ID: 1132805626

View in Genome Browser
Species Human (GRCh38)
Location 16:1773792-1773814
Sequence TCGGGTCCACCGCAGGCTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132805626_1132805644 29 Left 1132805626 16:1773792-1773814 CCCGCAGCCTGCGGTGGACCCGA 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1132805644 16:1773844-1773866 GAGTGGTCGCGGGTTCCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 40
1132805626_1132805639 18 Left 1132805626 16:1773792-1773814 CCCGCAGCCTGCGGTGGACCCGA 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1132805639 16:1773833-1773855 CCCCGCAGCGTGAGTGGTCGCGG 0: 1
1: 0
2: 1
3: 2
4: 84
1132805626_1132805643 28 Left 1132805626 16:1773792-1773814 CCCGCAGCCTGCGGTGGACCCGA 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1132805643 16:1773843-1773865 TGAGTGGTCGCGGGTTCCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 63
1132805626_1132805641 19 Left 1132805626 16:1773792-1773814 CCCGCAGCCTGCGGTGGACCCGA 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1132805641 16:1773834-1773856 CCCGCAGCGTGAGTGGTCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1132805626_1132805635 12 Left 1132805626 16:1773792-1773814 CCCGCAGCCTGCGGTGGACCCGA 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1132805635 16:1773827-1773849 CCCTGCCCCCGCAGCGTGAGTGG 0: 1
1: 0
2: 1
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132805626 Original CRISPR TCGGGTCCACCGCAGGCTGC GGG (reversed) Exonic
900830236 1:4960372-4960394 TCCTGTCCACCCCAGGCTGGTGG - Intergenic
902786020 1:18733256-18733278 TCGGGTCAACAGTAGGGTGCTGG - Intronic
914748285 1:150515190-150515212 TCGGGTCCAGCTCAGGTTGGGGG - Intergenic
921850402 1:219927894-219927916 TCGGGTCCGCCGCGCGCCGCGGG + Exonic
923657551 1:235931394-235931416 TAGTCTCCACTGCAGGCTGCAGG - Intergenic
1064965296 10:21009928-21009950 TAAGGGCTACCGCAGGCTGCTGG + Intronic
1067346160 10:45440603-45440625 TGGGGTGCACAGCAGGCAGCTGG - Exonic
1072321134 10:94251264-94251286 TGGGATCCACAGCAGGATGCAGG + Intronic
1075844850 10:125536905-125536927 TCGGGTACCTCCCAGGCTGCTGG + Intergenic
1076826163 10:132970790-132970812 TCGTGCCCACCCCAGGCAGCAGG - Intergenic
1081815413 11:45937110-45937132 TCCGCTGCACCACAGGCTGCAGG + Intronic
1087006736 11:93478985-93479007 TGGGGTCCGCAGCCGGCTGCGGG + Exonic
1087086440 11:94223526-94223548 TAGGGTACACCAGAGGCTGCAGG - Intergenic
1096088484 12:48882636-48882658 TCTGCTCCACCTCAGGCTGCTGG - Intergenic
1104679450 12:130739455-130739477 TCAGTTCCACCTCAGGCTGCAGG - Intergenic
1104913333 12:132250886-132250908 ACAGGTCCACCGCAGGCCTCCGG - Intronic
1105012733 12:132766520-132766542 CCGGCTCCACCACTGGCTGCCGG - Intergenic
1119318302 14:73713898-73713920 TCGGGTCCGCCGCCTGCAGCAGG + Exonic
1121242304 14:92439658-92439680 CTGGGTCCACAGCAGGCTGTTGG + Intronic
1122075280 14:99231519-99231541 TGGGGGCCACCGCTGGCAGCTGG + Exonic
1122153666 14:99737932-99737954 CTGGGGCCCCCGCAGGCTGCAGG + Intronic
1130427204 15:83813309-83813331 AGGGATCCACCCCAGGCTGCTGG - Intronic
1132309929 15:100849919-100849941 TCGGCTCTCCCGCAGGCTGCGGG - Intergenic
1132461762 16:58912-58934 ACAGGTTCACAGCAGGCTGCAGG + Intronic
1132662456 16:1067672-1067694 TTGGGTTCAACGGAGGCTGCGGG + Intergenic
1132805626 16:1773792-1773814 TCGGGTCCACCGCAGGCTGCGGG - Exonic
1134235501 16:12462193-12462215 CAGGGTCCAGCCCAGGCTGCAGG - Intronic
1139437368 16:66943908-66943930 CCCGGCCCACCGCAGGCTGTAGG - Exonic
1142977060 17:3651512-3651534 TCGGGGCCAGCGGAGGCTGGAGG + Intronic
1143863308 17:9906633-9906655 GTGGGTCCATGGCAGGCTGCAGG + Intergenic
1147237959 17:39071608-39071630 TCAGAGCCACTGCAGGCTGCGGG - Intronic
1152061831 17:78082090-78082112 CCTGTTGCACCGCAGGCTGCTGG - Intronic
1152252732 17:79220208-79220230 GCGGCTCCACAGCAGGCTCCCGG + Intronic
1152632719 17:81417762-81417784 TCTGGGCCAGCGCAGGCTTCTGG + Intronic
1160795397 19:942945-942967 TTGGGGCCACCGTACGCTGCAGG - Intronic
1160890747 19:1377548-1377570 TCTGGTCCACAGCACGGTGCCGG + Exonic
1161073898 19:2275808-2275830 GCGGGTGCGCCGCGGGCTGCTGG - Exonic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1165715975 19:38046204-38046226 GCTGGTCCATCCCAGGCTGCTGG + Intronic
1166366268 19:42280111-42280133 GCGGCTGCACCGCAGGCGGCTGG + Intronic
925802359 2:7613981-7614003 TGGGGTGCATGGCAGGCTGCAGG - Intergenic
927990643 2:27444576-27444598 TCAGCTCCATCGCAGGCTTCAGG + Intronic
928172869 2:29014596-29014618 TGGAGTGGACCGCAGGCTGCAGG + Intronic
928949778 2:36804393-36804415 TCAGGCTCACCCCAGGCTGCAGG + Intronic
932435400 2:71700209-71700231 CCGGGTCCACCTCTGGCTCCTGG - Intergenic
936454796 2:112664587-112664609 TCTGGTCAACCGTAGGCTACTGG - Intergenic
945074054 2:206019792-206019814 ACGGTTCCACTGCATGCTGCTGG + Exonic
946194749 2:218026475-218026497 TCGGGCCCAGAGCAGGCTCCTGG - Intergenic
948403661 2:237702039-237702061 TGGGCTCCACAGCAGGCTGTGGG + Intronic
1174157790 20:48528044-48528066 GCGGCTCCTCCTCAGGCTGCAGG + Intergenic
1174606834 20:51767733-51767755 TCGGGTCCACCCCGGGCGGAGGG + Intronic
1175994515 20:62806039-62806061 CAGGGTCCAGCGCAGGCAGCTGG - Intronic
1177092081 21:16781790-16781812 GCAGGTCTACCGGAGGCTGCTGG - Intergenic
1180066529 21:45415297-45415319 CCAGGGCCACCCCAGGCTGCAGG + Intronic
1182353722 22:29712806-29712828 TGGCCTCCACCCCAGGCTGCAGG - Intergenic
1184728785 22:46361901-46361923 TCGGGCCCACTGCAGGCAGCTGG - Exonic
1185317896 22:50186564-50186586 CCGGCTCCACCGCAGGCGGCAGG - Intronic
950556563 3:13699496-13699518 TCTGTTCCACCCCTGGCTGCAGG + Intergenic
950659297 3:14456883-14456905 ACCTGTCCACCACAGGCTGCTGG - Intronic
951568212 3:24034394-24034416 TTTTGTCCACAGCAGGCTGCAGG + Intergenic
954258127 3:49420235-49420257 TGGTGTCCAACGCTGGCTGCTGG - Exonic
960247359 3:115414258-115414280 TAGGGTCCATCGCAGGCTCCTGG - Intergenic
961325568 3:126107331-126107353 TCGGGTCATCCGCAGGTGGCTGG - Intronic
968756475 4:2418687-2418709 CCGGGCCCACCGCGCGCTGCGGG + Intergenic
969477448 4:7429646-7429668 CCGGGTCCTCCGCAGGATGGAGG - Intronic
981516780 4:145618980-145619002 TCCCGGCCGCCGCAGGCTGCTGG + Exonic
985125826 4:186693484-186693506 ACGGGTCCAGGACAGGCTGCGGG + Intronic
992157732 5:73971542-73971564 GCGGCTCCTGCGCAGGCTGCAGG - Intergenic
997815927 5:137017020-137017042 TGGGGGCCACAGCATGCTGCAGG - Intronic
998404101 5:141863864-141863886 TCTGGCCAACCGCACGCTGCTGG - Exonic
1004360634 6:14967780-14967802 CAGGGTCCACCTCAGGCTACTGG - Intergenic
1005819737 6:29588076-29588098 TGGGGTCCAGCGCAGACAGCAGG - Exonic
1006941775 6:37756414-37756436 TCGGGGCCATCCCGGGCTGCAGG + Intergenic
1019313030 7:371959-371981 TCGGATCCAATGCAGGCTACAGG + Intergenic
1019566024 7:1679462-1679484 TGGGGTCCCCTGCAGGTTGCTGG + Intergenic
1020353714 7:7253741-7253763 ACGGGTCCACATGAGGCTGCTGG - Intergenic
1023834197 7:44058898-44058920 TCGGGTGCACGGCAGACTCCTGG - Exonic
1024177983 7:46860826-46860848 TCAGCTCCTCCGCAGGGTGCTGG - Intergenic
1026906705 7:74066870-74066892 TGGGGTCCACCCCTGGGTGCTGG - Intronic
1029330336 7:99848298-99848320 TCAGCTCCACTGCAGGCAGCTGG - Intronic
1029372333 7:100157920-100157942 TCGGTTCCTCCACAGGCAGCTGG + Exonic
1034393001 7:150800684-150800706 TCGGGTTCATGACAGGCTGCAGG - Exonic
1035600472 8:894203-894225 CCGTGTCCACCTCAGGCTGCAGG - Intergenic
1037759779 8:21734108-21734130 GCCGGTCCACTGCACGCTGCAGG - Intronic
1041108703 8:54466405-54466427 TCGGGTCCCGGGCGGGCTGCGGG + Intergenic
1047288512 8:123508589-123508611 TCGGTTCTACCCCAGGCTGCTGG + Intronic
1057802017 9:98196483-98196505 TGGGCTCCACCACAGGCTCCAGG + Intergenic
1062465112 9:136677477-136677499 GCGGGACCCGCGCAGGCTGCAGG - Exonic
1186085126 X:5979460-5979482 TAGAGTCCACCCCAAGCTGCTGG - Intronic