ID: 1132804353

View in Genome Browser
Species Human (GRCh38)
Location 16:1768843-1768865
Sequence GGGGGTCCTATGTACAGGTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132804353_1132804363 5 Left 1132804353 16:1768843-1768865 CCCGACCTGTACATAGGACCCCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1132804363 16:1768871-1768893 CCTGACCCCCGCCCGGCCCGCGG 0: 1
1: 0
2: 1
3: 35
4: 355
1132804353_1132804372 19 Left 1132804353 16:1768843-1768865 CCCGACCTGTACATAGGACCCCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1132804372 16:1768885-1768907 GGCCCGCGGGGTAGCCAGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 164
1132804353_1132804364 6 Left 1132804353 16:1768843-1768865 CCCGACCTGTACATAGGACCCCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1132804364 16:1768872-1768894 CTGACCCCCGCCCGGCCCGCGGG 0: 1
1: 0
2: 3
3: 31
4: 259
1132804353_1132804365 7 Left 1132804353 16:1768843-1768865 CCCGACCTGTACATAGGACCCCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1132804365 16:1768873-1768895 TGACCCCCGCCCGGCCCGCGGGG 0: 1
1: 0
2: 1
3: 13
4: 173
1132804353_1132804360 -2 Left 1132804353 16:1768843-1768865 CCCGACCTGTACATAGGACCCCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1132804360 16:1768864-1768886 CCGACCACCTGACCCCCGCCCGG 0: 1
1: 0
2: 0
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132804353 Original CRISPR GGGGGTCCTATGTACAGGTC GGG (reversed) Exonic
903671221 1:25036727-25036749 GGGGGTCTGATGTGAAGGTCAGG - Intergenic
905945142 1:41895408-41895430 GGGGGTCCAATGTTCATATCAGG + Intronic
909990037 1:82212153-82212175 GGGGCTACTATGAACAGGACTGG + Intergenic
912680853 1:111727863-111727885 GGGGGACCTAAGTTCAGGGCTGG - Intronic
915249840 1:154580131-154580153 GGGAGTCCTTTGTAAAGGGCTGG + Intergenic
915916156 1:159942124-159942146 GGAGGCCCTAAGGACAGGTCTGG - Intronic
921775657 1:219096983-219097005 AGGGGACCAATGTACAGCTCAGG + Intergenic
924036586 1:239944118-239944140 GGGGGTCCAATTTACAGCTCAGG - Intergenic
1065222922 10:23514370-23514392 GGGGGTCCCATGGACATCTCAGG - Intergenic
1076180046 10:128399950-128399972 GGCGTTCCTATGTCCAGCTCAGG + Intergenic
1077139976 11:1020026-1020048 GGAGGTCCTAGGTACACCTCTGG - Intronic
1079301771 11:19284960-19284982 GCTGGTCTTATCTACAGGTCTGG + Intergenic
1081386613 11:42480131-42480153 AAGGGTCCAATGTACAGCTCAGG + Intergenic
1092926207 12:13274740-13274762 GGGTGTCCTGTGTGCATGTCTGG - Intergenic
1098037530 12:66320472-66320494 GTAGGTCCTATTTACAGGTGAGG + Intronic
1098158285 12:67622923-67622945 GGTGGGCCTATGGACAGGTATGG - Intergenic
1106393078 13:29354678-29354700 GCTGGTCTTAAGTACAGGTCGGG - Intronic
1108857632 13:54814504-54814526 GGTGTTCCTATGTACAAGTTAGG + Intergenic
1115990039 14:39141742-39141764 AAGGGGCCAATGTACAGGTCAGG - Intergenic
1116780854 14:49236229-49236251 AAGGGGCCAATGTACAGGTCAGG + Intergenic
1121247316 14:92471390-92471412 GGGGTGGCTATGGACAGGTCTGG - Intronic
1127763398 15:62163692-62163714 GGGGGTCCTGTGAACAGAACAGG + Exonic
1128177107 15:65565571-65565593 GAGGGGCCAATGTACAGCTCAGG - Intronic
1130106658 15:80933444-80933466 GTGGGTGCTATGCACAGGTGGGG + Exonic
1132804353 16:1768843-1768865 GGGGGTCCTATGTACAGGTCGGG - Exonic
1137874295 16:51980960-51980982 GGGGGTCATAAGGACAGGTTGGG + Intergenic
1140214072 16:72993369-72993391 GGGGGGCCTGTGGACAGGTCTGG - Intronic
1141934538 16:87228560-87228582 GGGGCTCCTGTGTACAGGGTGGG - Intronic
1150266086 17:63833255-63833277 GGGACTCCTATGTAAAGCTCTGG - Intronic
1154253864 18:12766459-12766481 GGGGGAGATATGTACAGGTGTGG - Intergenic
1156696008 18:39768992-39769014 GGAGCTATTATGTACAGGTCTGG - Intergenic
1160295240 18:77631324-77631346 AAGGGGCCTATGTACAGCTCAGG - Intergenic
1161502260 19:4622852-4622874 GTGGGACCTATGTAGAGGGCAGG + Intergenic
1162064211 19:8115322-8115344 GGGGGTCCCCTGAACAGCTCAGG - Intronic
1165776074 19:38405058-38405080 GGGGGTCCCTGGTGCAGGTCTGG - Exonic
926085038 2:10014863-10014885 GGTGTTCCTATGGTCAGGTCAGG + Intergenic
932218075 2:69979546-69979568 GGGGGTCCCATGTCCAGGGCTGG - Intergenic
947999673 2:234557507-234557529 AGGTGTCCAATGTACAGGTGAGG + Intergenic
1171213442 20:23334681-23334703 GGGGGTCCTATTCTTAGGTCAGG + Intergenic
1173401972 20:42733943-42733965 GGAGGTCCTATGGTCAGCTCAGG + Intronic
1174201784 20:48811369-48811391 AGGGGTCCTAAGTCCAGGTTAGG - Intronic
1174202186 20:48814458-48814480 GGGGGTCCTTGGTACAAATCAGG + Intronic
1176951979 21:15058880-15058902 GAGGGTACTATGTAAAAGTCTGG - Intronic
1178734816 21:35139327-35139349 GTGGGTGCTATGGACAGGTGAGG + Intronic
1179951710 21:44712099-44712121 GGGGGTCCTAGAGGCAGGTCGGG + Intergenic
1185066501 22:48635007-48635029 GGGGATCCTCTGTCCTGGTCAGG + Intronic
1185097960 22:48821951-48821973 GGGGGGGCAATGTGCAGGTCAGG - Intronic
950305815 3:11914843-11914865 TGGGGCCCTAGGTACAGGCCGGG + Intergenic
951529336 3:23684046-23684068 GGGAGTCTTATGTACAAGTAAGG + Intergenic
956871019 3:73418254-73418276 GGGCCTCCTATGTATAAGTCAGG - Intronic
959713903 3:109412224-109412246 GAGGGGCCTATGTACATGTGGGG - Intergenic
965455624 3:168896520-168896542 AGGGGGCCAATGTACAGCTCAGG - Intergenic
968628029 4:1636889-1636911 GGGGGTCCCATCTGCAGGGCTGG + Intronic
970663597 4:18312490-18312512 GAGGGGCCAATGTACAGCTCAGG - Intergenic
975082406 4:70296914-70296936 GGGGGATCTATGGACAGGTGAGG - Intergenic
985868173 5:2532848-2532870 GGGGGTCCTTAGTGGAGGTCTGG - Intergenic
986801937 5:11269730-11269752 AGGGGTCCAAAGTACAAGTCTGG - Intronic
1002344342 5:178537138-178537160 GGGGGTCCCACATACAGGCCGGG + Intronic
1006060370 6:31414430-31414452 GGGGGTCCCAGGGTCAGGTCAGG + Intronic
1006072813 6:31509202-31509224 GGGGGTCCCAGGGTCAGGTCAGG + Intronic
1006932990 6:37698650-37698672 GGGGGTCCTAGGGAAAGGCCGGG + Intronic
1014143626 6:117971732-117971754 AAGGGGCCAATGTACAGGTCAGG - Intronic
1015653352 6:135488763-135488785 GGGAGTCCTATGTACAGAACAGG - Intronic
1018736029 6:166687948-166687970 GGGGGTTCTATTCACAGGACGGG + Intronic
1019273760 7:165053-165075 GGGGCTCCCATGTCCAGGCCGGG + Intergenic
1024510379 7:50199411-50199433 GGGGGTCCTTTGGATAGGGCAGG + Intergenic
1028487981 7:91380776-91380798 GGTGGTCTTATGTAGATGTCAGG + Intergenic
1031608229 7:123794568-123794590 GAGGGGCCAATGTACAGCTCAGG + Intergenic
1031818761 7:126472847-126472869 TAGGGTCCAATGTACAGCTCAGG + Intronic
1036523528 8:9514380-9514402 GGGCGTCCTATGCACAGGTAGGG + Intergenic
1036760241 8:11503713-11503735 GAGGTTCCTATGTGCAGGTGTGG + Intronic
1052250282 9:26390131-26390153 GAGGGGCCAATGTACAGCTCAGG + Intergenic
1055700949 9:78945370-78945392 GGGAGTCCCATTGACAGGTCTGG - Intergenic
1059983447 9:119798296-119798318 TGGGGTTCTATGGTCAGGTCTGG - Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1061878680 9:133557543-133557565 GGGGGTCCTGGGTAAAGGGCAGG + Intronic
1190108587 X:47575122-47575144 GGGGCTCCCATGGCCAGGTCAGG - Exonic
1199185492 X:144910763-144910785 GGGGGGCCAATGTACAGCTCAGG - Intergenic
1202255301 Y:22914426-22914448 GGGGGACTTATGAACATGTCAGG + Intergenic
1202408292 Y:24548175-24548197 GGGGGACTTATGAACATGTCAGG + Intergenic
1202462490 Y:25121905-25121927 GGGGGACTTATGAACATGTCAGG - Intergenic