ID: 1132803304

View in Genome Browser
Species Human (GRCh38)
Location 16:1764485-1764507
Sequence ACCCTCCCTGGCTTAGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132803295_1132803304 16 Left 1132803295 16:1764446-1764468 CCGAGAAGAAGAAGGTGAGCATG 0: 1
1: 1
2: 6
3: 37
4: 332
Right 1132803304 16:1764485-1764507 ACCCTCCCTGGCTTAGTCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 202
1132803292_1132803304 27 Left 1132803292 16:1764435-1764457 CCACACGTCTCCCGAGAAGAAGA 0: 1
1: 0
2: 0
3: 11
4: 202
Right 1132803304 16:1764485-1764507 ACCCTCCCTGGCTTAGTCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 202
1132803294_1132803304 17 Left 1132803294 16:1764445-1764467 CCCGAGAAGAAGAAGGTGAGCAT 0: 1
1: 1
2: 0
3: 24
4: 228
Right 1132803304 16:1764485-1764507 ACCCTCCCTGGCTTAGTCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 202
1132803300_1132803304 -8 Left 1132803300 16:1764470-1764492 CCGAGGCCACCGGGCACCCTCCC 0: 1
1: 0
2: 0
3: 41
4: 312
Right 1132803304 16:1764485-1764507 ACCCTCCCTGGCTTAGTCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 202
1132803291_1132803304 28 Left 1132803291 16:1764434-1764456 CCCACACGTCTCCCGAGAAGAAG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1132803304 16:1764485-1764507 ACCCTCCCTGGCTTAGTCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132803304 Original CRISPR ACCCTCCCTGGCTTAGTCTC AGG Intronic