ID: 1132808539

View in Genome Browser
Species Human (GRCh38)
Location 16:1786944-1786966
Sequence CCGGCCGTTACCGTTTTTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 20}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132808539_1132808546 5 Left 1132808539 16:1786944-1786966 CCAAGAAAAACGGTAACGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1132808546 16:1786972-1786994 GCGTCCGCCGTCCTGGTGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1132808539_1132808545 4 Left 1132808539 16:1786944-1786966 CCAAGAAAAACGGTAACGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1132808545 16:1786971-1786993 CGCGTCCGCCGTCCTGGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1132808539_1132808552 23 Left 1132808539 16:1786944-1786966 CCAAGAAAAACGGTAACGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1132808552 16:1786990-1787012 AAGGGGGTTAGCGTCCGTGCCGG 0: 1
1: 0
2: 0
3: 1
4: 38
1132808539_1132808544 -2 Left 1132808539 16:1786944-1786966 CCAAGAAAAACGGTAACGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1132808544 16:1786965-1786987 GGGCGGCGCGTCCGCCGTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 117
1132808539_1132808548 7 Left 1132808539 16:1786944-1786966 CCAAGAAAAACGGTAACGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1132808548 16:1786974-1786996 GTCCGCCGTCCTGGTGAAGGGGG 0: 1
1: 0
2: 1
3: 4
4: 69
1132808539_1132808547 6 Left 1132808539 16:1786944-1786966 CCAAGAAAAACGGTAACGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1132808547 16:1786973-1786995 CGTCCGCCGTCCTGGTGAAGGGG 0: 1
1: 0
2: 0
3: 0
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132808539 Original CRISPR CCGGCCGTTACCGTTTTTCT TGG (reversed) Exonic
903348052 1:22700311-22700333 CGGGTGGTTTCCGTTTTTCTAGG - Intergenic
906653308 1:47529516-47529538 CAGGCCATTTCCGTTGTTCTTGG - Intergenic
907207430 1:52785742-52785764 CCGGCCCTTAACTTTTTTTTAGG + Intronic
915280844 1:154821152-154821174 TCGGCCATGACCTTTTTTCTTGG - Intronic
1064079080 10:12293913-12293935 CCGGCAGATACCTTTTTTATAGG - Intergenic
1071264697 10:83954616-83954638 CCAGCTGTTTCCGTTTTTGTGGG + Intergenic
1083635586 11:64119107-64119129 ACGGTCCTTACCGTTCTTCTTGG + Exonic
1091858368 12:3756944-3756966 CCAGCCATTACCTATTTTCTTGG - Intronic
1092086832 12:5769566-5769588 CTTGCCTTTACCGTTTCTCTTGG - Intronic
1098416696 12:70243136-70243158 GCGGCCGCTACCGTTTCCCTGGG - Exonic
1132808539 16:1786944-1786966 CCGGCCGTTACCGTTTTTCTTGG - Exonic
1161534559 19:4811101-4811123 CCGGCCGGCAGCCTTTTTCTGGG - Intergenic
925221250 2:2143349-2143371 CCGTCAGTTCCTGTTTTTCTAGG - Intronic
960598307 3:119428734-119428756 CTGGCCGTTACAGGTGTTCTTGG + Intergenic
970268414 4:14315792-14315814 CCTGCCGTTTCTGTTTTGCTCGG + Intergenic
981529014 4:145734246-145734268 CCTGCCGGTTCCCTTTTTCTTGG - Intronic
994091376 5:95812391-95812413 TCTGCCGTTACCATATTTCTGGG + Intronic
1004188847 6:13446731-13446753 TCGGCCCTTACCCTTTTTCTTGG - Intronic
1020901722 7:14011818-14011840 CCGGGGCTTACCTTTTTTCTTGG - Intergenic
1039614985 8:38948452-38948474 CCAGCAGTTACAGTTTCTCTGGG - Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1196772051 X:119304026-119304048 CCGGCCCATACCATATTTCTGGG + Intergenic