ID: 1132802756

View in Genome Browser
Species Human (GRCh38)
Location 16:1762377-1762399
Sequence CCATCTCCACCCGCGTGAAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132802756_1132802763 15 Left 1132802756 16:1762377-1762399 CCGCTTCACGCGGGTGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1132802763 16:1762415-1762437 AGCGGAACCAGTACAAGGAGCGG 0: 1
1: 0
2: 0
3: 6
4: 94
1132802756_1132802759 -3 Left 1132802756 16:1762377-1762399 CCGCTTCACGCGGGTGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1132802759 16:1762397-1762419 TGGCCCGTGTGCTCATGGAGCGG 0: 1
1: 0
2: 2
3: 6
4: 118
1132802756_1132802765 22 Left 1132802756 16:1762377-1762399 CCGCTTCACGCGGGTGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1132802765 16:1762422-1762444 CCAGTACAAGGAGCGGCTGATGG 0: 1
1: 0
2: 0
3: 6
4: 134
1132802756_1132802758 -8 Left 1132802756 16:1762377-1762399 CCGCTTCACGCGGGTGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1132802758 16:1762392-1762414 GGAGATGGCCCGTGTGCTCATGG 0: 1
1: 0
2: 1
3: 19
4: 170
1132802756_1132802762 10 Left 1132802756 16:1762377-1762399 CCGCTTCACGCGGGTGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1132802762 16:1762410-1762432 CATGGAGCGGAACCAGTACAAGG 0: 1
1: 0
2: 0
3: 20
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132802756 Original CRISPR CCATCTCCACCCGCGTGAAG CGG (reversed) Exonic
920096164 1:203487810-203487832 CCATTTCCACCCTCGGGAGGCGG + Exonic
924823723 1:247518584-247518606 CCATGTCCTCCCGCGTCCAGCGG - Intronic
1062894699 10:1094368-1094390 ACAACTCCACCTGCATGAAGGGG - Intronic
1067180860 10:43985057-43985079 CCATCTCTGCCCACCTGAAGTGG - Intergenic
1069439005 10:68411029-68411051 CCACCTCCACCTGCTTGAATTGG + Intergenic
1069661095 10:70123958-70123980 TCATGTCCACCAGCATGAAGGGG + Exonic
1070561142 10:77567314-77567336 CCATCACCACCCCGGTGGAGAGG + Intronic
1075969298 10:126638942-126638964 CCCTCACCACCAGGGTGAAGAGG + Intronic
1079004925 11:16784756-16784778 CCATCTCCAACAGAGTGAAAGGG - Intronic
1079444506 11:20546737-20546759 CCACCTCCACCCACTTCAAGTGG - Intergenic
1083823277 11:65184253-65184275 CCACCTCCACCCGCGCAAGGCGG - Intronic
1092458289 12:8664487-8664509 CCATCTGCTCCCCAGTGAAGGGG + Intergenic
1098284234 12:68892022-68892044 AGATTTCCAGCCGCGTGAAGTGG - Intronic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1101816722 12:108151351-108151373 CCCTCTCCACCTGCATCAAGGGG - Intronic
1104137331 12:125952882-125952904 CCATCTCCACACACATGGAGTGG + Intergenic
1108127148 13:47256851-47256873 CCATTTCCACACCCCTGAAGAGG + Intergenic
1113178843 13:107601215-107601237 CCATCACCTCCAGCCTGAAGTGG - Intronic
1115851769 14:37595092-37595114 CCAACGCCACCCGGGCGAAGAGG + Intronic
1119857632 14:77912749-77912771 CCATCCCCACCCACCTCAAGAGG - Intronic
1122544997 14:102517202-102517224 CCACCTCCCCCCGGGTGAAATGG + Intergenic
1132518344 16:376276-376298 CCATGTCCTCCCGCGTGACTGGG + Exonic
1132688868 16:1173404-1173426 CCGTCCGCACCAGCGTGAAGGGG - Intronic
1132802756 16:1762377-1762399 CCATCTCCACCCGCGTGAAGCGG - Exonic
1139428830 16:66900327-66900349 CCATCTCCACCCTGGGGAGGGGG - Intergenic
1142846900 17:2685797-2685819 CCTCCTCCACCCGGGGGAAGGGG - Intergenic
1151770816 17:76159464-76159486 CCATCTCCAAGCACGTGAAGTGG + Exonic
1152261032 17:79267295-79267317 CCATCACCATCAGCTTGAAGGGG - Intronic
1160362831 18:78298218-78298240 TCATCTGCACCCACGTGAGGTGG + Intergenic
1161447519 19:4326912-4326934 CCACCTCGGCCCGCGGGAAGGGG + Intronic
1163020998 19:14480680-14480702 TCATCTTCGCCCACGTGAAGGGG - Exonic
1163602545 19:18257701-18257723 CCAGCTCCACCCACGTGACGGGG + Exonic
1163614222 19:18317307-18317329 CCATCACCCCCCGCCTGAACTGG + Intronic
1168588021 19:57609879-57609901 CCATTTCCATCAGCGTTAAGAGG - Intronic
926631643 2:15142080-15142102 TCATCTCCACCCACGTGTTGGGG + Intergenic
928219971 2:29395449-29395471 CCATGACCACCCCAGTGAAGGGG - Intronic
929872560 2:45771421-45771443 CCATCTCCACCCGCTGGAGAGGG - Intronic
930808893 2:55520058-55520080 CCTTCTCCACCCGCGTCATCAGG + Intronic
936679591 2:114754712-114754734 CCATTTCCACACGAGTGAACAGG - Intronic
945094053 2:206202672-206202694 CCATCCCCACCCGAATGAGGCGG - Intronic
1169196737 20:3687205-3687227 CCATCTCCACCAGGCTGCAGGGG + Exonic
1172846866 20:37934796-37934818 CCACCCCCTCCCGCCTGAAGGGG - Intronic
1173473229 20:43339417-43339439 CCATCTCCACCAGCATTAAACGG - Intergenic
1174554067 20:51381535-51381557 AAGTCTCCATCCGCGTGAAGTGG - Intergenic
1175531881 20:59679162-59679184 CCATCTTCAACCGCGTGGACAGG - Intronic
1175619581 20:60431941-60431963 CCATTTCCACCTTCCTGAAGGGG - Intergenic
1175751397 20:61500410-61500432 CCCTCTCCACGCCCGTGATGTGG - Intronic
1178840263 21:36132950-36132972 CCAACCCCAGCCACGTGAAGAGG + Intergenic
1179525623 21:41974193-41974215 CCATCTCAACCCACGTGGTGAGG + Intergenic
1185068768 22:48644977-48644999 CCATCTCCCCCAGCTGGAAGGGG + Intronic
953206860 3:40838625-40838647 CCATCTCCACCAGGGTGCAGGGG - Intergenic
954622107 3:52002247-52002269 CCATCTCCCCACCTGTGAAGTGG - Intergenic
962274519 3:134001923-134001945 CGATCGCCACCCTCGTGAAAGGG + Intronic
964199764 3:154105809-154105831 CCATCTCAACCCGAGAGTAGTGG + Intergenic
965701217 3:171460565-171460587 CCCTCTGCACCAGCGTGGAGGGG + Intergenic
968895731 4:3401986-3402008 CCAGCTCCACCCCTGGGAAGGGG + Intronic
969091691 4:4698741-4698763 CCAGCTCCACCTGTGTGGAGGGG - Intergenic
976002172 4:80386492-80386514 CCACCACCGCCCGCGAGAAGAGG - Intronic
976100288 4:81554934-81554956 CCATCCCCAACCCCGGGAAGGGG - Intronic
982173519 4:152683809-152683831 CCATCTCACTGCGCGTGAAGTGG + Intergenic
985834950 5:2263521-2263543 GCATTTCCATCCACGTGAAGAGG - Intergenic
986003063 5:3645084-3645106 CCATCCCCACCAACGGGAAGGGG + Intergenic
988425963 5:31064900-31064922 CCAGCTCTACCCACGTGGAGGGG - Intergenic
1002313782 5:178330346-178330368 CGATCTGCACCCGTGTGCAGAGG - Intronic
1018893237 6:167996912-167996934 CCATCGCCTCCTGGGTGAAGAGG - Intronic
1022667670 7:32427478-32427500 CCATCTCCTCCCACGGGAATTGG - Intergenic
1028561333 7:92179292-92179314 CGTTCTCCACCCGCCTGCAGCGG - Intronic
1029626366 7:101722554-101722576 CCATCTCCACCCTCTTGGGGAGG + Intergenic
1029728496 7:102424408-102424430 CCTCCTGCTCCCGCGTGAAGAGG + Intronic
1036226304 8:6960617-6960639 ACATTTCCACCCTCATGAAGAGG + Intergenic
1040496031 8:47966284-47966306 CCATCTCCACCCGGGTCGTGTGG - Exonic
1041959444 8:63595771-63595793 CCATCTTCATACGCATGAAGAGG - Intergenic
1044506141 8:93022230-93022252 CCACCTCCATCAGCATGAAGTGG - Intergenic
1049540794 8:143207942-143207964 CCATCACCACCTGCGGGCAGAGG + Intergenic
1049636728 8:143692984-143693006 CCACCTCCACCCGCATGAGTGGG + Intronic
1057713150 9:97465468-97465490 CCCTCTCCACCCTCTTGAAAAGG + Intronic
1058697473 9:107571858-107571880 CCATCTCCAGCCGGGTGCGGTGG - Intergenic
1060726707 9:126011018-126011040 CAATGTCCACCCGTGTGAAAAGG + Intergenic
1061672787 9:132198448-132198470 CGCTCTCCAGCCGCGTGTAGAGG - Exonic
1191855935 X:65626968-65626990 CCATCTCCTCCAGGGTGTAGTGG - Intronic
1193625933 X:83819866-83819888 CCATCTCCAGCCAGGGGAAGTGG - Intergenic
1198037890 X:132819981-132820003 TCACCCCCACCCCCGTGAAGTGG - Intronic