ID: 1132803300

View in Genome Browser
Species Human (GRCh38)
Location 16:1764470-1764492
Sequence GGGAGGGTGCCCGGTGGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 312}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132803300_1132803310 18 Left 1132803300 16:1764470-1764492 CCGAGGCCACCGGGCACCCTCCC 0: 1
1: 0
2: 0
3: 41
4: 312
Right 1132803310 16:1764511-1764533 GCTCAGCTGCAGAGCATGCTGGG 0: 1
1: 0
2: 4
3: 21
4: 225
1132803300_1132803304 -8 Left 1132803300 16:1764470-1764492 CCGAGGCCACCGGGCACCCTCCC 0: 1
1: 0
2: 0
3: 41
4: 312
Right 1132803304 16:1764485-1764507 ACCCTCCCTGGCTTAGTCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 202
1132803300_1132803309 17 Left 1132803300 16:1764470-1764492 CCGAGGCCACCGGGCACCCTCCC 0: 1
1: 0
2: 0
3: 41
4: 312
Right 1132803309 16:1764510-1764532 AGCTCAGCTGCAGAGCATGCTGG 0: 1
1: 0
2: 0
3: 33
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132803300 Original CRISPR GGGAGGGTGCCCGGTGGCCT CGG (reversed) Intronic