ID: 1132808384

View in Genome Browser
Species Human (GRCh38)
Location 16:1786340-1786362
Sequence CCCTGCAGCCCCAGACCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 507}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132808384_1132808400 20 Left 1132808384 16:1786340-1786362 CCCCCGGGTCTGGGGCTGCAGGG 0: 1
1: 0
2: 5
3: 43
4: 507
Right 1132808400 16:1786383-1786405 CATCGGGGCGAAGTGGGGCACGG 0: 1
1: 0
2: 1
3: 7
4: 96
1132808384_1132808397 13 Left 1132808384 16:1786340-1786362 CCCCCGGGTCTGGGGCTGCAGGG 0: 1
1: 0
2: 5
3: 43
4: 507
Right 1132808397 16:1786376-1786398 GTCTTTACATCGGGGCGAAGTGG 0: 1
1: 0
2: 0
3: 0
4: 39
1132808384_1132808391 -9 Left 1132808384 16:1786340-1786362 CCCCCGGGTCTGGGGCTGCAGGG 0: 1
1: 0
2: 5
3: 43
4: 507
Right 1132808391 16:1786354-1786376 GCTGCAGGGGACCTGCCTGGAGG 0: 1
1: 0
2: 5
3: 46
4: 454
1132808384_1132808398 14 Left 1132808384 16:1786340-1786362 CCCCCGGGTCTGGGGCTGCAGGG 0: 1
1: 0
2: 5
3: 43
4: 507
Right 1132808398 16:1786377-1786399 TCTTTACATCGGGGCGAAGTGGG 0: 1
1: 0
2: 0
3: 0
4: 30
1132808384_1132808393 3 Left 1132808384 16:1786340-1786362 CCCCCGGGTCTGGGGCTGCAGGG 0: 1
1: 0
2: 5
3: 43
4: 507
Right 1132808393 16:1786366-1786388 CTGCCTGGAGGTCTTTACATCGG 0: 1
1: 0
2: 0
3: 14
4: 146
1132808384_1132808394 4 Left 1132808384 16:1786340-1786362 CCCCCGGGTCTGGGGCTGCAGGG 0: 1
1: 0
2: 5
3: 43
4: 507
Right 1132808394 16:1786367-1786389 TGCCTGGAGGTCTTTACATCGGG 0: 1
1: 0
2: 2
3: 6
4: 108
1132808384_1132808399 15 Left 1132808384 16:1786340-1786362 CCCCCGGGTCTGGGGCTGCAGGG 0: 1
1: 0
2: 5
3: 43
4: 507
Right 1132808399 16:1786378-1786400 CTTTACATCGGGGCGAAGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 28
1132808384_1132808401 21 Left 1132808384 16:1786340-1786362 CCCCCGGGTCTGGGGCTGCAGGG 0: 1
1: 0
2: 5
3: 43
4: 507
Right 1132808401 16:1786384-1786406 ATCGGGGCGAAGTGGGGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 75
1132808384_1132808395 5 Left 1132808384 16:1786340-1786362 CCCCCGGGTCTGGGGCTGCAGGG 0: 1
1: 0
2: 5
3: 43
4: 507
Right 1132808395 16:1786368-1786390 GCCTGGAGGTCTTTACATCGGGG 0: 1
1: 0
2: 0
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132808384 Original CRISPR CCCTGCAGCCCCAGACCCGG GGG (reversed) Intronic
900115641 1:1026699-1026721 GTCTGCAGCCCCAGCCCCGCTGG - Intronic
900161741 1:1227274-1227296 TCCTGGAGCACCAGGCCCGGCGG + Intronic
900221457 1:1511610-1511632 CCCTCCCGCCCAAGACCCCGGGG - Intergenic
900388082 1:2419676-2419698 CCTGGCATCCACAGACCCGGGGG + Intergenic
900527174 1:3135027-3135049 TCCAGAAGCCCCTGACCCGGGGG - Intronic
900527186 1:3135058-3135080 TCCAGAAGCCCCTGACCCGGGGG - Intronic
900549394 1:3246548-3246570 CCCTGCAGGCCCAGTCCGAGGGG + Intronic
900550183 1:3250678-3250700 CCCTGCACCCTCAGGCCCTGGGG - Intronic
900600858 1:3502120-3502142 CTCAGCAGCCCCACCCCCGGGGG - Intronic
900739633 1:4322844-4322866 CCCTGCAGACTCTGACCCCGTGG - Intergenic
901470039 1:9449865-9449887 CCCTGCAGGCCGAGACCCCATGG + Intergenic
902400690 1:16155319-16155341 CCCTTCACCTCCAGTCCCGGGGG - Intronic
902514127 1:16980688-16980710 CCCTCCAGCCCCGGAGCCGCTGG + Exonic
902994926 1:20217022-20217044 CCCTGCAGCCCCAAACTCCTGGG + Intergenic
903173754 1:21568930-21568952 CCCAGCTGCCCCAGGCCCGCAGG - Intronic
903220404 1:21865994-21866016 CTCTGTAGCCCCAGACATGGTGG + Intronic
903281447 1:22252353-22252375 GCCTGCAGCCCCCCTCCCGGCGG - Intergenic
904753946 1:32757885-32757907 GCCTGCGGCCCCGGCCCCGGGGG + Intronic
905477522 1:38239403-38239425 CCCAGCTGCCCCAGAGCCCGAGG + Intergenic
905752648 1:40479214-40479236 CCCTGCAGCACCAGGACCTGGGG - Exonic
905797850 1:40825571-40825593 CCCTCCAGCCCCAGACCTGGAGG - Intronic
906149908 1:43581628-43581650 CCCTTCAGCCCCAGCGCCTGGGG + Intronic
906698767 1:47842492-47842514 CCCTCCAGCACCAGCCTCGGTGG + Intronic
906797799 1:48711591-48711613 CCGTGCAGATCCAGCCCCGGGGG - Intronic
910676370 1:89820864-89820886 CCCTGCAGCGCCTGACCGGACGG - Intronic
912369737 1:109164726-109164748 CCCTGTAGCCCCTTACCCAGTGG - Intronic
912828375 1:112927048-112927070 CCCTGCAGCCTCAGCCACCGAGG - Intronic
916651678 1:166839645-166839667 CCCAGCCGCCCGGGACCCGGGGG - Intronic
917817644 1:178725984-178726006 CCCGCCAGCCCCGGCCCCGGAGG + Intronic
919730491 1:200910874-200910896 ACCTGCAGCCCAAGACCGGCAGG - Intronic
920115414 1:203617369-203617391 CCCTGCTGCCCCAGACACTCAGG + Intergenic
920310286 1:205044419-205044441 CCCTCTAGCCCCAGACCCCTGGG + Intronic
921832557 1:219744483-219744505 CACTGCAGCCCCAGACTCCTGGG + Intronic
921945043 1:220880294-220880316 CCCTGCAGCCCCCGGCCTCGGGG + Exonic
922467730 1:225855806-225855828 CACTGCAGCCCCAGCCCCTGTGG + Intronic
922588124 1:226751195-226751217 CCCTGGAACCCCAGTCCCGGCGG - Intergenic
922804827 1:228379872-228379894 CCCTGCAGCCCCAGCCCCCCAGG - Intergenic
1062868289 10:876307-876329 CACTGCAGCCTCTGACCCGCTGG - Intronic
1063174506 10:3539479-3539501 CCAGGCAGCCCCAGAGGCGGCGG + Intergenic
1064110039 10:12530642-12530664 CGCTGCCTCCCCAGACCCCGAGG - Intronic
1064193479 10:13227195-13227217 GCCTGCAGCACCTGACCCAGGGG + Intronic
1064618694 10:17192025-17192047 ACCAGCAGCCCCAGGCCAGGAGG + Intronic
1065304757 10:24357522-24357544 CCCTGCAGCAGCACACCCGCAGG + Intronic
1065687751 10:28302910-28302932 CCCTGCAGCCCCGGGCCCGGAGG + Intronic
1066047398 10:31605160-31605182 TGCTGCAGCCCCAGACCCATTGG - Intergenic
1066283256 10:33938930-33938952 TCCTGCAGCGCCAGCCCCCGTGG + Intergenic
1067103328 10:43349080-43349102 CCCTGCACCCCAAGACATGGTGG + Intergenic
1071019267 10:81032640-81032662 CCCAAAAGCCCCAGACCAGGTGG + Intergenic
1071187197 10:83059097-83059119 CCTTACAGCCCTAGACCCAGAGG + Intergenic
1071568711 10:86684832-86684854 CCCTGCAGTGGCAGACCCTGTGG - Intronic
1071718899 10:88123259-88123281 CCCTGCAGCCCCACTGCAGGAGG - Intergenic
1072952709 10:99861857-99861879 CCCTGCAGCCTCGGCCCCTGGGG + Intergenic
1073179921 10:101577554-101577576 CCCTCCACCCCCAGCCCTGGAGG + Intronic
1073414324 10:103368460-103368482 CCCTGCGGCCCCCGACCCTCCGG + Exonic
1075327643 10:121547468-121547490 CCCTGCAGCCCCAAACTCCTGGG + Intronic
1075702052 10:124476178-124476200 CCCAGCTGACCCAGACCAGGAGG + Intronic
1075741554 10:124699290-124699312 TCCTGCAGCCACACACCCAGTGG + Intronic
1075849135 10:125573488-125573510 CTCAGCAGCCCCAGCCCCTGGGG - Intergenic
1076334013 10:129692868-129692890 AGCTGCAGCCCCAGACCTCGCGG + Intronic
1076372788 10:129965552-129965574 GAGTGCTGCCCCAGACCCGGCGG - Intergenic
1076753822 10:132557720-132557742 CCCTGCAGCCCGAGACACTCGGG - Intronic
1077008158 11:368961-368983 CCCTGCGGCCCCAGCCCTGCAGG + Intergenic
1077066074 11:641412-641434 CAGTGCAGCCCCTGACCCTGGGG + Intergenic
1077203728 11:1329794-1329816 CCCTTGAGCCCCAGAGGCGGAGG + Intergenic
1077327481 11:1969988-1970010 CCCTGCAGCTCCAGCCCTGCAGG + Intronic
1077408029 11:2391340-2391362 CCCTGCAGCTCCAGGCCTGGGGG - Intronic
1077424455 11:2467791-2467813 CCCTGCAGACCCAGGCCAGGTGG + Intronic
1078710429 11:13785777-13785799 CACTGCAGCCTCAAACCCTGGGG - Intergenic
1079359340 11:19757390-19757412 ACCTGCAGCCCCAGAATCTGAGG - Intronic
1082010711 11:47448215-47448237 CACTGCAGGCTCAGACCTGGAGG + Intronic
1082631031 11:55542125-55542147 CACTGCAGCCTCAGACCCCTGGG - Intergenic
1083594488 11:63912361-63912383 CCCTGGAGCCCCAGTCCCCATGG - Exonic
1084204415 11:67583687-67583709 CCCGCCGGCCCCAGCCCCGGCGG - Exonic
1084515982 11:69638237-69638259 ACCTGCAGCCGCATACCTGGCGG - Intergenic
1084564312 11:69920651-69920673 CCCTGCAGCCCCAGCAGCTGAGG - Intergenic
1084693595 11:70740893-70740915 ACCTGCAGCCCCTGGCCAGGTGG + Intronic
1084703357 11:70801886-70801908 CCCTGGAGCCCCAGACTTGCAGG + Intronic
1084792670 11:71484470-71484492 CCCTGCACCCCCACCCCCAGGGG - Intronic
1085153189 11:74268443-74268465 CCCTGCAGCCCCAGGACCTGGGG - Intronic
1085514561 11:77104833-77104855 CCCGGCAGCCCCAGCCACAGGGG - Intronic
1085650209 11:78261156-78261178 GCCTGCAGTCCCAGACTGGGGGG + Intronic
1088585564 11:111357595-111357617 CCCTGCAGCCCCTGGCCCCATGG - Exonic
1088588512 11:111380320-111380342 CCCTTCAGCCACAGAGCTGGAGG + Intronic
1089515696 11:119030295-119030317 CCCTGCAGCCCGAAGCCCGCCGG - Intronic
1089604716 11:119635227-119635249 CTCAGCGGCCCCAGACCGGGTGG - Intronic
1089649054 11:119900355-119900377 ACCTGCAGCCACAGGCCAGGTGG - Intergenic
1089665249 11:120014000-120014022 CCCTGCAGCAGCAGAGCCGTCGG + Intergenic
1089711309 11:120316890-120316912 ACATGCAGCCCCAGACCAAGAGG - Intronic
1090075420 11:123577604-123577626 CCCCGCAGCCCCTGACAAGGAGG - Intronic
1090258822 11:125304210-125304232 AACTGCAGCCCCAGCCCCAGGGG + Intronic
1090265695 11:125351562-125351584 CCCTGCAAACACAGACCCCGAGG + Intronic
1090399229 11:126438140-126438162 CCAGGCAGCCACAGTCCCGGGGG - Intronic
1090423862 11:126593647-126593669 CCGTGCAGGCCCAGACCCCATGG - Intronic
1090667505 11:128924585-128924607 CCCTACAGCCTCAGTCCCTGTGG - Intergenic
1202810463 11_KI270721v1_random:25168-25190 CCCTGCAGCTCCAGCCCTGCAGG + Intergenic
1091402404 12:188993-189015 CTCTGCTGCCCCAGACCCCCTGG - Intergenic
1092769120 12:11881011-11881033 CACTGCAGCCCCAAACCCCTGGG + Intronic
1095089048 12:38087191-38087213 CCCTACAGCCCCAGCCCAGGTGG - Intergenic
1095452102 12:42342328-42342350 CACTGCAGCCTCAGACCCCTGGG + Intronic
1096106327 12:48998608-48998630 CCCTGGAGGCCCAGGGCCGGCGG + Exonic
1096200841 12:49681631-49681653 CCCTGCAGCCCCAAACTCATGGG + Intronic
1096264759 12:50114011-50114033 CACTGCAGCCCCAAACTCGTTGG + Intronic
1096292398 12:50352932-50352954 CTCAGCAGGCCCAGACCCTGGGG - Exonic
1097267625 12:57755244-57755266 CGCTCCAGACCCAGACCCGCGGG + Exonic
1097699030 12:62801784-62801806 CCCTGCTGCCCCAGACTCCCAGG + Intronic
1101976534 12:109364402-109364424 CACTGCAGCCTCAAACTCGGGGG + Intronic
1102099215 12:110264879-110264901 CCCTGCAGTGCCAGACCCCATGG + Intergenic
1102394629 12:112575433-112575455 TCCAGCAGCCCCATTCCCGGAGG - Intronic
1102423860 12:112825091-112825113 CCCTGGAGCCCCCCACCTGGAGG - Intronic
1102518770 12:113466492-113466514 CTCTGCAGCCCCAAAGACGGTGG + Intronic
1103444780 12:120987514-120987536 CCCTGCAGCACCAGAACAGGAGG - Intronic
1104026749 12:125033025-125033047 CGCTGCAGCCCCAGAGCAGCTGG + Intergenic
1104386863 12:128358098-128358120 CCGTGCAGCTCCAGCCCCAGAGG - Intronic
1104856218 12:131903660-131903682 CCCTGCAGCCCCACCCCCAGTGG + Intronic
1104919789 12:132284875-132284897 CCCTGCACCCCTGGACCCTGCGG + Intronic
1107929994 13:45299276-45299298 CCCTGCAGCCCAAGAAAGGGAGG - Intergenic
1108041031 13:46339442-46339464 CCATGCAGGCTCAGACCTGGGGG + Intergenic
1112392681 13:98999524-98999546 TCCTGCAACCCCAGACACGCAGG - Intronic
1113767761 13:112891628-112891650 CCCTGCAGCCTCAGCTCCTGCGG + Intergenic
1113842649 13:113369188-113369210 TCCTGCAGCCCCAGCTCCAGAGG - Intergenic
1114351178 14:21853006-21853028 CCCTGCAGACCCAGGCACTGTGG - Intergenic
1114355632 14:21904598-21904620 CCCTGCAGACCCAGGCACTGTGG - Intergenic
1114678134 14:24459314-24459336 TCCTGTGGCCCCAGACCCTGAGG - Intergenic
1115981162 14:39053017-39053039 CCCAGCAGCTCCAGAGGCGGAGG + Intronic
1119411156 14:74431351-74431373 CCCTGCCTCCCCAGACCCACAGG - Intergenic
1121042012 14:90757366-90757388 CCCTGCAGCCCCAAACTCCTGGG - Intronic
1121637207 14:95461918-95461940 CCCTCCAGCCCCAGACAAAGGGG - Intronic
1122436985 14:101706992-101707014 CTCTGCAGCCCCTGCCCCTGTGG - Intergenic
1122603026 14:102930568-102930590 CCCCGCAGCCCCTGCCGCGGCGG + Exonic
1122675415 14:103408606-103408628 TCTTGCAGCCCCAGGCCTGGTGG - Intronic
1123007574 14:105331490-105331512 CCCTGCAGCCTCAAACTCTGGGG + Intronic
1123665731 15:22608485-22608507 CCCTGGAGCCCCAGGGCCTGGGG - Intergenic
1123752029 15:23364167-23364189 CCCTGGAGCCCCAGGGCCTGGGG + Intronic
1123996413 15:25720999-25721021 CGCTGCAGCCCCAGGCACAGTGG + Intronic
1124284395 15:28388092-28388114 CCCTGGAGCCCCAGGGCCTGGGG + Intronic
1124298302 15:28523522-28523544 CCCTGGAGCCCCAGGGCCTGGGG - Intronic
1124319553 15:28702899-28702921 CCCTGCAGCCCCAGGGCCTGGGG - Intronic
1124469345 15:29969026-29969048 CCCTGCAGGCCGTGGCCCGGCGG + Intergenic
1124482959 15:30092532-30092554 CCCTGGAGCCCCAGGGCCTGGGG + Intronic
1124489411 15:30144603-30144625 CCCTGGAGCCCCAGGGCCTGGGG + Intronic
1124520618 15:30404686-30404708 CCCTGGAGCCCCAGGGCCTGGGG - Intronic
1124538039 15:30561533-30561555 CCCTGGAGCCCCAGGGCCTGGGG + Intronic
1124544499 15:30613594-30613616 CCCTGGAGCCCCAGGGCCTGGGG + Intronic
1124564462 15:30801029-30801051 CCCTGGAGCCCCAGGGCCTGGGG + Intergenic
1124604940 15:31162868-31162890 CACTGCAGCCCTGGACCCGCTGG - Intergenic
1124754117 15:32393724-32393746 CCCTGGAGCCCCAGGGCCTGGGG - Intronic
1124760611 15:32446052-32446074 CCCTGGAGCCCCAGGGCCTGGGG - Intronic
1124778022 15:32603010-32603032 CCCTGGAGCCCCAGGGCCTGGGG + Intronic
1126018254 15:44374023-44374045 CCCTGCAACCTCAGCCCCGTGGG - Intronic
1126403257 15:48296035-48296057 TGATGCAGCCCCAGACCCAGGGG + Intronic
1127877263 15:63122075-63122097 CCCCGCGGCCCCCGACCCTGAGG + Exonic
1128103453 15:65025319-65025341 CACTGCAGCCCCAGACTCAAGGG - Intronic
1128199672 15:65793535-65793557 CGCTTGAGCCCCAGAGCCGGAGG + Intronic
1128211436 15:65905935-65905957 CCCAACAGCCCCAGGCCCTGTGG + Intronic
1128338442 15:66803297-66803319 CACTGCGGCCCCAGCCCAGGAGG + Intergenic
1128604816 15:69028564-69028586 CCCTGCTGCCCCAGAAAGGGGGG - Intronic
1128711006 15:69872032-69872054 CCCTGGAGCCCCAGACTCTAAGG - Intergenic
1128964261 15:72041736-72041758 CCCTACAGCTGCAGAGCCGGTGG + Intronic
1129391643 15:75223832-75223854 CCCTGCAGCCCCACTGCAGGGGG - Intergenic
1129472656 15:75764022-75764044 CCCTGCAGCCCCACTGCAGGGGG + Intergenic
1129738792 15:77979932-77979954 CTCTGTGGCCCCAGCCCCGGGGG - Intergenic
1130254733 15:82320640-82320662 CTCTGTGGCCCCAGCCCCGGGGG - Intergenic
1130600240 15:85269366-85269388 CTCTGTGGCCCCAGCCCCGGGGG + Intergenic
1130978741 15:88797714-88797736 CCTGGCAGCCCCAGCCCCTGAGG - Intergenic
1132669098 16:1095424-1095446 CCCTGCAGGCCCTGCCCTGGGGG - Intronic
1132675072 16:1118136-1118158 CCCTGTAGCCCCAGCCCCCGGGG - Intergenic
1132808384 16:1786340-1786362 CCCTGCAGCCCCAGACCCGGGGG - Intronic
1132838356 16:1965946-1965968 ACCTGCCGCCCCAGAGCAGGGGG - Intergenic
1134527747 16:14957534-14957556 CACTGCAGCCTCAAACCCCGAGG + Intergenic
1135634457 16:24062214-24062236 CCCTCCAGCCCCAGACAAGCTGG - Intronic
1136588488 16:31202727-31202749 CGCTGCAGCCGCCGACCAGGAGG + Exonic
1137426433 16:48384957-48384979 CCCTGGAGCCCCGGGCCCGGCGG - Intronic
1137577048 16:49606909-49606931 CCCTGCAGACCCCCACCCGGTGG - Intronic
1137609589 16:49809812-49809834 CCCTCCAGCCCCAGACCCCCTGG - Intronic
1138377076 16:56571615-56571637 CAATGCTGCCCCAGACCCAGGGG + Intergenic
1140475581 16:75237968-75237990 CCCTGCCGCGCCTGCCCCGGGGG + Intronic
1140859800 16:79008816-79008838 ACCTGCAGCCGGAGACCAGGGGG + Intronic
1141004582 16:80340161-80340183 CCCTAGAGCCCCACACCAGGTGG - Intergenic
1141443284 16:84042855-84042877 CCCTGCAGGCCCGGCCCCGGGGG + Intergenic
1141657395 16:85423452-85423474 CCCTGCCACCCCAGACCAGCTGG - Intergenic
1141657486 16:85423850-85423872 CCCTGCAGCCCCAGCCTCGTGGG + Intergenic
1141868143 16:86765255-86765277 CACTGCAGCCCCAGACTCCCGGG + Intergenic
1142157120 16:88537653-88537675 CCCTGTAGCCGCTGACTCGGTGG + Intergenic
1142177346 16:88651218-88651240 CCCGGCAGCCCCAGCCCAGGCGG + Intergenic
1142198041 16:88747866-88747888 CCCTCCATCTCCAGAGCCGGTGG - Intronic
1142208645 16:88796498-88796520 CCCTGCAGCTTCAGTCCCCGGGG + Intergenic
1142247953 16:88978408-88978430 CCCTCCAGCCTCAGTCCTGGGGG - Intergenic
1142597024 17:1034855-1034877 CCCTTCTCCCCCACACCCGGCGG - Intronic
1143023489 17:3928463-3928485 CCCTGCAGTGCAAGACCCTGCGG + Intronic
1143034447 17:3986382-3986404 CCCAGCAGCCCCAGACACAAAGG + Intergenic
1143036912 17:4004741-4004763 TCCAGGAGCCCCAGGCCCGGAGG - Exonic
1143438766 17:6951579-6951601 CCCTCCAGCCCCAGGCAAGGCGG + Intronic
1144910513 17:18677626-18677648 CCCTGGGGCCCCAGAGTCGGTGG - Intronic
1145234649 17:21200046-21200068 ACATGCATCCCCAGTCCCGGGGG - Intronic
1145815733 17:27793764-27793786 GCCTGCAGCCCCCGCCCCGGGGG + Intronic
1146268344 17:31467973-31467995 CCCTGCAGCCCCAGTGAAGGAGG + Intronic
1146447350 17:32943008-32943030 CCCTGCAGACCCACACCAGGTGG - Exonic
1147015541 17:37489318-37489340 CCGTGGCGCCCGAGACCCGGAGG - Intergenic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1148095585 17:45050934-45050956 CCACGCCGCCCCAGTCCCGGGGG + Intronic
1148793178 17:50184966-50184988 CCCAGCACCCCCAGGCCCTGGGG - Exonic
1149585506 17:57783448-57783470 CCCTGCTGCCCGAGCCCGGGTGG + Intergenic
1151310286 17:73288596-73288618 CCCTGCTGGACCAGACTCGGTGG - Intronic
1151655690 17:75494986-75495008 CCCTCCAGCCCCAGCCACGCAGG + Exonic
1151744725 17:76005744-76005766 GCCTGCAGGGCCAGACCCTGAGG + Exonic
1151900540 17:77009690-77009712 CACTGCAGCCCCAAACCCCTGGG - Intergenic
1151967928 17:77441342-77441364 CACTGCGGCCCCTGCCCCGGAGG + Intronic
1152804474 17:82348560-82348582 CCCTGCAGCCCCAGGCCCTGGGG - Intergenic
1153676452 18:7460010-7460032 CACGGCAGCCCCCGACCTGGGGG + Intergenic
1154062129 18:11071884-11071906 CCAGGCAGCCCCAAACCCAGGGG - Intronic
1154382761 18:13867474-13867496 CCCTGCAGCCTCAGACTCCAGGG - Intergenic
1157165833 18:45357633-45357655 CCCTGCAGACCCACACACTGTGG - Intronic
1157451036 18:47789365-47789387 CGCTGCAGCACCAGACACGCAGG + Intergenic
1157817526 18:50741004-50741026 CCCTGCAGCCCCAAACTCCTGGG + Intergenic
1159121548 18:64177199-64177221 CCCTGGAGCCCCAGAGGCAGAGG - Intergenic
1159586731 18:70289229-70289251 CGCTGCAGCCCCGCGCCCGGCGG - Intronic
1159864654 18:73689966-73689988 CCATGCAGCCACAGCCTCGGAGG + Intergenic
1159969188 18:74627948-74627970 CACTGCAGCCTCAAACTCGGAGG + Intronic
1160063466 18:75552522-75552544 CACTGCAGCCCTACACCTGGTGG - Intergenic
1160152539 18:76406109-76406131 CCCTGCAGCCCCTCCTCCGGAGG + Intronic
1160206284 18:76836294-76836316 CACTGCAGCCCCAAACCCCCGGG + Intronic
1160534583 18:79585375-79585397 GCCTCCAGCCCCAGACCTGCTGG - Intergenic
1160535142 18:79587569-79587591 CTCTGCAGCCCCCGACTCAGCGG - Intergenic
1160734089 19:653957-653979 ACCTGCATCCCCAGAGCCTGGGG - Intronic
1160739303 19:678633-678655 GCCTGCAGTCCCAGCCCCTGGGG - Intronic
1160837392 19:1131327-1131349 CCCTGGGGCCCCAGAACTGGGGG - Intronic
1160927918 19:1555904-1555926 CCGTGGCGCCCCGGACCCGGTGG - Exonic
1161202693 19:3024831-3024853 CCCTGCAGCCCCTGCCCCAGCGG + Intronic
1161299917 19:3537623-3537645 CCCTGCAGCCCCCGGCCCCCCGG - Intronic
1161337654 19:3722884-3722906 CCCGGGAGCCCCGTACCCGGGGG + Intronic
1161369598 19:3903316-3903338 CTCTGAAGCCCCAGATCCCGGGG + Intronic
1161473504 19:4472720-4472742 CCCTGCAGCCCAGGACCCCCAGG - Intronic
1161479416 19:4503189-4503211 CCCAGGAACCCCAGACCCAGGGG - Exonic
1161480501 19:4508009-4508031 CGTTGCAGCCCCAGGCCCTGCGG + Intronic
1161953075 19:7478375-7478397 ACCTGCAGCACCAGAGCCCGAGG + Exonic
1162005916 19:7779185-7779207 CACTGCAGCCCCAAACCCCCAGG + Intergenic
1162033253 19:7926186-7926208 CCCTGCAGCCCCGCCCCCCGCGG - Intergenic
1162057505 19:8073463-8073485 CCCCGCTGCCCCAAACCCTGTGG + Intronic
1162479684 19:10921137-10921159 CCCTGCTGCCCCTGGCCCTGGGG - Intronic
1162721564 19:12665845-12665867 CTCTGCAGCCCCCGACCTCGGGG - Intronic
1163125498 19:15242248-15242270 CCCTGCAGCACCACATCAGGAGG + Intronic
1163635986 19:18437458-18437480 CCCTGCAGCCCCTCGCCCCGCGG + Intronic
1163690581 19:18736281-18736303 CCCTGCAGCCCCATAACTCGGGG - Intronic
1163753548 19:19092840-19092862 CCCTGCCGCTACAGACCCTGGGG - Intronic
1163831024 19:19547235-19547257 GCCTTCATCCCCAGACCCTGGGG - Intergenic
1164588610 19:29493993-29494015 CCCTGCAGCCCCAAACTCCTGGG - Intergenic
1164638911 19:29811334-29811356 CCAGGGAGCCCCAGACCCCGCGG + Intergenic
1164981855 19:32620065-32620087 CCCAGCAGCCCCAGCCGTGGTGG + Intronic
1165141826 19:33704339-33704361 CAATGCAGACCCAGACCCTGAGG - Intronic
1165715647 19:38044166-38044188 CCCTGCAAACCCCGACCCTGGGG - Intronic
1166128913 19:40733660-40733682 CCCTGCAGCACAAGAGCTGGAGG + Intronic
1166204441 19:41259871-41259893 CCCAGCAGCCCCAGGGCAGGAGG + Exonic
1166268601 19:41700237-41700259 CCCTGCAGCCCCCTCCCTGGAGG - Intronic
1166268614 19:41700273-41700295 CCCTGCAGCCCCCTCCCTGGAGG - Intronic
1166268627 19:41700309-41700331 CCCTGCAGCCCCCTCCCTGGAGG - Intronic
1166268640 19:41700345-41700367 CCCTGCAGCCCCCTCCCTGGAGG - Intronic
1166268653 19:41700381-41700403 CCCTGCAGCCCCCTCCCTGGAGG - Intronic
1166328512 19:42065647-42065669 CCCTGCATCCTCAGGCCCTGGGG - Intronic
1166365880 19:42278240-42278262 GCCTGCAGCCCCAGTCCAGGAGG + Intronic
1166692248 19:44829667-44829689 CACTGCAGCCTCAAACCCTGGGG + Intergenic
1166693630 19:44839527-44839549 TCCTGGAGCCCCAGATCCTGAGG - Intergenic
1166737927 19:45097140-45097162 TCCTCCAGCCCCAGACCCTCTGG - Intronic
1167103838 19:47419318-47419340 GCCTGCTGCCCCCGCCCCGGCGG - Intronic
1167134422 19:47608659-47608681 GCCCCCAGCCCCAGTCCCGGGGG - Intronic
1167244061 19:48363473-48363495 CCCTGGACCCCCAGACCCCCCGG + Exonic
1167342028 19:48921974-48921996 CCCTCCAACCTCAGACCCAGGGG - Intronic
1167410538 19:49341320-49341342 CCCTTCAGTCCCTGACCAGGCGG + Exonic
1167661432 19:50798137-50798159 CCCTGGAGCACCAGGCCAGGCGG + Exonic
1167678728 19:50906515-50906537 CCCTCCTTCCCCAGACCCAGAGG - Exonic
1167866982 19:52336651-52336673 CGCCGCAGCCCCAGTCCCGGCGG + Intronic
1167950307 19:53021226-53021248 CGCTTCAGCCCCAGAGGCGGAGG + Intergenic
1168315024 19:55481271-55481293 CCCTGCGGCCCCTGCCCCGGCGG + Exonic
1168315614 19:55483528-55483550 CCCTGCACCCCTAGACCCCCAGG - Exonic
1168661064 19:58167229-58167251 CCCTGCAGCCACAGATCAGCAGG + Intergenic
925132517 2:1503725-1503747 CCCTGCAGGCTCAGAGCCCGTGG + Intronic
925188227 2:1864051-1864073 ACCTGCAGCCGCAGCCCTGGGGG - Intronic
925541681 2:4974263-4974285 CCCTGAAGACCCAGACAGGGAGG - Intergenic
925635167 2:5935586-5935608 CACTGCATCCCCAGACCCCAGGG - Intergenic
926205365 2:10831485-10831507 CCCGGCAGCCCCACATCCTGGGG + Intronic
927166046 2:20322676-20322698 ACCTGCAGTCCCAGACACTGGGG + Intronic
927229199 2:20803332-20803354 GCCAGGAGCCCCAGACCAGGTGG + Intronic
927272409 2:21226188-21226210 GAGTGCAGTCCCAGACCCGGAGG - Intergenic
927511663 2:23647862-23647884 CCTTGCTGCCCCTGACCCCGGGG - Intronic
927852221 2:26506514-26506536 CCCTGCTGCCTGAGTCCCGGGGG + Intronic
928149088 2:28810519-28810541 GGCCGCAGCCCCAGCCCCGGGGG + Intronic
931036626 2:58251478-58251500 CACGCCAGCCCCAGTCCCGGCGG + Intergenic
932144698 2:69307090-69307112 GCCGGGAGCCCCAGACCCGCCGG - Intergenic
932147591 2:69336711-69336733 CCCTGCAGCCTCAGACTCATGGG - Intronic
932485175 2:72080418-72080440 CCCTGCAGCCCACCACCCTGGGG + Intergenic
933357345 2:81228649-81228671 CCCTCCAGCCTCAGACTCTGAGG - Intergenic
933664650 2:84955117-84955139 CACTGCAGCCCCAGACTCCTGGG - Intergenic
934763817 2:96869639-96869661 CCCCGCAGCCCCGGGGCCGGAGG - Intronic
935636785 2:105255395-105255417 CACTGCAGCCCCAAACCCCTGGG + Intergenic
937904550 2:127046459-127046481 CCCTGCAGGCCCTGACCTTGTGG + Intergenic
937905984 2:127053069-127053091 CCCTCCTGCCCCACACCCTGAGG + Intronic
938140642 2:128791864-128791886 CCTGCCAGCCCCAGACCCTGCGG + Intergenic
940255758 2:151726972-151726994 CACTTCAGCCCCAGACCCCTGGG - Intronic
940360390 2:152790630-152790652 CACTGCAGCCCCAGCCTCTGGGG + Intergenic
941384962 2:164841468-164841490 CGCTGCAGCCCCCGCCCCGTGGG + Intronic
944128398 2:196319245-196319267 ACCTGCAGGCCCAGCCCCAGAGG - Exonic
944579153 2:201116907-201116929 CCCTGCAGCCGCAGCCCCAGAGG + Intronic
946279912 2:218659367-218659389 ACCTCCAGACCCAGAGCCGGCGG + Exonic
946410982 2:219515030-219515052 CCCCGCTGCCCCAGCCCCAGTGG + Exonic
947461631 2:230308774-230308796 ACCTGCAGCAGCAGAGCCGGCGG + Intronic
947530720 2:230907195-230907217 CCCTGCAGCCCCACACTTGGTGG + Intergenic
947844765 2:233235196-233235218 CCCTGCATCCCCAGGCACAGGGG - Intronic
948109711 2:235444943-235444965 ACCTCCAGACCCAGACCCAGGGG - Intergenic
948126457 2:235567790-235567812 CCCTACAGGCCCAGACCCCTTGG - Intronic
948459823 2:238123734-238123756 CCGCCCAGCCCCAGCCCCGGAGG - Intronic
948900938 2:240956613-240956635 CCCTGGAGCCCAAGTCCAGGGGG + Intronic
949070342 2:242020713-242020735 CCGTGCAGCTGGAGACCCGGCGG + Intergenic
949070397 2:242020966-242020988 TCCTGCAGCTGGAGACCCGGGGG + Intergenic
949070635 2:242022153-242022175 CCGTGCAGCTGGAGACCCGGGGG + Intergenic
949070728 2:242022564-242022586 CCGTGCAGCTGGAGACCCGGGGG + Intergenic
1168917852 20:1505929-1505951 CTCTGCAGCCCTAGACCTAGGGG + Intergenic
1169435461 20:5583470-5583492 CACTGCAGCCTCCGACCCTGAGG - Intronic
1171959841 20:31485692-31485714 CCCAGACGCCCCAGCCCCGGGGG + Intergenic
1172091109 20:32433608-32433630 CTCTGCAGCACCCGACCTGGAGG + Exonic
1172227804 20:33316902-33316924 CGCTGCTGCCCCAGGCCCAGGGG + Intergenic
1172300411 20:33845821-33845843 GCCTGCAGCCCCACGCCCTGGGG + Intronic
1172448120 20:35003633-35003655 CCCACCAGCCCCTGACCCTGTGG - Intronic
1172844701 20:37922877-37922899 CCCTGCAGCCCCTCACCCACCGG - Intronic
1172848690 20:37945076-37945098 CCCAACAGCCCCAGGCCCTGGGG - Exonic
1174423394 20:50415559-50415581 GCCTGCAGCCCCAGGCTCAGAGG + Intergenic
1174868794 20:54164387-54164409 CTCTGAAGCTCCAGACACGGGGG + Intronic
1175196144 20:57244643-57244665 CCCAACAGCCCCAGAACTGGGGG - Intronic
1175232237 20:57481341-57481363 CCCTCCACCTCCAGACCCAGGGG + Intergenic
1175290369 20:57871184-57871206 CCCTGTTGCCCCAGACACAGTGG + Intergenic
1175493059 20:59392062-59392084 CCCAGCAGCCCCAGACTCATGGG + Intergenic
1175503563 20:59466894-59466916 CCCTGCAGCCCCAGCCGCTTGGG - Intergenic
1175719432 20:61276743-61276765 CCCAACAGCCCCTGACCCCGTGG - Intronic
1175815774 20:61882565-61882587 CTCTGAAGCCCCTGGCCCGGGGG + Intronic
1175916905 20:62430258-62430280 CCCAGCAGCCCCAGCCCCTCAGG - Intergenic
1175961283 20:62637861-62637883 ACCTCCACCCCCAGACCCGCGGG + Intergenic
1176114267 20:63424289-63424311 CCCTGCAGCCCCTGACCCATGGG - Intronic
1176150112 20:63586421-63586443 CCCTCCAGCCACCGTCCCGGAGG + Intergenic
1176167565 20:63682047-63682069 CCCTGCAGCCCAGGGCCTGGAGG + Intronic
1177724295 21:24947088-24947110 CACTGCAGCCTCAAACCTGGGGG - Intergenic
1178589221 21:33895158-33895180 CCGTGCAGCCCCAGCCTCAGCGG - Exonic
1178710119 21:34909687-34909709 CTCTGTAGCCAGAGACCCGGGGG - Intronic
1179358151 21:40681387-40681409 CCCTGCAGCCCTGTCCCCGGCGG - Intronic
1179429473 21:41310030-41310052 CCCTGCAGCACCAGGCTGGGAGG - Intronic
1180701004 22:17781429-17781451 CCCTGCAGCCCCAGTTCCTGGGG - Intergenic
1180891342 22:19291449-19291471 CGCCGCAGCCCCAGCCCAGGTGG + Intronic
1180949547 22:19714939-19714961 CTCTGAAGCCCCAGGCGCGGCGG - Intronic
1180951991 22:19724609-19724631 ACCTGCAGGCCCAGACCACGTGG + Exonic
1181008197 22:20024552-20024574 CCCTGCAGCACCAGCCCTTGTGG + Intronic
1181235899 22:21447480-21447502 CCCTGCAGCGCCAGAGCCGGGGG - Exonic
1181260998 22:21597380-21597402 CTCTGCAGCCCCAGACTCCTGGG + Intronic
1181360069 22:22327540-22327562 CCCTGGGGCCCCAGACACTGAGG - Intergenic
1181370292 22:22410006-22410028 CCCTGGGGCCCCAGACACTGAGG - Intergenic
1181491360 22:23262666-23262688 CCCGGCGGCCCCACACCCAGCGG - Intronic
1181509259 22:23381753-23381775 CCCTGCAGCCCCTGCCGTGGGGG - Intergenic
1181511276 22:23389786-23389808 CCCTGCAGCCCGAGACGAGTGGG + Intergenic
1181511290 22:23389839-23389861 CCCTGCAGCCCGAGACGAGTGGG + Intergenic
1181511303 22:23389892-23389914 CCCTGCAGCCCGAGACGAGTGGG + Intergenic
1181625480 22:24119692-24119714 CCCGGCAGCCACTCACCCGGTGG - Exonic
1181804398 22:25366273-25366295 CCCTCCAGCCCCATCCTCGGTGG - Intronic
1182302112 22:29342775-29342797 CCCTGCTGCCCCAGTCCCCTGGG - Intronic
1183314217 22:37128302-37128324 CCCAGGAGTCCCAGACCTGGTGG - Exonic
1183422935 22:37722901-37722923 CCGTGGATCCCCAGACCCTGTGG + Intronic
1184021900 22:41826634-41826656 CCCTGCAGCCCCCCACCCACAGG - Intergenic
1184037453 22:41925540-41925562 GCCTGCAGCCCCAGAGCCCCTGG - Exonic
1184176784 22:42793481-42793503 CCCTGCAGCCCAAGACCAAGGGG + Intergenic
1184227825 22:43140251-43140273 CACTGCAGCCTCAGACTCAGGGG + Intronic
1184246896 22:43240432-43240454 CCCTGATACCCCAGACACGGAGG + Intronic
1184496720 22:44846481-44846503 CCCTCAAACCCCAGACCCTGCGG + Intronic
1184602139 22:45549837-45549859 CCCAGGAGTCCCAGACCTGGTGG + Intronic
1184684021 22:46087949-46087971 CCCTGCAGCTGCAGCCCTGGAGG - Intronic
1184859427 22:47164859-47164881 CCCTGCAGCCCCTGCGCAGGAGG + Intronic
1184943368 22:47784343-47784365 CCCTGCATCCTCTCACCCGGGGG - Intergenic
1185090102 22:48761756-48761778 CCCTGAAGCTGCAGAGCCGGTGG - Intronic
1185287905 22:50010687-50010709 TCCTGCAGCCCCAGACACTCGGG - Intronic
950496003 3:13334994-13335016 CCCTGCAGCCCCTGCCCCGCAGG + Intronic
950658427 3:14451781-14451803 CCCTGCAGCGTCTGACCCTGGGG + Intronic
952299611 3:32092852-32092874 CACTGCAGCCTCAATCCCGGGGG + Intergenic
952316843 3:32238912-32238934 GCGTCCAGCCCCAGACCCGCCGG + Exonic
952990037 3:38823908-38823930 CCCTGCAGCTGCAGCCCCTGTGG + Intergenic
953032848 3:39189352-39189374 CCCTCCACCCCCAGCCCTGGAGG - Exonic
953413999 3:42705265-42705287 CTCTGCACCCCCACACCCAGGGG - Intronic
954108080 3:48419861-48419883 CCCTGCAGACCCTGGCCCCGAGG - Exonic
954446946 3:50551946-50551968 CCCTGCACCCCCAGTCTCTGAGG + Intergenic
954661910 3:52230915-52230937 CCCTGCAGCCTGAGGCCCAGCGG - Exonic
955212841 3:56958258-56958280 TCCTGCAGCCCAAGACCCTCAGG + Intronic
955380450 3:58433933-58433955 CCCCGCGGCCCCTCACCCGGTGG - Intergenic
960586265 3:119323387-119323409 CCCCGCCGGCCCAGACCCCGCGG + Intronic
960949844 3:122992256-122992278 CCCTGGAGCCCCTGACCCGTGGG - Intronic
961404512 3:126668724-126668746 CCCTGCGGCCCCTGCCCCGCAGG - Intergenic
961539579 3:127590513-127590535 GCCTCCAGCGCCAGACCAGGCGG + Exonic
961662544 3:128477363-128477385 CCCTACAACCCCAGAGCAGGAGG - Intergenic
962807930 3:138939876-138939898 CCCTGCAACCTCTGGCCCGGTGG + Intergenic
967493829 3:190121391-190121413 CCCTGTAGGCCCAGATGCGGAGG + Intronic
968049871 3:195647200-195647222 CCGTGCAGCTGGAGACCCGGTGG - Intergenic
968049937 3:195647482-195647504 CCGTGCAGCTGGAGACCCGGCGG - Intergenic
968050168 3:195648623-195648645 CCATGCAGCTGGAGACCCGGTGG + Intergenic
968050248 3:195648999-195649021 CCCTGCAGCTGGAGACCCGTGGG + Intergenic
968097131 3:195940044-195940066 CCGTGCAGCTGGAGACCCGGTGG - Intergenic
968097351 3:195941108-195941130 CCGTGCAGCTGGAGACCCGGCGG + Intergenic
968097394 3:195941296-195941318 CCGTGCAGCTGGAGACCCGGCGG + Intergenic
968284345 3:197499291-197499313 CCCAGCGGCCCCAGGCCCTGGGG + Intergenic
968303939 3:197637218-197637240 CCATGCAGCTGGAGACCCGGTGG - Intergenic
968304205 3:197638548-197638570 CCGTGCAGCTGGAGACCCGGTGG + Intergenic
968304249 3:197638736-197638758 CCATGCAGCTGGAGACCCGGTGG + Intergenic
968761399 4:2444236-2444258 CCCTGCAGGCCCAGGCCATGGGG - Intronic
968811282 4:2800678-2800700 CACCACAGCCCCAGACCCGTGGG - Intronic
968958404 4:3730539-3730561 CCCTGCACCCCCAGCCCCCACGG - Intergenic
969586749 4:8098203-8098225 CCCTGCAGCCCCAGCCCCTCTGG + Intronic
969635309 4:8365722-8365744 CCCTGGAGCCCCAGACGGGTGGG + Intergenic
969699940 4:8762423-8762445 CCCTCCAGCCACAGACCCCCGGG + Intergenic
970333151 4:15004226-15004248 CGCAGCAGCCGCAGAGCCGGAGG + Exonic
971244555 4:24916501-24916523 CTCGGCAGCCCCAGACACGCGGG + Intronic
971428061 4:26535291-26535313 CACTGCAGCCTCAGACTCTGCGG + Intergenic
975584740 4:75939219-75939241 CCCTGTCGCCCCAGCCCTGGTGG + Intronic
975710688 4:77157638-77157660 GCCCTCAGCCCCAGCCCCGGGGG + Intronic
980101084 4:128542159-128542181 CTCTGCAGCCCCAGACATCGAGG - Intergenic
981633530 4:146849093-146849115 CCCTTGAGCCCCAGTCCCTGTGG + Intronic
982436225 4:155384965-155384987 CCCCGCAGCCCCAGACACCTTGG + Intergenic
983229462 4:165114449-165114471 GCCTGTAGTCCCAGACCCTGGGG - Intronic
983863235 4:172734391-172734413 CACTGCAGCCCCAGGCCCAGTGG + Intronic
985490282 5:174975-174997 CCCAGGTGCCCCAGACCGGGTGG - Intronic
985506666 5:285451-285473 CCATGCAGCTGGAGACCCGGCGG + Intronic
985683724 5:1270959-1270981 GCCTGCAGCCCAGGAGCCGGAGG + Intronic
985740970 5:1617328-1617350 CCCTGCAGCTGGAGACCCGTGGG - Intergenic
985740999 5:1617469-1617491 CCATGCAGCTGGAGACCCGGCGG - Intergenic
985741158 5:1618222-1618244 CCATGCAGCTGGAGACCCGGTGG - Intergenic
985741352 5:1619141-1619163 CCATGCAGCTGGAGACCCGGGGG - Intergenic
985741474 5:1619689-1619711 CCATGCAGCTGGAGACCCGGCGG - Intergenic
985741545 5:1620051-1620073 CCGTGCAGCTGAAGACCCGGTGG + Intergenic
985833102 5:2250531-2250553 CCCTGCAGCCCCATTCCCTAAGG + Intergenic
985868619 5:2536361-2536383 CCCTCCAGCCCCAGACCCAGAGG - Intergenic
993716282 5:91278604-91278626 ACCTGTAGCCCCAGCCCCTGGGG + Intergenic
998142163 5:139706074-139706096 ACCTGCCGACCCAGACCAGGGGG - Intergenic
1002000059 5:176192328-176192350 CCCTGCAGGCCCAGGTCCTGGGG - Intergenic
1002196443 5:177504109-177504131 CCCTGGAGGCCCAGTACCGGCGG - Exonic
1002457043 5:179351175-179351197 CCCTGCAGCCAGGGACCCAGGGG + Intergenic
1002834403 6:853731-853753 CCCTGCACCCCCAGGTCAGGAGG + Intergenic
1006166124 6:32066316-32066338 CACTGCAGCCCCAGACTCCTGGG - Intronic
1006659164 6:35624871-35624893 CCCTGCAGCCACAGACCACTAGG - Intronic
1007414990 6:41686341-41686363 CCCAGCAACCCCAGACCTGGAGG + Intronic
1007777364 6:44231186-44231208 CCCTACAACTCAAGACCCGGGGG - Intronic
1007791308 6:44310407-44310429 GCCTGCAGCCCCTGCCCCAGCGG - Exonic
1007817299 6:44533639-44533661 GACTGCAGCCCCAGAACTGGGGG + Intergenic
1007822369 6:44570135-44570157 CCCGGCAGCTCCAGCCCCGAGGG - Intergenic
1011661792 6:89601152-89601174 TCCTGCAGCCACTGACCCAGCGG + Intronic
1012450640 6:99349775-99349797 CCCTGCAGATCCGGCCCCGGCGG - Intronic
1013591120 6:111620324-111620346 CCCTGCAGCCTCTGAGCCTGGGG - Intergenic
1016319960 6:142831667-142831689 CCCTACAGTCCCTGACCAGGAGG - Intronic
1016387289 6:143540999-143541021 CACTGCAGCCTCAAACCCTGAGG + Intronic
1018805018 6:167252323-167252345 CCCTGCAGCCTCAGATCCCTGGG + Intergenic
1018945578 6:168345486-168345508 TCCTGCAGCCCCACCCCCAGGGG - Intergenic
1019257192 7:60016-60038 CCAAGCTCCCCCAGACCCGGTGG + Intergenic
1019453154 7:1110043-1110065 CCCTCCACGCCCAGACACGGAGG + Intronic
1019455551 7:1125086-1125108 GCCTGCAGCCACAGACGTGGTGG + Intronic
1019795234 7:3043788-3043810 CCCTGCAGCCCCTGGGCGGGCGG - Exonic
1020094809 7:5362339-5362361 TGCTGCAGCCCCAGGCCCCGTGG + Intronic
1022375251 7:29806499-29806521 CCCGGCAGCACCAGAGCCGGTGG + Intronic
1024301232 7:47889173-47889195 CCCTCCAGCCCCAGACCTCCTGG + Intronic
1024903003 7:54343688-54343710 CCGTCCAGCCCCAGCCCTGGAGG + Intergenic
1025834956 7:65085673-65085695 CCCTTCAGCCCCATAGCTGGGGG + Intergenic
1025904727 7:65775152-65775174 CCCTTCAGCCCCATAGCTGGGGG + Intergenic
1026740689 7:72976536-72976558 TCCTGCACCCCCAGTCCCCGGGG - Intergenic
1026874118 7:73869946-73869968 CCCTGCTGCCCCAGGCCCAGTGG + Intergenic
1027103043 7:75388535-75388557 TCCTGCACCCCCAGTCCCCGGGG + Intergenic
1027244506 7:76358413-76358435 CCCTGCACCCCTAGAGCCGCGGG + Intronic
1028884662 7:95917900-95917922 TCCTGCAGCCCCAGGCCAAGGGG - Intronic
1029145570 7:98443460-98443482 TCCTGCAGCCACAGACCCTGGGG - Intergenic
1029494326 7:100889138-100889160 CCGTGCAGCCCCACTCCCCGGGG + Exonic
1029653339 7:101908720-101908742 CCCTGGAGCCCCTGGCCTGGTGG + Intronic
1029729911 7:102432702-102432724 CACTGCAACCCCCGACCCCGGGG - Intergenic
1029747563 7:102525000-102525022 CCCCTCAGCCCCAGCCCCTGTGG + Intergenic
1031531795 7:122885815-122885837 CGCTGCAGCCGCATACCCGGCGG + Intronic
1032895006 7:136240731-136240753 CCCTGCAGCCCCAGGTCCCACGG + Intergenic
1033477206 7:141702244-141702266 CCGGGCAGCGCCAGACCCGGCGG - Intergenic
1034088211 7:148339505-148339527 GCCGGCAGCCCGAGTCCCGGCGG - Intronic
1034220090 7:149437415-149437437 CCCTTCGGCCCCATACCCTGAGG + Intronic
1034227893 7:149497380-149497402 CGCGGGAGCCCCAGGCCCGGTGG + Intronic
1034267223 7:149787062-149787084 CCCAGCAGCACCAGCCTCGGTGG - Intergenic
1034490875 7:151392491-151392513 CCCTGAAGCCCCCTACCCGGGGG + Intronic
1035070934 7:156144279-156144301 CCCTGGAGCTCCAGCCCTGGAGG + Intergenic
1035093050 7:156330513-156330535 CCCTGCAGACCCTGCCCTGGAGG - Intergenic
1037401272 8:18497459-18497481 CCCTGCAGCCAGACACCTGGAGG - Intergenic
1037547572 8:19939550-19939572 CCCTCCACCTGCAGACCCGGCGG + Intronic
1037817577 8:22120211-22120233 CCCTGAAGCCCCTGCCCCGGCGG + Intronic
1037916748 8:22777643-22777665 TCCTGTTGCCCCAGAGCCGGGGG + Intronic
1038533735 8:28339132-28339154 CCCTGCCGCCCCAGAGCATGTGG + Exonic
1038739798 8:30207155-30207177 CCCTGCAGCCTCAGACTCCTAGG + Intergenic
1039591901 8:38756919-38756941 CCTTCCAGCCCCGGACCCAGCGG + Intronic
1040869926 8:52090095-52090117 CGCTTAAGCCCCAGACGCGGAGG - Intergenic
1045602666 8:103735013-103735035 CCCTGCAACCCCAGACGCAGGGG - Intronic
1046438011 8:114219353-114219375 CCCTGCAGCTGCAAACCCAGTGG + Intergenic
1046547317 8:115668498-115668520 CCCCGCAGCCCCCGGCCCCGCGG + Intronic
1048604828 8:135956696-135956718 CCCTCCAGGGCCACACCCGGTGG + Intergenic
1049198122 8:141326474-141326496 CCCTGCCGCCCCACCCCCGGTGG - Intergenic
1049238750 8:141525886-141525908 CACCCCAGCCCCAGACCTGGTGG + Intergenic
1049564397 8:143330755-143330777 CCCTGCTGCCCCAGAGCCCCCGG + Intronic
1049844339 8:144792729-144792751 GCCGGGAGCCCCAGACCCCGTGG - Intergenic
1050289650 9:4140480-4140502 CCCAGAAGCCTCAGACCCAGAGG + Intronic
1051105017 9:13569522-13569544 CCCTCCAGCCCCAGCCCCCTCGG + Intergenic
1051618279 9:19027535-19027557 CCCTACAGGCCCAGGCCAGGAGG - Intronic
1053434447 9:38066280-38066302 CCCTGCAGCCACACCCCAGGTGG - Intronic
1054777039 9:69132460-69132482 TCCTGCAGCACCAGGCCCCGAGG - Intronic
1055574912 9:77651162-77651184 CCCTGTAGCCCCACACTTGGTGG - Intergenic
1057152949 9:92809918-92809940 CCCTGCAGCCCCTGGGGCGGGGG + Intergenic
1057311510 9:93946071-93946093 CGCTGCCGCCCCAGCCCCCGCGG - Intergenic
1058478195 9:105362719-105362741 CCCTTCAGCCCCAAACCTGGAGG - Intronic
1059251549 9:112891163-112891185 CCTTCCAGCCCCTGCCCCGGTGG - Intergenic
1060520650 9:124292177-124292199 CCCTGGAGCTCCAGCCCTGGAGG - Intronic
1060551539 9:124487768-124487790 CCCTGGAGCCCCAGCTCTGGTGG + Intronic
1060802591 9:126554169-126554191 CCCTGGAGGCCCAGACCAGTGGG - Intergenic
1061056276 9:128224573-128224595 CCCTGGGTCCCCAGACCTGGGGG - Intronic
1061073458 9:128326357-128326379 CCCTCCAGCCCCAGGCAGGGAGG + Intronic
1061404391 9:130385440-130385462 CACAGCAGACCCAGCCCCGGGGG - Intronic
1061543578 9:131290947-131290969 CCCTGGGTCCCCAGACCCTGGGG - Intronic
1061559708 9:131394429-131394451 CCCCGCAGCCCCGCGCCCGGCGG - Intronic
1061673836 9:132204242-132204264 CCCAGCTTCCCCAGACCCTGTGG + Intronic
1061799323 9:133105474-133105496 CCCTGCAGCTCCTGTCCCTGGGG + Intronic
1061828410 9:133275479-133275501 CCCTGAAGCCCCGTCCCCGGGGG + Intergenic
1061876345 9:133546120-133546142 CCCTGCGTCCCCAGCCCTGGAGG + Intronic
1062296113 9:135828086-135828108 CCCTTCAGCTCCAGCCCCTGGGG + Intronic
1062318507 9:135979426-135979448 CCCTGCAGCCGCGTCCCCGGGGG - Intergenic
1062558702 9:137129513-137129535 CCCTGCAGCACAAGAGCCGCCGG + Intergenic
1185448154 X:269712-269734 CCCTGCAGGCCCCGCCCAGGCGG - Intergenic
1185489754 X:512051-512073 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185489829 X:512315-512337 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185489855 X:512403-512425 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185489867 X:512447-512469 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185489905 X:512579-512601 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185489979 X:512843-512865 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490003 X:512931-512953 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490163 X:513503-513525 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490226 X:513723-513745 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490252 X:513811-513833 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490288 X:513943-513965 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490410 X:514383-514405 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490472 X:514603-514625 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490484 X:514647-514669 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490520 X:514779-514801 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490533 X:514823-514845 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490557 X:514911-514933 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490581 X:514999-515021 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490618 X:515131-515153 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490643 X:515219-515241 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490668 X:515307-515329 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490705 X:515439-515461 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490742 X:515571-515593 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490766 X:515659-515681 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490803 X:515791-515813 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185490840 X:515923-515945 CCCTGCAGCCCCTTTCCCTGTGG + Intergenic
1185643405 X:1600551-1600573 TCCTGCATCCCCAGACCATGGGG + Intronic
1190418073 X:50200389-50200411 CCCTGCTGCCTCTGACCCTGGGG + Intronic
1191634843 X:63364160-63364182 GCCTGCAGACCCTGACCCAGCGG + Intergenic
1191742381 X:64449369-64449391 CCCTCCTGCCACAGACCCAGAGG - Intergenic
1192451893 X:71249949-71249971 CCCTGCAGCCCCAGGATGGGAGG + Intronic
1194749312 X:97666643-97666665 ACCTACAGCACCAGACCCAGGGG - Intergenic
1195885667 X:109635076-109635098 CCCTGCAGCTCCAGGCCAGTTGG + Intronic
1197093941 X:122571892-122571914 CCTTGCAGCCCCATCCCTGGTGG + Intergenic