ID: 1132809036

View in Genome Browser
Species Human (GRCh38)
Location 16:1788864-1788886
Sequence GCTGCTGGTGCGACACATCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132809036_1132809038 -10 Left 1132809036 16:1788864-1788886 CCAGGATGTGTCGCACCAGCAGC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1132809038 16:1788877-1788899 CACCAGCAGCTCTGCCTGGTTGG 0: 1
1: 0
2: 1
3: 37
4: 400
1132809036_1132809041 5 Left 1132809036 16:1788864-1788886 CCAGGATGTGTCGCACCAGCAGC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1132809041 16:1788892-1788914 CTGGTTGGCCTGCAGTGCCGTGG 0: 1
1: 0
2: 0
3: 27
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132809036 Original CRISPR GCTGCTGGTGCGACACATCC TGG (reversed) Exonic
900704494 1:4071856-4071878 GCTGCTGCTGAGCCACTTCCAGG + Intergenic
900965213 1:5952714-5952736 GCTGCTGGAGCTCCACGTCCAGG - Exonic
901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG + Exonic
902834082 1:19035599-19035621 ACTGCAGGTGTCACACATCCAGG - Intergenic
915202192 1:154239321-154239343 GCTCCTGGTATGATACATCCAGG + Intronic
918240318 1:182615057-182615079 GCTGATGGTGCCACAGAGCCCGG - Intergenic
919810063 1:201403429-201403451 GTTGCTGATGCTCCACATCCTGG - Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
921670584 1:217919870-217919892 GCTGCCTGTGCTACACATTCTGG + Intergenic
922200192 1:223394384-223394406 GCTGCTGCTGCGGCAGAGCCAGG + Exonic
1064552946 10:16521035-16521057 GCTGCTGGTGATCCTCATCCCGG - Exonic
1067081019 10:43212216-43212238 GCTGTTGTTGGAACACATCCCGG + Intronic
1070670379 10:78373504-78373526 GGTGCTGGAGCAACACTTCCTGG + Intergenic
1073045725 10:100637179-100637201 GATGCTGATGCGACAGGTCCAGG - Intergenic
1077184868 11:1231496-1231518 GCAGCTGGTGCCACTCATGCAGG + Exonic
1078463765 11:11535187-11535209 GCTGCTGGTGAGGCAGACCCTGG + Intronic
1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG + Intergenic
1089706702 11:120283389-120283411 GCTGCTGGGTTGCCACATCCTGG - Intronic
1090077579 11:123589075-123589097 GCTGCTCATGTGACACATTCCGG - Intronic
1091806913 12:3363485-3363507 GCTGCTGGTGTGAGGGATCCAGG + Intergenic
1094061938 12:26323570-26323592 TCTGCAGGTGAGACACATTCTGG - Intergenic
1106477004 13:30107663-30107685 GCTCATGGTCTGACACATCCAGG - Intergenic
1106575994 13:30976257-30976279 GCTGCTGGTGGGAAACCTACAGG - Intergenic
1106782835 13:33076870-33076892 GCTGCTGCTGTTACACATGCTGG - Intergenic
1108044668 13:46372286-46372308 GCGGCTGTTGCTGCACATCCTGG + Exonic
1112071825 13:95861306-95861328 GCTGCTGATGGGGCTCATCCAGG + Intronic
1112380341 13:98882918-98882940 GCTACTGATGTGAGACATCCAGG + Intronic
1113422941 13:110184059-110184081 GCTGTTGGTGACACACACCCTGG + Intronic
1113893779 13:113750045-113750067 GCTGATGGTGGGACACCTGCTGG + Intergenic
1122154240 14:99740849-99740871 GATGCTGGCTCTACACATCCTGG + Intronic
1126709796 15:51443353-51443375 GCTGCTGGTGCCAGCCAGCCAGG + Intergenic
1131793732 15:95991874-95991896 GCTGATGGTGCAAAATATCCTGG + Intergenic
1132521617 16:392806-392828 GCTGCTGCTCCGCCACCTCCTGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133234473 16:4381537-4381559 GCTGGTTGTCGGACACATCCAGG - Exonic
1137001225 16:35232789-35232811 ACTGCTGGTGCCACAGCTCCAGG + Intergenic
1137783341 16:51115997-51116019 GCTGCTGCTGCTACAGCTCCAGG + Intergenic
1140950898 16:79816389-79816411 GCTGAAGGTGGGACACAGCCTGG - Intergenic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1152940021 17:83164100-83164122 GCTCCTGTTGCTACACATCCTGG + Intergenic
1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG + Intronic
1161465586 19:4428568-4428590 GGTGCTGGTGGGATTCATCCAGG - Intronic
1163007436 19:14405825-14405847 CCTGCTGGTGCGGCCCATCCAGG + Exonic
1163133067 19:15288644-15288666 GCAGCTGGTGCTACACAGGCTGG + Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1166998842 19:46733052-46733074 GCTGCTGGTGAAACAGATCGAGG - Exonic
928120006 2:28577214-28577236 ACTGCTGGTGCCAGACAGCCAGG - Intronic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
932246316 2:70199663-70199685 GCTGCAGGTGGGACACATGAGGG - Intronic
932759534 2:74430316-74430338 GCAGCTGGGGGAACACATCCAGG - Exonic
934878538 2:97951336-97951358 GCTTCTGGTGCCACACAGCGGGG + Intronic
939755375 2:146103008-146103030 GCAGCTGGTGCCACCCATACCGG - Intergenic
943928548 2:193819925-193819947 GGTGCTGTTGCAACACAACCAGG - Intergenic
1169220687 20:3820647-3820669 GCTGCAGGGGCAACACATTCAGG + Exonic
1173374646 20:42472416-42472438 GCTGCTGGTTGAACACATACTGG + Exonic
1173999348 20:47362990-47363012 GCTGCTGGTGCCACACTCTCTGG + Intergenic
1175889707 20:62310745-62310767 GCTGCCGGTGCGGCCCCTCCTGG + Exonic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1177483799 21:21728787-21728809 GCTGCTGCTGCAAAATATCCAGG - Intergenic
1181846106 22:25710068-25710090 GATGCTGGGGAGACACAGCCAGG - Intronic
1183489112 22:38107402-38107424 GCTGCTGGATCGACAGAGCCAGG + Intronic
1184250796 22:43259048-43259070 GCTGATGTTGTGAAACATCCTGG - Intronic
949908775 3:8882550-8882572 GCTGATGGTGGGAAACAGCCGGG - Intronic
950441800 3:13014886-13014908 GCTCCTGGGGGGACACATACTGG + Intronic
953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG + Intronic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
967869753 3:194220306-194220328 GCTGCTGGTGTGGCCCAGCCCGG + Intergenic
968600860 4:1508655-1508677 GCTGCTGGGGCCACACACCTGGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968975831 4:3821653-3821675 GCTGATGGAGCGACACAGACTGG + Intergenic
980774990 4:137425955-137425977 TCTGCTGGTGGGACAGGTCCTGG + Intergenic
982901103 4:161003630-161003652 GCTGCTGTTGCGACCCAGCTGGG - Intergenic
985745143 5:1642620-1642642 GCTGCTGCTCCCACACCTCCAGG + Intergenic
992782493 5:80140852-80140874 GCTGCTGGTCAGACACATTTAGG - Exonic
1003854687 6:10261162-10261184 GCTGCTGCTCTGGCACATCCAGG - Intergenic
1007079062 6:39085985-39086007 GCTGCTGGTGGGACACTTGAGGG - Exonic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019399515 7:844237-844259 GCTGCAGGTGAGAGAGATCCTGG - Intronic
1024616066 7:51113097-51113119 GGTACTGGTCCCACACATCCAGG + Intronic
1026466842 7:70661771-70661793 CCTGCTCGTGCAACACAGCCTGG - Intronic
1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG + Intergenic
1033150816 7:138913744-138913766 GCTGCTGGTGTGACTCAGCAAGG - Intronic
1033477265 7:141702546-141702568 GCAGCTTCTGCCACACATCCAGG - Intergenic
1034507621 7:151506853-151506875 GCTGGTGGTGCTACACAGCTGGG + Intronic
1035663421 8:1363803-1363825 GCTGCGGGTGTGACAGAGCCCGG + Intergenic
1043195460 8:77287199-77287221 GGTGCTGTTGCAACACAGCCAGG + Intergenic
1049711126 8:144063838-144063860 GCGGCTGGTGCAGCTCATCCAGG - Intergenic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1060751856 9:126174734-126174756 GCTGCTGGAGCCACTCAGCCTGG + Intergenic
1061586914 9:131575444-131575466 GCAGCTGCTGCGACCCACCCTGG - Intergenic
1062254640 9:135615169-135615191 CCTGCTGGGGCTACACAGCCGGG + Intergenic