ID: 1132807612

View in Genome Browser
Species Human (GRCh38)
Location 16:1782330-1782352
Sequence GGAACCCGCGCGCCCGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 95}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132807612_1132807622 9 Left 1132807612 16:1782330-1782352 CCTCCCGCGGGCGCGCGGGTTCC 0: 1
1: 0
2: 1
3: 15
4: 95
Right 1132807622 16:1782362-1782384 GGCACCGGGGAAGCCTCTCTCGG 0: 1
1: 0
2: 2
3: 18
4: 121
1132807612_1132807619 -5 Left 1132807612 16:1782330-1782352 CCTCCCGCGGGCGCGCGGGTTCC 0: 1
1: 0
2: 1
3: 15
4: 95
Right 1132807619 16:1782348-1782370 GTTCCGGAGTCGGCGGCACCGGG 0: 1
1: 0
2: 0
3: 6
4: 54
1132807612_1132807620 -4 Left 1132807612 16:1782330-1782352 CCTCCCGCGGGCGCGCGGGTTCC 0: 1
1: 0
2: 1
3: 15
4: 95
Right 1132807620 16:1782349-1782371 TTCCGGAGTCGGCGGCACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 41
1132807612_1132807623 10 Left 1132807612 16:1782330-1782352 CCTCCCGCGGGCGCGCGGGTTCC 0: 1
1: 0
2: 1
3: 15
4: 95
Right 1132807623 16:1782363-1782385 GCACCGGGGAAGCCTCTCTCGGG 0: 1
1: 0
2: 5
3: 45
4: 428
1132807612_1132807618 -6 Left 1132807612 16:1782330-1782352 CCTCCCGCGGGCGCGCGGGTTCC 0: 1
1: 0
2: 1
3: 15
4: 95
Right 1132807618 16:1782347-1782369 GGTTCCGGAGTCGGCGGCACCGG 0: 1
1: 0
2: 0
3: 6
4: 63
1132807612_1132807625 15 Left 1132807612 16:1782330-1782352 CCTCCCGCGGGCGCGCGGGTTCC 0: 1
1: 0
2: 1
3: 15
4: 95
Right 1132807625 16:1782368-1782390 GGGGAAGCCTCTCTCGGGCGCGG 0: 1
1: 0
2: 1
3: 3
4: 94
1132807612_1132807627 23 Left 1132807612 16:1782330-1782352 CCTCCCGCGGGCGCGCGGGTTCC 0: 1
1: 0
2: 1
3: 15
4: 95
Right 1132807627 16:1782376-1782398 CTCTCTCGGGCGCGGCCCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 91
1132807612_1132807628 28 Left 1132807612 16:1782330-1782352 CCTCCCGCGGGCGCGCGGGTTCC 0: 1
1: 0
2: 1
3: 15
4: 95
Right 1132807628 16:1782381-1782403 TCGGGCGCGGCCCTCCGGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132807612 Original CRISPR GGAACCCGCGCGCCCGCGGG AGG (reversed) Intronic