ID: 1132804869

View in Genome Browser
Species Human (GRCh38)
Location 16:1770824-1770846
Sequence CAGGCTGAACAGGGGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 504}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132804862_1132804869 -6 Left 1132804862 16:1770807-1770829 CCGGCACGGGTACCACGCAGGCT 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG 0: 1
1: 0
2: 3
3: 35
4: 504
1132804860_1132804869 -3 Left 1132804860 16:1770804-1770826 CCTCCGGCACGGGTACCACGCAG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG 0: 1
1: 0
2: 3
3: 35
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132804869 Original CRISPR CAGGCTGAACAGGGGGAGGC CGG Intronic
900167075 1:1248105-1248127 GAGGCTGGACTGAGGGAGGCTGG + Intergenic
900167092 1:1248171-1248193 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167135 1:1248302-1248324 GAGGCTGTACCGAGGGAGGCTGG + Intergenic
900167176 1:1248434-1248456 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167236 1:1248632-1248654 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167301 1:1248830-1248852 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167389 1:1249094-1249116 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167413 1:1249160-1249182 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167437 1:1249226-1249248 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167461 1:1249292-1249314 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167485 1:1249358-1249380 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167509 1:1249424-1249446 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167533 1:1249490-1249512 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167557 1:1249556-1249578 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900297195 1:1957729-1957751 CAGGCTGAGCAGGAGGGAGCCGG + Intronic
900381234 1:2385089-2385111 CACTCTCAACAGGGGGAGCCGGG + Intronic
900414441 1:2528565-2528587 CCGGAAGAACAGGGGGAGGGAGG - Intergenic
900415903 1:2534548-2534570 CAGGCTGACCTGGGGAAGGAGGG + Intergenic
900421668 1:2558491-2558513 CAGGCTGCCCAAGCGGAGGCTGG - Intronic
900679472 1:3908755-3908777 CAGGCTGTACAGGGGCATGGTGG + Intergenic
900697503 1:4021367-4021389 CAGGCTGAGTGGGGAGAGGCAGG - Intergenic
901142193 1:7042422-7042444 AGGGCTGAACAGGGAGAGGCAGG - Intronic
901798516 1:11693886-11693908 CAGGCAGGACAGGGCTAGGCTGG - Intronic
901925968 1:12566297-12566319 CAGGCTGACCAGGGGGCCTCAGG - Intergenic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902232407 1:15036330-15036352 CAGGCAGGGCAGGGGGAGCCGGG - Intronic
902488657 1:16764665-16764687 CAGGCTCAGCTGTGGGAGGCTGG + Intronic
902603580 1:17556198-17556220 CTGGGAGCACAGGGGGAGGCTGG + Intronic
902689938 1:18104805-18104827 CACCATGAACAGAGGGAGGCTGG + Intergenic
903701972 1:25255933-25255955 CAGGCCGCACAGCAGGAGGCAGG - Intronic
903778665 1:25808584-25808606 GAGGCCGGACAGGGCGAGGCGGG - Exonic
904004534 1:27356900-27356922 CAGGCGGGACAGGGGCAGGCAGG - Intronic
904026072 1:27504591-27504613 GAGGCTTTACAGTGGGAGGCCGG + Intergenic
904285056 1:29448698-29448720 GAGGCAGAGAAGGGGGAGGCTGG - Intergenic
904468209 1:30720206-30720228 CAGGCTGAACACCTGGAGTCTGG + Intronic
904690038 1:32286972-32286994 CAGAGGGAACAGGGTGAGGCAGG + Intergenic
904912502 1:33945788-33945810 CGGGCTGAGCAGGGGGCAGCAGG - Intronic
905789884 1:40784181-40784203 CAGAGCGAACAGGGCGAGGCGGG + Exonic
905797509 1:40823934-40823956 CAGGGTGGACAGTGGGAGACTGG - Intronic
906391854 1:45424312-45424334 AAGGCTGTTGAGGGGGAGGCCGG + Intronic
906574506 1:46875767-46875789 CAGGCTGGACAGGGTCACGCTGG - Intergenic
906597467 1:47092138-47092160 CAGGCTGGACAGGGTCACGCTGG + Intronic
906652434 1:47522199-47522221 CAGGCTGAGGATGGGGTGGCAGG - Intergenic
907305934 1:53513228-53513250 CAGGCTGGGGAGGGGGAGCCCGG - Intronic
910370670 1:86512424-86512446 CAGGCTGAAGAAGAGAAGGCAGG - Intergenic
910515340 1:88054201-88054223 CAGGCTGGAGCTGGGGAGGCAGG - Intergenic
911930490 1:103896684-103896706 TAAGCTGAAGAGGAGGAGGCAGG - Intergenic
912542961 1:110430875-110430897 CAGGCTGAAGAGTGAGAGTCAGG - Intergenic
912545058 1:110444770-110444792 CAGGAAGAAGAGGGGCAGGCAGG + Intergenic
915385254 1:155485421-155485443 AAGGCTGAGCGGGGGGAGGATGG - Intronic
915891954 1:159781261-159781283 CAGGCGGTGCAGGGTGAGGCCGG - Exonic
917843739 1:179003265-179003287 CAGCCTAAGCAGGGGCAGGCAGG + Intergenic
918540615 1:185627986-185628008 AAGGCTAAAAAGAGGGAGGCTGG - Intergenic
919761612 1:201101696-201101718 CAGGATGAACAGGGGGATCTGGG + Intronic
920305413 1:205015311-205015333 CAGGATGAGCAGTGGGAGTCTGG - Intronic
920313457 1:205061851-205061873 CAGGCTGAGCTGTGGGAGCCCGG - Exonic
921699206 1:218248110-218248132 GAGGGTGAGCAGGGGGAGGTTGG + Intergenic
921940180 1:220830938-220830960 CAAGCTGGAGAGAGGGAGGCTGG - Intergenic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923042970 1:230332974-230332996 CAGCATGGACAGTGGGAGGCCGG + Exonic
923531783 1:234817852-234817874 CAGGCTCAGCTGTGGGAGGCTGG - Intergenic
923815024 1:237367967-237367989 CAGTCTGATCAAGGGGAGGAGGG + Intronic
924253985 1:242163807-242163829 CAGGATGAGCAGGGAGAGACGGG + Intronic
924282202 1:242449735-242449757 CAAGCTGACCCAGGGGAGGCAGG + Intronic
924852626 1:247845630-247845652 AAGGCTGCACTGAGGGAGGCTGG - Intergenic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063849889 10:10175728-10175750 CAGGAAGGACAGGGTGAGGCTGG - Intergenic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1063913381 10:10854921-10854943 CAGGCTTGACAGGTGGACGCTGG - Intergenic
1064574356 10:16729452-16729474 CAGGCTGAAAAGGGAGTGGTAGG + Intronic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1066442202 10:35449531-35449553 AAGGCTGCAGAGGGGGAGGCTGG + Intronic
1067439443 10:46300387-46300409 AGGGCTAAACAGGGGGAGTCTGG - Intronic
1067829940 10:49605779-49605801 CAGGCTGGCCAAGGGCAGGCAGG + Intergenic
1068798757 10:61115111-61115133 CAGGCTGAAAAGAGAGAGGTTGG - Intergenic
1069303021 10:66932106-66932128 CTGGCTGAAAAGGGGGAGGGAGG - Intronic
1069908742 10:71747282-71747304 CAGGCAGAAAAGGGAGTGGCAGG + Intronic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1072620165 10:97074464-97074486 CAGGCTCAGAAGGGGAAGGCAGG + Intronic
1072789642 10:98308925-98308947 CCGGCGGCGCAGGGGGAGGCAGG + Intergenic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073466578 10:103697795-103697817 GAGACTGCACAGGGAGAGGCTGG + Intronic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1074776291 10:116770524-116770546 CAGGTGGCACAGGGGGCGGCAGG + Intergenic
1075991304 10:126841198-126841220 CAGGCTAAGCCTGGGGAGGCTGG - Intergenic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1076826785 10:132973379-132973401 CAGGCTGGGCAGGGGCAGACTGG + Intergenic
1077178625 11:1202601-1202623 CAGGCTGAGCCGGGTGGGGCTGG + Intergenic
1077306545 11:1871191-1871213 CACGCAGAACAGGAGGAGGGGGG + Intronic
1077339385 11:2019215-2019237 GAGGCTGCACCTGGGGAGGCTGG + Intergenic
1077555820 11:3225550-3225572 CAGGCTGGGCAGGGGCAGGTGGG + Intergenic
1077579023 11:3405008-3405030 CAGGGGGAACAGGGGTGGGCGGG + Intergenic
1078105468 11:8355555-8355577 CAGGCTGGACAAGGAGAGGAAGG - Intergenic
1079009167 11:16814401-16814423 CAGGCTGTACAGAGGTAGGCAGG - Intronic
1081674186 11:44958753-44958775 GGGGCTGAGCAGGGGGAGGCAGG + Intergenic
1081863939 11:46349327-46349349 CAGGCTCCGCAGGGGGAGGGAGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083146068 11:60759863-60759885 CAGGGTGAACAGGGTGATGGTGG - Intronic
1083618960 11:64039605-64039627 CAGGCTGTCCGGGGGGAGGAGGG - Intronic
1084008936 11:66337166-66337188 CAGGCTGGGGAGGGGGAGGTGGG - Intergenic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084675272 11:70630361-70630383 CAGGCTGCCCAGGCAGAGGCGGG + Intronic
1085052920 11:73388971-73388993 CAGGCAGAGCCCGGGGAGGCCGG - Intronic
1085260220 11:75200312-75200334 CAGGCTGACCAGGAGCAGGAAGG - Exonic
1085389725 11:76176259-76176281 CAGGCTGCCCAGGGACAGGCAGG + Intergenic
1085507878 11:77070378-77070400 CTGGCTGAGCAGGGGCTGGCTGG - Intronic
1085515675 11:77110545-77110567 CAGGCTCAAGCGAGGGAGGCAGG - Intronic
1088875863 11:113935797-113935819 CAGGCTGCCCAGCGGGAGGTTGG + Intronic
1090976852 11:131686567-131686589 GAGGCAGAAGAGGAGGAGGCAGG + Intronic
1091007815 11:131969520-131969542 GAGACTGAGCAAGGGGAGGCAGG + Intronic
1091301505 11:134510783-134510805 CTGGGTGAGCAGGGGCAGGCAGG - Intergenic
1202822370 11_KI270721v1_random:74404-74426 GAGGCTGCACCTGGGGAGGCTGG + Intergenic
1092292734 12:7172932-7172954 AAAGCTGAACAGGGGAAGGAAGG + Intergenic
1092406954 12:8227890-8227912 CAGGGGGAACAGGGGTGGGCAGG + Intergenic
1092585692 12:9899081-9899103 CAGTTTGCACAGGGAGAGGCAGG + Intronic
1092667589 12:10820893-10820915 GAGACTCAAAAGGGGGAGGCTGG - Intergenic
1092725933 12:11485655-11485677 CAGGCTGCATAGCGGGAGGTGGG - Intronic
1095977375 12:47949050-47949072 CAGGCCTGACAGGGAGAGGCGGG - Intergenic
1096048962 12:48589495-48589517 CATGCTGAACAGGTAGAAGCTGG + Intergenic
1096127138 12:49128221-49128243 CAGGCACCACAGTGGGAGGCTGG + Exonic
1096134090 12:49185273-49185295 CAGGCACCACAGTGGGAGGCTGG + Exonic
1096145049 12:49272948-49272970 CAGGCACCACAGTGGGAGGCTGG - Exonic
1096186005 12:49581014-49581036 GAAGCTGAGCAGGTGGAGGCTGG - Intronic
1096498945 12:52054064-52054086 CAGGCTGACTAGGGTGTGGCTGG + Intronic
1096594734 12:52687640-52687662 CAGGCAGAAAAGGGAAAGGCAGG + Intergenic
1096862766 12:54541929-54541951 GAGGGTGAAGAGGGGGAGGTGGG - Intronic
1097260934 12:57719925-57719947 CAGGCTGAACTGGGAGGGGCGGG + Intronic
1097673307 12:62568130-62568152 TAGGTTAAAAAGGGGGAGGCAGG + Intronic
1097918676 12:65047527-65047549 CAAGCTGAACATGAGGAGGGAGG + Intergenic
1099713721 12:86264457-86264479 CGGGCTGCAGCGGGGGAGGCGGG + Intronic
1101062116 12:100983230-100983252 CAGCCTTAACAGTGGGAGCCTGG + Intronic
1102114991 12:110396141-110396163 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1102375733 12:112419332-112419354 CAGCCGGAACTCGGGGAGGCAGG - Intronic
1102419844 12:112794842-112794864 CAGGCTGGACTGGGGGAGTAGGG - Intronic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1103793146 12:123485719-123485741 CAGGGTGAACCGGGGGCGGTTGG + Exonic
1104870136 12:131989094-131989116 CAGGCTGGACATGTGGATGCTGG + Intronic
1107401974 13:40077970-40077992 CAGGTAGAAGAGAGGGAGGCAGG + Intergenic
1107915494 13:45145836-45145858 AAGCCTGAACAGGGTGAGGAGGG - Intronic
1108522091 13:51255769-51255791 GCTGCTGCACAGGGGGAGGCTGG + Intronic
1111856437 13:93643482-93643504 TAGGCTGAACAGAGGTAGGCAGG + Intronic
1113581248 13:111431067-111431089 CAGGCTGAAAAGGGGAGGGGAGG - Intergenic
1113611135 13:111645724-111645746 CAGGCTGAGCAGGGGGCTGATGG + Intronic
1114366662 14:22034294-22034316 CAGTGTGAACAGGAAGAGGCAGG + Intergenic
1114519753 14:23325725-23325747 CTGGCTGGACAGGAGCAGGCAGG - Exonic
1116016105 14:39409021-39409043 CAAGCTGAAGAGGCCGAGGCAGG - Intronic
1118199098 14:63655682-63655704 CAGGCTGAGAAGGCTGAGGCAGG + Intergenic
1118319169 14:64743231-64743253 CACGCCGAGCAGGGGGCGGCCGG + Exonic
1118443393 14:65831377-65831399 GAGGCTAAACCGGGGAAGGCTGG + Intergenic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG + Intronic
1119266838 14:73267746-73267768 CAGGCTGATCAGGGGATGGCTGG - Intronic
1119657709 14:76429204-76429226 CAGGCTGCTTTGGGGGAGGCTGG - Intronic
1121144621 14:91573656-91573678 CTGGCAGAAGAGGGGGAGACTGG + Intergenic
1122288605 14:100667576-100667598 GAGGCTGGAGAGGGCGAGGCAGG + Intergenic
1122353139 14:101109033-101109055 CTGGCTGACCAGGGTGAGGATGG - Intergenic
1122624147 14:103075610-103075632 CCGGCTGTGCCGGGGGAGGCTGG + Intergenic
1122722558 14:103730434-103730456 CAGGCTCCCCAGGAGGAGGCAGG - Intronic
1123112424 14:105879634-105879656 CAGGGTGCCCAGGGGCAGGCAGG - Intergenic
1123141704 14:106086343-106086365 AAGGCTGAACAGGGAGTTGCAGG + Intergenic
1123200169 14:106655991-106656013 AAGGCTGAACAGGGAGTTGCAGG + Intergenic
1124253720 15:28124118-28124140 CAGGTCGAACATGGGGATGCAGG + Exonic
1124437837 15:29665671-29665693 CAGGCAGCACAGGGGAAAGCAGG + Intergenic
1124465576 15:29936386-29936408 CAGGCTGGACCGGGGAAGGCAGG - Intronic
1124804439 15:32867336-32867358 CAGGGAGAGCAGGGTGAGGCTGG - Intronic
1127448253 15:59088205-59088227 CAGGGTGAACAGGTGAAGGGAGG + Intronic
1127609916 15:60626940-60626962 AAATCTGAACAGGAGGAGGCAGG - Intronic
1127843060 15:62846967-62846989 CAGGCTGACCTGGGGGTGGTGGG + Intergenic
1128173094 15:65530379-65530401 CAGGCGGGATAGGGGCAGGCCGG - Intergenic
1128240113 15:66095994-66096016 CAGTGAGAACAGGGGGAGCCCGG - Intronic
1128680558 15:69648367-69648389 CAGGCGGAGAAGGGGGCGGCCGG - Intergenic
1128735454 15:70051287-70051309 CAGGAAGAACAGGAGGAGCCTGG - Intronic
1129105279 15:73302861-73302883 CAGGCTGACCAGGGGAAGGCAGG - Exonic
1129175915 15:73839614-73839636 AAGGCTGCACAGGTGGAGGTGGG + Intergenic
1129189953 15:73931339-73931361 CAGACTGAAGAGGGAGAGACTGG - Intronic
1129244830 15:74272758-74272780 CTGGCTGACCCTGGGGAGGCAGG - Exonic
1129879425 15:78997020-78997042 CAGGCTGTTCAGTGGGTGGCGGG - Intronic
1132755494 16:1482533-1482555 CAGGTGGCACTGGGGGAGGCGGG + Intergenic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1133346698 16:5075910-5075932 CAGGCAGATCAGAGGAAGGCAGG - Intronic
1134071851 16:11265169-11265191 CAGGGTGAACAGGTGAAGGGAGG - Intronic
1134905018 16:17972550-17972572 CAGGCTGACGTGGGGGCGGCCGG - Intergenic
1135939525 16:26809449-26809471 AAGGATGAAAAGGGGGAGGAAGG + Intergenic
1136033913 16:27524135-27524157 CAGGCTATACAGTGGGAAGCGGG + Intronic
1136370009 16:29830470-29830492 CAGGATGAACCTGGGGAGCCTGG - Exonic
1137435058 16:48448136-48448158 CAAGCTGAACACAGGGAGGTGGG - Intronic
1137652664 16:50133885-50133907 CTGGCTGATGAGGGGGTGGCTGG + Intergenic
1138189044 16:54999358-54999380 CACGCTGCACAGATGGAGGCTGG + Intergenic
1138281383 16:55774433-55774455 CAGGCAGAACAGGCGGAGCGCGG + Intergenic
1138348790 16:56335579-56335601 CAGTCTGAACAGGAGCGGGCAGG - Intronic
1138513122 16:57520142-57520164 CAGGATGAAGACGAGGAGGCTGG - Intronic
1139392551 16:66614178-66614200 CAGGCTGCACAGCAGGAGGTGGG - Intergenic
1140479147 16:75253222-75253244 CAGGCTGAGGAGTGGGTGGCTGG - Intronic
1140847521 16:78904581-78904603 CAGGCTGACCTGGGGAAGGGAGG - Intronic
1141462079 16:84183602-84183624 CAGGCTTAGCAGGGAGAGGAAGG + Intronic
1141660359 16:85438041-85438063 CAGGCTCATCTGGGGGAGGCGGG + Intergenic
1141681864 16:85549512-85549534 CCTGCTGCACAGGGGCAGGCTGG + Intergenic
1142304636 16:89278533-89278555 CAGGTGGAACAAGGTGAGGCTGG + Intronic
1142499494 17:324273-324295 GAGGCGGAGCAGGTGGAGGCAGG - Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142697098 17:1639775-1639797 CTGGGTGAAGTGGGGGAGGCAGG + Intronic
1142805550 17:2369484-2369506 CAGGCTGGACGGGGGGAGGGGGG - Intronic
1142923632 17:3213187-3213209 AAGCCTGCACAGGGGAAGGCTGG - Intergenic
1144517447 17:15928457-15928479 GAGGCTGAGCATGGGGAGGCTGG + Intergenic
1144941665 17:18946508-18946530 ATGGCTGAACACGTGGAGGCAGG - Intergenic
1146000605 17:29128178-29128200 TAGGCGGAGCAGGGGGAGGTGGG + Intronic
1146372768 17:32275658-32275680 CAGGCTGATTAGGGAGAGACAGG - Intronic
1146539153 17:33679867-33679889 AGGGCTGAAAAGGGAGAGGCAGG + Intronic
1146546675 17:33745165-33745187 CAGGCGGAACTGGGGGTGGGAGG - Intronic
1146669007 17:34724022-34724044 CAGGCTGAGCTGGAGCAGGCTGG + Intergenic
1146795111 17:35775040-35775062 CAGGCAGAAGAGGGGGTGGCGGG + Intronic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147341801 17:39756711-39756733 CAGGCAGAAGAGAGGGAGACAGG - Intergenic
1149652384 17:58284077-58284099 GAGGGTGGACAGGGTGAGGCTGG + Intergenic
1149754316 17:59174885-59174907 GAGGCTGGACAAGGGGAGGGAGG - Intronic
1150289252 17:63972213-63972235 CATGCTGAACAGCGTGGGGCAGG + Exonic
1150433879 17:65139394-65139416 CAGGCTGCTCAGGGGAAGGTTGG - Intronic
1150445237 17:65223489-65223511 CAGCCTGAACAGGGAAGGGCAGG - Intronic
1150634230 17:66901666-66901688 GAGGCTGAATAGTGGTAGGCTGG + Intergenic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1151451693 17:74201967-74201989 CTGCCTGAAAAAGGGGAGGCGGG + Intergenic
1151569065 17:74917189-74917211 CAGGCAGAACAGGGTGTGGCTGG - Exonic
1151699895 17:75737519-75737541 CAGTCTGGAGAGGAGGAGGCAGG - Exonic
1151825287 17:76520618-76520640 CAGGATGGACTGGGGAAGGCAGG + Intergenic
1152068942 17:78125757-78125779 CAGGTCGTACAGGCGGAGGCTGG + Exonic
1152289241 17:79429460-79429482 CAGGCTGGGCAGGAGGAGGGAGG + Intronic
1152404784 17:80091015-80091037 CTGGCTGAGGAGGGGGAGCCGGG - Intronic
1152518889 17:80843841-80843863 CAGACTGAAAATGGGAAGGCCGG - Intronic
1152586865 17:81193142-81193164 AATGCTGAACAGGGTGAGGCCGG - Intronic
1152755383 17:82084976-82084998 CAGGCTGGGGATGGGGAGGCTGG + Intronic
1152929110 17:83100936-83100958 CAGCTTGAGCAGGGGCAGGCTGG + Intergenic
1153645991 18:7196415-7196437 CAGGCTTAATAGGTGGGGGCTGG + Intergenic
1153732559 18:8029311-8029333 CAGGCAGGACAGGTGGAGGAGGG - Intronic
1154200120 18:12293884-12293906 CAGGATGGGCAGGGGGAGCCAGG - Intergenic
1154371771 18:13769792-13769814 CACACTGAACAGGGAGAAGCTGG + Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155526967 18:26726867-26726889 AAGGCAGAACAGGGCAAGGCAGG - Intergenic
1157269851 18:46264686-46264708 CAGGCTGGGCAGGTGGAGGCAGG - Exonic
1157550368 18:48577062-48577084 CAGGCTGGCCTGGGGGAGCCAGG + Intronic
1157576376 18:48746549-48746571 CAGGCTGGCCAGGAGGAGTCAGG + Intronic
1157616105 18:48988708-48988730 CAGCCTGAGCTGGGGGAGGAGGG + Intergenic
1157761771 18:50270562-50270584 CTGGCTGAAGAGGGGGAGTCAGG + Intronic
1157804712 18:50649543-50649565 AAGGCTGGACAGGGAGAGGTGGG - Intronic
1159886671 18:73914245-73914267 CAGGCTCCCCATGGGGAGGCAGG - Intergenic
1160313660 18:77820960-77820982 CAGGCTGTGCAGGGAGAGCCGGG + Intergenic
1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG + Intergenic
1160513431 18:79465514-79465536 CAGGCTGGATGGGTGGAGGCGGG - Intronic
1160538632 18:79608714-79608736 CAGGCTGAGCTGCGGGAGGATGG + Intergenic
1161064951 19:2233004-2233026 CAGCCAGGACAGGTGGAGGCTGG - Intronic
1161099402 19:2413895-2413917 CAGGCTGTGCTGGGGGCGGCAGG - Exonic
1161291644 19:3496853-3496875 CAGGCTAAACCTGGGGACGCGGG + Exonic
1161301765 19:3546218-3546240 CAGGCTGGGGTGGGGGAGGCCGG - Intronic
1161339905 19:3735703-3735725 CAGGCAGAGCTGGGGGAGGTTGG + Intronic
1161378343 19:3951266-3951288 GAGGCTGACCAGGGGGACGGGGG + Intergenic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161594370 19:5143750-5143772 GAGGCTGAGCAGCAGGAGGCTGG + Intronic
1162583839 19:11546983-11547005 CAGGCTGGGCAGGGGGTGGTGGG + Intronic
1162776965 19:12985758-12985780 CAGGCTGCACAGGGAGAGCTGGG + Intergenic
1162964404 19:14149159-14149181 CAGGCTGGAGAGGAGGGGGCCGG + Exonic
1163355541 19:16808145-16808167 TAGCATGAACATGGGGAGGCGGG - Intronic
1163683317 19:18696236-18696258 CCGGCTGGTCAGGGTGAGGCAGG + Intronic
1164455611 19:28404134-28404156 CAGGGTGTACATGGGGAGGCTGG + Intergenic
1164564303 19:29314921-29314943 CAGGGTGGAGAGGAGGAGGCTGG + Intergenic
1166109402 19:40613257-40613279 CCGGCTGGAAAGGTGGAGGCGGG + Intronic
1167915185 19:52734647-52734669 GGGGCTGAGGAGGGGGAGGCTGG + Intronic
925302774 2:2828792-2828814 CAGGCAGACCAGAGGGAGACAGG + Intergenic
925606638 2:5666945-5666967 AGGGCTGAGCAGGGGGAGGAGGG - Intergenic
926118700 2:10229305-10229327 AAGCGTGAACAGGGGGAGGGTGG + Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926148526 2:10411655-10411677 CAGGCTGAGCACTGGGATGCCGG - Intronic
926872587 2:17439648-17439670 GAGGCAGAAGAGGTGGAGGCTGG - Intergenic
927047823 2:19297761-19297783 CTGGCTTAACAGTGGGATGCTGG + Intergenic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
927452749 2:23223037-23223059 AAGGCTGACTTGGGGGAGGCAGG + Intergenic
929446002 2:42001921-42001943 CAGGCTGAACTGCTGGAGGAAGG - Intergenic
929534645 2:42773417-42773439 CTGGCTGCACTGGGGGAGGTGGG + Intronic
929681215 2:43995549-43995571 CAGGCTGAAGTGGCGGGGGCAGG + Intronic
929795568 2:45055984-45056006 CCAGCTGAAAATGGGGAGGCAGG + Intergenic
929994057 2:46814153-46814175 AAGGCTGAGCGGGGGGAGGGAGG - Intergenic
930213362 2:48667074-48667096 CATGCTGAAGAGGTGGAGGCAGG - Intronic
931116852 2:59174515-59174537 CGGGCTGAACAGGCGGATGGTGG - Intergenic
931763449 2:65435618-65435640 CCGGCAGAACAGGGGGCTGCGGG + Intergenic
932627968 2:73314039-73314061 CAGGATGAACAGGGCTAGGAAGG + Intergenic
932698549 2:73977389-73977411 CAGGCTGAAAAGGGGAGAGCAGG + Intergenic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
933726701 2:85431125-85431147 GAGGCTGGTCGGGGGGAGGCGGG + Intronic
934573947 2:95389006-95389028 CAGGCTGAGGAGGGGTAGTCTGG + Intergenic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
935065148 2:99641037-99641059 CAGGGTGGACAGGGAGTGGCAGG - Intronic
937264432 2:120607070-120607092 CAGGCTGAGCCAGAGGAGGCTGG + Intergenic
937993558 2:127677139-127677161 TTGGCTGAACTGTGGGAGGCTGG - Intronic
938722202 2:134076743-134076765 CTGGCTGCAGTGGGGGAGGCAGG - Intergenic
939630630 2:144523434-144523456 CAAGCTGAGCGGGGGGAGGGGGG - Intronic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
942624453 2:177884518-177884540 TAGGCTGACCATGGGGAGGTGGG + Intronic
944668892 2:201979187-201979209 CAGTCTGAGCAGGGTGTGGCAGG + Intergenic
945460289 2:210100068-210100090 CAGGCTGCACAGCAGGAGGTGGG + Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946336201 2:219038334-219038356 CAGGCAGAGCAGGGTGTGGCAGG - Intronic
946366202 2:219250606-219250628 CAGGCACCACAGTGGGAGGCTGG + Exonic
946369465 2:219271860-219271882 CAGGCACCACAGTGGGAGGCTGG - Intronic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948186786 2:236027515-236027537 CAGTCTGCCCTGGGGGAGGCAGG - Intronic
1169068199 20:2706314-2706336 CACTCAGACCAGGGGGAGGCAGG - Intronic
1169313840 20:4571515-4571537 TTGGCTGAAAAGTGGGAGGCGGG + Intergenic
1170657742 20:18305588-18305610 AAGGCTGCCCTGGGGGAGGCAGG - Intronic
1172031497 20:31985181-31985203 CAGAGTGAACAGGGTGGGGCTGG - Intronic
1172114999 20:32568529-32568551 CAGGAAGAACATGGGGAGGGAGG - Intronic
1172301746 20:33855312-33855334 CAGGCTGAGCGGGTGGAAGCTGG - Intergenic
1172486406 20:35300597-35300619 CTGGCTGACCTGGGGGAGGGAGG + Intergenic
1172775047 20:37402409-37402431 CAGGCGGAACCGTGGGAGCCTGG - Intronic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1174283960 20:49459165-49459187 ATGGCTGGACACGGGGAGGCAGG + Intronic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1174461844 20:50688865-50688887 CAGGATGAACTGGGGGACCCTGG + Intronic
1174484534 20:50852874-50852896 CAGGCTGGGCAGGGAGAGGTGGG - Intronic
1175229451 20:57464429-57464451 CAGGCTGAAGCGGGGGAGGCTGG + Intergenic
1175811644 20:61861619-61861641 CAGCTTGAACAAGTGGAGGCTGG + Intronic
1175893373 20:62325091-62325113 CAGGCGGATGAGGGGCAGGCAGG + Intronic
1175989943 20:62783616-62783638 CAGCCTGCCCAGGGGGAGCCGGG - Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177810003 21:25915462-25915484 GGGGCTGAACATGGGAAGGCTGG - Intronic
1179356218 21:40662895-40662917 CAGCCTGAACAGGGTAAGGTAGG + Intronic
1179450637 21:41466313-41466335 CAGGCTGAGCATGGCGGGGCAGG + Intronic
1179656981 21:42851786-42851808 GAGGCTGAGCAGGGGCAGGATGG - Intronic
1179714907 21:43281619-43281641 CAGGATGAACATCGGGAGGAGGG - Intergenic
1180036881 21:45254688-45254710 AAGGGTGAACAGAGGCAGGCAGG + Intergenic
1180160175 21:45995680-45995702 CAGGCTGCACAGGGGCTGGTGGG + Intronic
1181271540 22:21661467-21661489 CATGCTTACCAGGGGGAGCCAGG + Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181602676 22:23961466-23961488 CCGGCTGGACAGGGAGAAGCAGG + Intergenic
1181605838 22:23979841-23979863 CCGGCTGGACAGGGAGAAGCAGG - Intronic
1182676351 22:32042637-32042659 CAGGCTGTGGAGGGGGAGTCAGG + Intergenic
1183255581 22:36759474-36759496 CAGGGTGCACAGGGACAGGCTGG + Intronic
1183323229 22:37177642-37177664 CAGGCTGCAGAGGGTGAAGCTGG - Intergenic
1183411114 22:37655508-37655530 GAGGCTGGACCTGGGGAGGCCGG - Exonic
1183921863 22:41176291-41176313 CAGGATCAACAATGGGAGGCAGG - Exonic
1183951114 22:41353669-41353691 GAGGCTGACCAGGGTGTGGCAGG + Intronic
1184258759 22:43302482-43302504 CAGGCAGGGCAGGGGGCGGCTGG + Intronic
1184388344 22:44188819-44188841 CAGGCTGATCAAGGTGAGGTGGG + Intronic
1185012796 22:48325028-48325050 CAGGCAGAACTGGGTGTGGCTGG - Intergenic
1185088979 22:48755460-48755482 CAGGCTGATCAGGGGGAGCCAGG + Intronic
1185388071 22:50545627-50545649 CAGGCTGAAGAGGGAGACCCTGG - Intergenic
950428047 3:12935210-12935232 CAGGCTGAGCAGGGGCAGAATGG - Intronic
952227680 3:31395741-31395763 CTAGCTCAACAGGTGGAGGCAGG + Intergenic
952301302 3:32106642-32106664 AAGGCTGAACAGGCGGAGGTGGG + Exonic
952520461 3:34151836-34151858 CATACAGAACAGGGGGATGCTGG - Intergenic
952858878 3:37795691-37795713 CAGGCTGAGCTGGGGAAGGCAGG - Intronic
953386484 3:42509175-42509197 CAGGCTGGATAAGGTGAGGCAGG - Intronic
953838166 3:46365912-46365934 CAAGCTGAGCAGGGGGAGTGGGG - Intergenic
954291755 3:49653634-49653656 GAGGCTGAGCTGGGGGAGGCAGG - Exonic
954748480 3:52800458-52800480 CAGGCTGGAGCGGAGGAGGCCGG - Intronic
955380655 3:58435253-58435275 AAGGCAGAACAGGCGGATGCTGG + Intergenic
956988848 3:74738804-74738826 TTGGCTGAAAAGGGGGAGGAGGG - Intergenic
957444280 3:80294883-80294905 GAGGCTGAGGTGGGGGAGGCGGG - Intergenic
959734043 3:109637363-109637385 GAGGCTGAAGAGTGGGAGGAGGG - Intergenic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
960640390 3:119817390-119817412 CAGACTGAACTGGGGGTGGGGGG - Exonic
961387289 3:126529890-126529912 CAGACAGAACAGGGAGAGCCAGG - Intronic
961430709 3:126880894-126880916 CAGGCTGTTGAGGTGGAGGCTGG + Intronic
961441204 3:126954342-126954364 CAGGCTGACCATGGGGAGAGGGG + Intronic
961662304 3:128475881-128475903 CAGCCAGAGCTGGGGGAGGCTGG - Intergenic
961813674 3:129536484-129536506 CAGGCTGAATGGGGAGAGGTAGG + Intergenic
961885621 3:130094558-130094580 CAGGGGGAACAGGGGTGGGCGGG + Intronic
962256578 3:133874020-133874042 TAGGCTGAAGAGGAGGAGGAAGG + Intronic
962600858 3:136989989-136990011 CAGGGTGAAGAGGTAGAGGCAGG + Intronic
962626845 3:137234197-137234219 AAGGCTTAACTGGGGGAGGATGG - Intergenic
963848308 3:150181870-150181892 CTGGCTGAGCAGGGGGAATCAGG + Intergenic
966054002 3:175659896-175659918 CAGCCTGAACAGACTGAGGCAGG - Intronic
966835851 3:184048940-184048962 CAGTCAGAACAGGGGGTGGGAGG + Intergenic
968083566 3:195863783-195863805 CAGGCTGGACCTGGGCAGGCGGG - Exonic
968994814 4:3938701-3938723 CAGGGGGAACAGGGGTGGGCAGG + Intergenic
969350784 4:6596849-6596871 CAGGCTGCACTGGGGCAGGTGGG - Intronic
969391213 4:6892497-6892519 GAAGCTGAACAGGGCGTGGCGGG + Intergenic
969517275 4:7654707-7654729 CAGGCTGAGCAGTGGAAGGGGGG - Intronic
969688452 4:8689967-8689989 CTGGCTGCACAGGTGGAGTCTGG + Intergenic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
971137938 4:23890136-23890158 CAAGCTGCACAGGGGAAGGGAGG - Intronic
972374285 4:38456288-38456310 CAGGCTGTGCAGGTGCAGGCAGG + Intergenic
975022668 4:69508703-69508725 GAGGCTGAAGAGCGGGAGGAGGG + Intronic
975390164 4:73806951-73806973 CAGACTGAACAGGCAAAGGCTGG + Intergenic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
979231638 4:118353566-118353588 CCGGCTGGAAAGTGGGAGGCAGG - Intergenic
979616319 4:122746847-122746869 GAGGCTAAACAGTGTGAGGCAGG - Intergenic
980481154 4:133389284-133389306 CAGACTGAACAGAGGTAGCCTGG + Intergenic
980638308 4:135538783-135538805 CAGGGTGAACAGGGTGATGGTGG - Intergenic
980717355 4:136644373-136644395 CAGGAAGAAAAGGGGGAGGTTGG - Intergenic
982670502 4:158314345-158314367 GAGGCTGAAGAGGGAGAAGCTGG - Intergenic
984355763 4:178655203-178655225 CAGGAGGAAGAGGGAGAGGCGGG - Intergenic
984812563 4:183807691-183807713 GAGGCTGAGCTGGGGGAGGTGGG + Intergenic
985475281 5:75391-75413 CTGGCTGCAGAGGGCGAGGCGGG + Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985647898 5:1093711-1093733 CACCCTGAACACGGGGAGGGAGG - Intronic
985759317 5:1737061-1737083 CACTCTGAACATGGGGAGCCTGG + Intergenic
985992873 5:3577919-3577941 CAGTTTGGACAGGTGGAGGCTGG - Intergenic
986317589 5:6600918-6600940 CTGGCTGGACAGGTGGAGCCTGG - Intronic
986591401 5:9374737-9374759 TTGGCTGAAGAGGGGTAGGCAGG - Intronic
986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG + Intergenic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
989173239 5:38494323-38494345 CTGGCTGACCAGGGGTAGGGTGG + Intronic
989517556 5:42361083-42361105 ATGCCTGAACAAGGGGAGGCAGG - Intergenic
990161469 5:52944400-52944422 GAGGCTGAAGAGGGAGAAGCTGG - Intronic
991085781 5:62647251-62647273 CAGGCTAAGCAGGGGGAGTTGGG - Intergenic
992848596 5:80780510-80780532 CAGGCTCACCATGGGCAGGCTGG - Intronic
994505821 5:100641834-100641856 CAGTTTGCACAGGGAGAGGCAGG - Intergenic
994784043 5:104132832-104132854 CATGCTGAAGAGGAGGAAGCTGG - Intergenic
995593330 5:113722706-113722728 GAGGCTGGACATGGGGAGGTTGG + Intergenic
996713732 5:126569049-126569071 CAGGCTGCACAGCAGGAGGTAGG + Intronic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
997748447 5:136320633-136320655 CAGGGAGAAAATGGGGAGGCTGG - Intronic
997825264 5:137100617-137100639 CAGGCTGTACAATGGCAGGCAGG - Intronic
999128076 5:149261365-149261387 CAGCCTCAACAGGGGGAACCAGG + Intergenic
999652641 5:153782767-153782789 CAGGCGGAAGACGGGGAGGAAGG + Intronic
1000772683 5:165376339-165376361 CAAGCTGCTGAGGGGGAGGCTGG + Intergenic
1001081832 5:168672920-168672942 AAGGGTGAGAAGGGGGAGGCAGG - Intronic
1001350917 5:170963734-170963756 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1001949351 5:175805572-175805594 CCGGCTCATCAGGTGGAGGCTGG - Intronic
1001975845 5:175997709-175997731 CAGTCTGTACAGGCGGAGCCAGG + Intronic
1002048487 5:176555524-176555546 CGGGCTGAACTGGGGGCAGCAGG - Intronic
1002241580 5:177846063-177846085 CAGTCTGTACAGGCGGAGCCAGG - Intergenic
1002427589 5:179185363-179185385 CCGCCTGAGCAGGGAGAGGCTGG + Intronic
1002466591 5:179411838-179411860 CTGGCGGAGCAGGAGGAGGCTGG - Intergenic
1002478978 5:179486825-179486847 CACGGTGAAGAGGGGGCGGCAGG - Intergenic
1003062931 6:2876422-2876444 CAGTCTGCACAAGGGGAGGGAGG + Intergenic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003482402 6:6545937-6545959 CAGGCTGAGCTGGGGGTGGGGGG + Intergenic
1004173202 6:13315248-13315270 TAGGCTGAGCAGGAGGAGGGAGG - Intronic
1004501675 6:16215717-16215739 CATGCTTATCAGGGGCAGGCAGG - Intergenic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005959359 6:30684868-30684890 GAGGCTGAGAAGGAGGAGGCGGG - Exonic
1006558578 6:34889572-34889594 CAGACTGGAGAGGGGGTGGCTGG - Exonic
1006625122 6:35392414-35392436 CAGTCTGGGCAGGCGGAGGCTGG - Intronic
1006817498 6:36862350-36862372 CAGGCTGTGGAGGAGGAGGCTGG - Intronic
1007147132 6:39647368-39647390 CAAGCTCAAGAGGGGCAGGCAGG + Intronic
1007576031 6:42925649-42925671 CAGCCTGCAGAGGAGGAGGCAGG - Exonic
1007654779 6:43445522-43445544 CAGGCAGCACTGGGGGAGGTGGG - Intronic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1012637937 6:101570470-101570492 CAGGGGGAGAAGGGGGAGGCTGG - Intronic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1013437718 6:110128767-110128789 CAGGCTGTACAGCAGGAGGTGGG + Intronic
1013637691 6:112044699-112044721 GAGGCTGGACTGGGGGAGGTAGG + Intergenic
1017428030 6:154342624-154342646 GGGGCTGAGGAGGGGGAGGCAGG + Intronic
1017483351 6:154880044-154880066 CATGCTGACCAGGAGGAAGCCGG - Intronic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018908761 6:168089979-168090001 CAGCCTGAGCAGGTGGAGGATGG - Intergenic
1018931323 6:168242151-168242173 CTGTCTGAGCAGGGGTAGGCTGG + Intergenic
1019219661 6:170463728-170463750 CAGGCTGGGCCGGGGCAGGCAGG - Intergenic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019271923 7:154279-154301 CAGGCTGCTCTCGGGGAGGCTGG - Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019355535 7:576909-576931 CAGGCCGAAAAGCAGGAGGCTGG - Intronic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019453508 7:1112385-1112407 CAGAGTGAGCAGGTGGAGGCCGG - Intronic
1019706047 7:2497838-2497860 CAGGAGGAACAGGGGGTGACGGG + Intergenic
1019729545 7:2622670-2622692 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019729556 7:2622695-2622717 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1020280260 7:6646702-6646724 CAGGGAGCACTGGGGGAGGCGGG - Intronic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1022310746 7:29194305-29194327 ACTGCTGGACAGGGGGAGGCGGG - Intronic
1022427642 7:30284485-30284507 GAGGCGGAGCAGGGGCAGGCAGG + Exonic
1023375476 7:39551205-39551227 TAGGCTGAAGAGGAGGAAGCGGG - Intergenic
1024968179 7:55043937-55043959 CAGGTTGAACAAGCTGAGGCAGG - Intronic
1026024187 7:66732052-66732074 CAGGCTGGGCTGGGGGTGGCTGG - Intronic
1026578521 7:71594650-71594672 CAGGCAGAAGGGGAGGAGGCAGG + Intronic
1026888911 7:73970944-73970966 CAGGCTGGGCTGGGGGTGGCAGG - Intergenic
1028585496 7:92447649-92447671 CGGGCCGACCAGGGGGCGGCCGG + Exonic
1029352400 7:100023549-100023571 CAGGCTGCACAGGAGAAGGATGG + Exonic
1030287035 7:107837441-107837463 CTGGCTGGACAGGGAGAGGTGGG - Intergenic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032220069 7:129987886-129987908 CAGGCTGTACAGGGGGATTGAGG + Intergenic
1032384037 7:131509209-131509231 CAGGCTAACCAGGGAGAGGGAGG + Intronic
1033269005 7:139913893-139913915 GAGGGTGAGCAGGGAGAGGCTGG - Intronic
1035162513 7:156961374-156961396 CAGTCTGAAGAGGAGGGGGCTGG + Intronic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1036125396 8:6057484-6057506 CAGGCAGAGCAGGGCGGGGCTGG - Intergenic
1036294937 8:7528188-7528210 CAGGCAGGACAGGGAGAGCCTGG - Intergenic
1036296572 8:7542769-7542791 CAGGCAGGACAGGGAGAGCCTGG - Intergenic
1036325994 8:7778250-7778272 CAGGCAGGACAGGGAGAGCCTGG + Intergenic
1036327626 8:7792803-7792825 CAGGCAGGACAGGGAGAGCCTGG + Intergenic
1037742490 8:21618574-21618596 CAGGCTGCACAGCAGGAGGTGGG + Intergenic
1038196612 8:25373917-25373939 GAGGCTGTACAGGAAGAGGCAGG + Intronic
1038828628 8:31033384-31033406 CAGGCTGTGCCGGGGGAGGCGGG - Exonic
1041670325 8:60485299-60485321 CAGCCTGTATAGGGGAAGGCAGG + Intergenic
1041711228 8:60896333-60896355 GAGGCTGAACAGTGGGAGTATGG - Intergenic
1042807664 8:72789509-72789531 CAGGTAGAGAAGGGGGAGGCAGG + Intronic
1044480809 8:92685735-92685757 TGGGGTGAAAAGGGGGAGGCAGG - Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044934210 8:97277678-97277700 CAGGCGGCACAGGTGCAGGCTGG - Exonic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1045689617 8:104746812-104746834 CTGGCTTAACAGAGGGAGGTAGG + Intronic
1045993265 8:108334683-108334705 TAGGCTGAAGAGGAGGAGGAGGG - Intronic
1047021212 8:120776698-120776720 CAGGCTTATGAGGGGGAAGCAGG - Intronic
1047192810 8:122693672-122693694 CAGCCTGAACATAGAGAGGCAGG + Intergenic
1047339379 8:123966084-123966106 CAGGAAGCACTGGGGGAGGCTGG - Intronic
1048904466 8:139074607-139074629 CAGGCAATACAGGGTGAGGCTGG - Intergenic
1048962753 8:139594104-139594126 CAGACTGTACAGTGAGAGGCAGG + Intergenic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049404321 8:142444944-142444966 CAGGCTGAGCTGGGGGTGGGAGG + Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049795584 8:144495993-144496015 CAGTCAGGACAGGAGGAGGCGGG + Intronic
1050377041 9:4984722-4984744 CAGCCTGCACTGGAGGAGGCCGG - Intergenic
1050582136 9:7070042-7070064 CAGGCAGAACAGGGGGAAAAGGG + Intronic
1051338868 9:16092896-16092918 CAGGCTGCACAGGGCCAGCCGGG - Intergenic
1051626241 9:19102472-19102494 GAGCCTGAACCGGGGGACGCCGG - Intronic
1051689578 9:19696012-19696034 CAGGCTGCACAGCAGGAGGTGGG + Intronic
1053440203 9:38109727-38109749 CAGGCTGAAGAGAGGGCAGCTGG + Intergenic
1056172147 9:83996754-83996776 CAGGCTGTACAGGAGCAGGCTGG + Intronic
1056934949 9:90909283-90909305 AAGGCTGAGAATGGGGAGGCAGG - Intergenic
1057125583 9:92613618-92613640 CATGCGGACCGGGGGGAGGCAGG - Exonic
1058040743 9:100298803-100298825 CAGGCTGATCAGGGAGTGGTGGG + Intronic
1058228740 9:102399214-102399236 TAGGCTGAAGAGGGGGAGTGGGG + Intergenic
1060940798 9:127541913-127541935 CAAGCCCAACAGGGTGAGGCAGG + Intronic
1061291649 9:129653798-129653820 AGGGCTGAGCAGCGGGAGGCAGG + Intergenic
1061393951 9:130333155-130333177 CATGCTGAACTGGGGCATGCCGG + Intronic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1061492592 9:130954330-130954352 AAGGCTGAAATGAGGGAGGCAGG - Intergenic
1061802472 9:133120090-133120112 CAGGCAGAGCAGGGCGAGGGGGG + Intronic
1061927299 9:133812213-133812235 CTCGCTGCACAGGAGGAGGCGGG + Exonic
1062121580 9:134836676-134836698 GATGCTGGGCAGGGGGAGGCGGG - Intronic
1185612778 X:1402398-1402420 GAGGCTGAATTGGGGGAGGAGGG - Intergenic
1186167562 X:6843200-6843222 CAGGCTAAACAGGGGCACCCTGG + Intergenic
1189215539 X:39320052-39320074 CATGCTGAACTGTGGCAGGCTGG - Intergenic
1189229860 X:39443750-39443772 CAGGCTTGAGAGGGTGAGGCGGG + Intergenic
1189263349 X:39694007-39694029 CAGGCTGAAAAGGAGGTGCCTGG - Intergenic
1189309422 X:40009281-40009303 CAGGCGGAAGCGGGGGAGGGCGG + Intergenic
1190643555 X:52503811-52503833 CAGGCCCAACAGGGGTAGCCTGG + Intergenic
1190881676 X:54496111-54496133 CAGGCTGAAGCTGGGGAGGACGG - Exonic
1192554353 X:72078139-72078161 CAGGCTGTAAATGGTGAGGCTGG + Intergenic
1192698903 X:73447339-73447361 CAGGCGGCACAGGGGGCGGTGGG + Exonic
1197209169 X:123815257-123815279 CAGGCAGAAGAGAGGGAGGGAGG - Intergenic
1197764300 X:130049949-130049971 CAGGCTTAAAAGGGAGAAGCAGG + Intronic