ID: 1132803309

View in Genome Browser
Species Human (GRCh38)
Location 16:1764510-1764532
Sequence AGCTCAGCTGCAGAGCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 224}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132803300_1132803309 17 Left 1132803300 16:1764470-1764492 CCGAGGCCACCGGGCACCCTCCC 0: 1
1: 0
2: 0
3: 41
4: 312
Right 1132803309 16:1764510-1764532 AGCTCAGCTGCAGAGCATGCTGG 0: 1
1: 0
2: 0
3: 33
4: 224
1132803303_1132803309 8 Left 1132803303 16:1764479-1764501 CCGGGCACCCTCCCTGGCTTAGT 0: 1
1: 0
2: 1
3: 25
4: 662
Right 1132803309 16:1764510-1764532 AGCTCAGCTGCAGAGCATGCTGG 0: 1
1: 0
2: 0
3: 33
4: 224
1132803307_1132803309 -3 Left 1132803307 16:1764490-1764512 CCCTGGCTTAGTCTCAGGACAGC 0: 1
1: 0
2: 1
3: 20
4: 143
Right 1132803309 16:1764510-1764532 AGCTCAGCTGCAGAGCATGCTGG 0: 1
1: 0
2: 0
3: 33
4: 224
1132803306_1132803309 0 Left 1132803306 16:1764487-1764509 CCTCCCTGGCTTAGTCTCAGGAC 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1132803309 16:1764510-1764532 AGCTCAGCTGCAGAGCATGCTGG 0: 1
1: 0
2: 0
3: 33
4: 224
1132803302_1132803309 11 Left 1132803302 16:1764476-1764498 CCACCGGGCACCCTCCCTGGCTT 0: 1
1: 0
2: 2
3: 31
4: 345
Right 1132803309 16:1764510-1764532 AGCTCAGCTGCAGAGCATGCTGG 0: 1
1: 0
2: 0
3: 33
4: 224
1132803305_1132803309 1 Left 1132803305 16:1764486-1764508 CCCTCCCTGGCTTAGTCTCAGGA 0: 1
1: 0
2: 1
3: 21
4: 246
Right 1132803309 16:1764510-1764532 AGCTCAGCTGCAGAGCATGCTGG 0: 1
1: 0
2: 0
3: 33
4: 224
1132803308_1132803309 -4 Left 1132803308 16:1764491-1764513 CCTGGCTTAGTCTCAGGACAGCT 0: 1
1: 0
2: 1
3: 17
4: 157
Right 1132803309 16:1764510-1764532 AGCTCAGCTGCAGAGCATGCTGG 0: 1
1: 0
2: 0
3: 33
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132803309 Original CRISPR AGCTCAGCTGCAGAGCATGC TGG Intronic