTGAGCAAAGGCCTGGAGG + Intergenic
967995629 3:195164359-195164381 AGGGCTGAACAAAGGTCTGGAGG - Intronic
970162806 4:13206157-13206179 ATGCCTGAGCAAAGGGCAGGAGG - Intergenic
970531437 4:16989438-16989460 TTGTCTGATCAAGGGGGTTGGGG - Intergenic
970562879 4:17300132-17300154 GTGCCTTATAAAAGGGCTGGAGG + Intergenic
971988607 4:33861891-33861913 GTGTCTCATAAAAGGGCTGGAGG - Intergenic
972077007 4:35102012-35102034 TTGGGTGGTCTAAGGGCTGTGGG - Intergenic
978876543 4:113646527-113646549 TTGGATGAGCAAAGGCCTGCAGG + Intronic
979733397 4:124052491-124052513 AAGGCTGATCAAGGGGCTGAGGG + Intergenic
982317544 4:154046979-154047001 ATGTTTGAGCAAAGGGCTGGAGG + Intergenic
983901272 4:173137381-173137403 TTTGCTTATCTCAGGGCTGGGGG - Intergenic
985550874 5:532968-532990 TGGGCTGAGCAAAGGGCTCGGGG + Intergenic
985871713 5:2562712-2562734 TTGCCGGAACACAGGGCTGGTGG + Intergenic
985976311 5:3420935-3420957 TTGACTGATGAACTGGCTGGAGG - Intergenic
986609511 5:9552635-9552657 GTGGCTTATAAAAGGGCTGGAGG - Intergenic
990676889 5:58196692-58196714 GAGGCTGATCAAGGGGCAGGAGG - Intergenic
994811992 5:104531610-104531632 TTGTCTGAACAAGGGCCTGGAGG - Intergenic
995229250 5:109740054-109740076 CAGGCTTAACAAAGGGCTGGAGG - Intronic
1001249508 5:170135988-170136010 TTGGCTGAGCCCAGGGCTGTGGG + Intergenic
1001768251 5:174272244-174272266 TTGACTGACCTAAGGGGTGGTGG + Intergenic
1001777283 5:174338059-174338081 GAGGCTGATCAAAGGGCTGAAGG + Intergenic
1004043065 6:12001236-12001258 TTGTGTGATCAAAGCTCTGGAGG + Intergenic
1004186702 6:13427220-13427242 TTCTCTGTTCAAAGGGCTTGAGG - Intronic
1005939113 6:30547486-30547508 CTCGCTGATCAATGGGCTGGTGG - Exonic
1006698089 6:35948870-35948892 GTGCCTTATAAAAGGGCTGGAGG + Intronic
1007528931 6:42522859-42522881 TTGGCTTAACACATGGCTGGAGG - Intergenic
1010202380 6:73294029-73294051 TTGGCTTCCCAAATGGCTGGTGG - Intronic
1011375762 6:86684953-86684975 GTGCCTCATGAAAGGGCTGGAGG + Intergenic
1012448284 6:99328640-99328662 GTGGCAGATGAAGGGGCTGGTGG - Intronic
1012849421 6:104429110-104429132 GTGCCTTATAAAAGGGCTGGAGG + Intergenic
1013087734 6:106870839-106870861 TGGGATGATCAAGGGGGTGGAGG + Intergenic
1013870230 6:114749251-114749273 TTGAGTGATCAAAGGGATGCAGG + Intergenic
1016526732 6:145010142-145010164 GTGCCTTATAAAAGGGCTGGAGG + Intergenic
1016808503 6:148236905-148236927 GTGGATTATAAAAGGGCTGGGGG + Intergenic
1020274125 7:6614933-6614955 TTCGCTGACCACAAGGCTGGTGG - Intergenic
1021759941 7:23893991-23894013 CTGCCATATCAAAGGGCTGGTGG - Intergenic
1021943823 7:25705498-25705520 GTGCCTGATAAAAGAGCTGGAGG + Intergenic
1022620131 7:31975045-31975067 GTGGTGGATCAGAGGGCTGGGGG - Intronic
1026239733 7:68562537-68562559 TTGGCTGAACTCAGGGCTGCTGG + Intergenic
1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG + Intergenic
1026965447 7:74436377-74436399 GTGCCTTATAAAAGGGCTGGAGG - Intergenic
1027906910 7:84196547-84196569 CTGGCTGATCAATAGGCTTGAGG - Intronic
1029175906 7:98664321-98664343 CTGGCGGATCCGAGGGCTGGAGG - Intergenic
1029248404 7:99218974-99218996 AAGGCTGACCAAGGGGCTGGAGG - Intergenic
1032852336 7:135805700-135805722 GTGTCTTATAAAAGGGCTGGAGG - Intergenic
1035185822 7:157125330-157125352 TTGGCAGAACAAGGGCCTGGAGG - Intergenic
1037627693 8:20622397-20622419 ATGGCTTAACAAAGGGTTGGTGG - Intergenic
1040984549 8:53279577-53279599 CTGCCTTATGAAAGGGCTGGAGG + Intergenic
1042355789 8:67826008-67826030 TTGGCTGCCCAAAGTGCTGCTGG + Intergenic
1047913223 8:129553836-129553858 TTTGCTGATAAAAGGGCCTGTGG - Intergenic
1048790529 8:138099340-138099362 TTTGTTGAGCAAAGGCCTGGAGG - Intergenic
1049750193 8:144279401-144279423 GTGGCTGAGCACATGGCTGGTGG - Intronic
1055385177 9:75753903-75753925 TTGGCTGGTGACATGGCTGGTGG - Intergenic
1059390950 9:113999252-113999274 TAGGCTGATCGAGGGGCAGGCGG + Intronic
1059846928 9:118290290-118290312 GTGCCTTATAAAAGGGCTGGAGG - Intergenic
1060766461 9:126297855-126297877 GTGGCTGAGCAGAGGGCGGGTGG - Intergenic
1060805441 9:126572914-126572936 GTACCTTATCAAAGGGCTGGGGG - Intergenic
1061238034 9:129353264-129353286 GAGGCTGATGAAGGGGCTGGTGG + Intergenic
1186730302 X:12402729-12402751 GTGCCTTATGAAAGGGCTGGAGG + Intronic
1189469738 X:41304411-41304433 TGGAGTGGTCAAAGGGCTGGCGG + Intergenic
1190124663 X:47693210-47693232 ATGACTTATAAAAGGGCTGGAGG - Intergenic
1190215849 X:48478939-48478961 TTGGCTGACCCAGGGGCTGTGGG + Intronic
1190770753 X:53512233-53512255 TTGGCCTCTCAAAGTGCTGGTGG - Intergenic
1192512985 X:71736676-71736698 TGGCCTGACCAAAGAGCTGGGGG + Intergenic
1192513712 X:71744833-71744855 TGGCCTGACCAAAGAGCTGGGGG - Intergenic
1192575664 X:72241305-72241327 GTGCCTTATGAAAGGGCTGGAGG + Intronic
1193649207 X:84109468-84109490 ATGGCTGATCACAGGCCTGTGGG - Intronic
1199981007 X:152920478-152920500 CTGGCTGATGAAAGGGTGGGTGG + Intronic