ID: 1132809038

View in Genome Browser
Species Human (GRCh38)
Location 16:1788877-1788899
Sequence CACCAGCAGCTCTGCCTGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 400}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132809035_1132809038 -9 Left 1132809035 16:1788863-1788885 CCCAGGATGTGTCGCACCAGCAG 0: 1
1: 0
2: 2
3: 6
4: 103
Right 1132809038 16:1788877-1788899 CACCAGCAGCTCTGCCTGGTTGG 0: 1
1: 0
2: 1
3: 37
4: 400
1132809028_1132809038 7 Left 1132809028 16:1788847-1788869 CCCCGACCAGCCCAGCCCCAGGA 0: 1
1: 0
2: 5
3: 66
4: 635
Right 1132809038 16:1788877-1788899 CACCAGCAGCTCTGCCTGGTTGG 0: 1
1: 0
2: 1
3: 37
4: 400
1132809031_1132809038 1 Left 1132809031 16:1788853-1788875 CCAGCCCAGCCCCAGGATGTGTC 0: 1
1: 0
2: 5
3: 50
4: 397
Right 1132809038 16:1788877-1788899 CACCAGCAGCTCTGCCTGGTTGG 0: 1
1: 0
2: 1
3: 37
4: 400
1132809034_1132809038 -8 Left 1132809034 16:1788862-1788884 CCCCAGGATGTGTCGCACCAGCA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1132809038 16:1788877-1788899 CACCAGCAGCTCTGCCTGGTTGG 0: 1
1: 0
2: 1
3: 37
4: 400
1132809026_1132809038 20 Left 1132809026 16:1788834-1788856 CCGGAGAGCTTCTCCCCGACCAG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1132809038 16:1788877-1788899 CACCAGCAGCTCTGCCTGGTTGG 0: 1
1: 0
2: 1
3: 37
4: 400
1132809032_1132809038 -3 Left 1132809032 16:1788857-1788879 CCCAGCCCCAGGATGTGTCGCAC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1132809038 16:1788877-1788899 CACCAGCAGCTCTGCCTGGTTGG 0: 1
1: 0
2: 1
3: 37
4: 400
1132809029_1132809038 6 Left 1132809029 16:1788848-1788870 CCCGACCAGCCCAGCCCCAGGAT 0: 1
1: 0
2: 2
3: 42
4: 440
Right 1132809038 16:1788877-1788899 CACCAGCAGCTCTGCCTGGTTGG 0: 1
1: 0
2: 1
3: 37
4: 400
1132809030_1132809038 5 Left 1132809030 16:1788849-1788871 CCGACCAGCCCAGCCCCAGGATG 0: 1
1: 0
2: 5
3: 69
4: 512
Right 1132809038 16:1788877-1788899 CACCAGCAGCTCTGCCTGGTTGG 0: 1
1: 0
2: 1
3: 37
4: 400
1132809033_1132809038 -4 Left 1132809033 16:1788858-1788880 CCAGCCCCAGGATGTGTCGCACC 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1132809038 16:1788877-1788899 CACCAGCAGCTCTGCCTGGTTGG 0: 1
1: 0
2: 1
3: 37
4: 400
1132809036_1132809038 -10 Left 1132809036 16:1788864-1788886 CCAGGATGTGTCGCACCAGCAGC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1132809038 16:1788877-1788899 CACCAGCAGCTCTGCCTGGTTGG 0: 1
1: 0
2: 1
3: 37
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132809038 Original CRISPR CACCAGCAGCTCTGCCTGGT TGG Exonic
900610723 1:3543538-3543560 CACCCCCAGCTCTGCGTGTTTGG - Intronic
900662265 1:3790677-3790699 CAGCAGTAGCTCTGCCTGCGTGG - Intronic
901814889 1:11788347-11788369 CACCAGCTGCTCTGCCCCTTGGG - Exonic
902295785 1:15466060-15466082 CTGCTCCAGCTCTGCCTGGTGGG + Exonic
902542064 1:17162753-17162775 GACCAGTAGCTCTGCCTGGGTGG - Intergenic
902634637 1:17727107-17727129 CACCTGCATCTCTGCCTCGCTGG + Intergenic
903149942 1:21399974-21399996 CACCACCACCTCTGCCTCCTGGG + Intergenic
903167014 1:21527623-21527645 CACCACAAGCTCTGCCTCCTGGG + Intronic
903219177 1:21859570-21859592 GACCAGCAGCTCTGCCCGGCTGG + Exonic
903831910 1:26180566-26180588 CACCAGGAGCTCATCCTGGGCGG + Exonic
904490450 1:30855653-30855675 CAGCCTCAGCTCTGCCTGGCGGG + Intergenic
906042456 1:42798592-42798614 CAGCCTCAGCCCTGCCTGGTGGG + Intergenic
906168363 1:43704717-43704739 TACCAGCACCTCAGCCTAGTCGG - Exonic
907551709 1:55310389-55310411 CTGCAGCAGCTGGGCCTGGTGGG + Intergenic
908338185 1:63148731-63148753 CAGCATCTGTTCTGCCTGGTTGG - Intergenic
908799471 1:67864570-67864592 CACCTGTAGCTCTGCCTGTCAGG + Intergenic
909487730 1:76192215-76192237 CAAAAGCAGCTCTGCCTTTTTGG - Intronic
910577681 1:88784708-88784730 CATCAGTTGCACTGCCTGGTTGG + Exonic
911269692 1:95786208-95786230 CACCACAAGCTCTGCCTCCTGGG + Intergenic
911582951 1:99656397-99656419 CACCACCAACTCTGCATTGTTGG + Intronic
912781703 1:112555487-112555509 CACCACAAGCTCTGCCTCCTGGG - Intronic
913344561 1:117795344-117795366 TATCAGCAGCTCAGCCTGGGAGG + Intergenic
914937307 1:151992827-151992849 AACCAGGAGCTCTGCCTTGTTGG - Intronic
915062779 1:153200236-153200258 CACCAGGAGCTTTGGCTGGAAGG + Intergenic
915582736 1:156824843-156824865 CACAAGCTGCTCTGCCTCCTGGG - Intronic
916562012 1:165941411-165941433 GAACAGCGGCTCTGCATGGTCGG - Intergenic
917024467 1:170627076-170627098 CACTAGCAGATCTGCCTTGCAGG - Intergenic
917305416 1:173619100-173619122 CACCACCAGCCCTGCCTTGCAGG + Intronic
917796752 1:178538322-178538344 CACCAGAATCTGTGCCAGGTAGG + Intronic
918842781 1:189565196-189565218 CACCAGCATCTCTTTCTGGTAGG + Intergenic
919191868 1:194230772-194230794 CAGCAGCAGCTGTACCTGGGAGG + Intergenic
919453887 1:197801010-197801032 CAGCTGCAGCTGTGCCTGGGAGG - Intergenic
920677489 1:208048322-208048344 CCCCTGAAGCCCTGCCTGGTTGG - Intronic
921513034 1:216055323-216055345 CAGTAGCAGCTCTGCCTGTGTGG - Intronic
921699484 1:218251454-218251476 CAGAAGAAGCTCTGCCAGGTAGG - Intergenic
922427999 1:225517571-225517593 GACCAGTAGCTTTGCCTGGGGGG + Intronic
922702243 1:227768640-227768662 CACACACAGCACTGCCTGGTAGG + Intronic
924952658 1:248898571-248898593 CACCACCAGGCCTGCCTGGCAGG + Intergenic
1062770143 10:92552-92574 CAGCTGCAGCTGTGCCTGGGGGG + Intergenic
1064089614 10:12372536-12372558 CACCTGCTGCTCTACATGGTGGG - Intronic
1067796107 10:49323390-49323412 CTCCAGCAGCTTTGGTTGGTGGG - Exonic
1068605635 10:59002268-59002290 CACCTGCAGCTGGGCCAGGTAGG - Intergenic
1068915899 10:62431114-62431136 TTCCAGCAGCCCTGCCTGGGAGG + Intronic
1069538198 10:69271550-69271572 CACCACAAGCTCTGCCTCCTGGG + Intronic
1069561890 10:69436328-69436350 CAGCTGCAGCTGTGCCTGGGAGG + Intergenic
1069807951 10:71137699-71137721 GCCCAGCAGCACTGCCTGCTTGG + Intergenic
1069916230 10:71789007-71789029 TTCCATCACCTCTGCCTGGTAGG - Intronic
1070131258 10:73656855-73656877 CACCACAAGCTCTGCCTCGCGGG - Intronic
1070999360 10:80815692-80815714 CACCACAAGCTCTGCCTCCTGGG + Intergenic
1072257992 10:93639081-93639103 CTCCTGCAGATCTGTCTGGTAGG + Intronic
1072268609 10:93754069-93754091 CAGCAGCAGCTCAGCCTTGGTGG - Intergenic
1072753182 10:97999137-97999159 CAGCTGCAGCTGTGCCTGGGAGG - Intronic
1072971307 10:100020139-100020161 CACCTGCAGCAGGGCCTGGTGGG + Intergenic
1073485791 10:103818397-103818419 CAGCAGCAGCTGTGCCTGGCTGG + Intronic
1074232314 10:111549693-111549715 CATCTGCACCTCTGCCTGGATGG - Intergenic
1074536084 10:114329461-114329483 CACCAGCAGCTGCCCCTGGTGGG + Intronic
1074808224 10:117075625-117075647 CACCAGAAACTCTACTTGGTTGG + Intronic
1076596681 10:131626588-131626610 CACCAGCAGCTCTTCCAGAGTGG + Intergenic
1076655314 10:132019762-132019784 CAGCTGCAGCTGTGCCTGATGGG + Intergenic
1076677574 10:132155318-132155340 CACCAGCTTCTGTGCCTGGCTGG - Intronic
1077018754 11:408176-408198 CACAAGCACCTCTGACAGGTTGG + Exonic
1077039183 11:510660-510682 CACCAGAACCTCTGCCTCCTGGG - Intergenic
1077279392 11:1735255-1735277 CGCCAGCAGCCGTGCCTGGCGGG + Exonic
1077440358 11:2566009-2566031 CACCAGCCGCCCTGCCTTGGTGG - Intronic
1077539733 11:3140850-3140872 CAGCTGCAGCTCTGCATGGGCGG - Intronic
1077542480 11:3153791-3153813 CACCCGCAGCCGGGCCTGGTGGG - Intronic
1077601479 11:3577869-3577891 GACCAACAGCTCTTCCTGGAGGG - Intergenic
1077680766 11:4237932-4237954 CAGCAGCCGCCCTGCCTGGGAGG + Intergenic
1078359278 11:10655938-10655960 CCCCAGCAGCCCTGCCTGCAGGG + Intronic
1079112642 11:17613467-17613489 CACCATCAGCCCAGCCTGATGGG + Intronic
1080669778 11:34365438-34365460 CAACAGGAGCTCTGCCTGTCAGG + Intergenic
1081666313 11:44918938-44918960 CACCTGCAGCTCTGCCCAGAGGG - Intronic
1081767491 11:45621658-45621680 CAGCTGCAGCTATGCCTGGGAGG + Intergenic
1082808099 11:57462517-57462539 CACCAGCGACTCTGCCCTGTGGG + Intronic
1082991703 11:59212272-59212294 CACCAGGAGTTCTGCCAGGTAGG + Exonic
1083000806 11:59288895-59288917 GACCAGGAGTTCTGCCAGGTAGG + Intergenic
1083455610 11:62776773-62776795 CACCACAACCTCTGCCTGCTAGG - Intronic
1084195300 11:67521149-67521171 GACCTGCAGCTCTGCCAGGCAGG + Exonic
1084257390 11:67952443-67952465 GACCAACAGCTCTTCCTGGAGGG - Intergenic
1084805369 11:71575229-71575251 CACCAGCAGCTCTTCAGGGTTGG + Intergenic
1084904602 11:72335941-72335963 CAGAAGCCTCTCTGCCTGGTTGG + Intronic
1084967406 11:72751842-72751864 CACCAGCAACTGGGCCAGGTAGG + Intronic
1087156458 11:94909611-94909633 CTCCAGAACCCCTGCCTGGTTGG - Intergenic
1088918393 11:114244149-114244171 CATCAGCAGCTGTGTTTGGTAGG + Intronic
1089168713 11:116498035-116498057 CACCTGCTGCTCTGCCTGAAGGG + Intergenic
1090514790 11:127412945-127412967 CAGCTGCAGCTGTGCCTGGGAGG + Intergenic
1090849082 11:130555645-130555667 CACCGCCAAGTCTGCCTGGTTGG - Intergenic
1091051712 11:132378580-132378602 CACAAGCTGCTCTGCCAGTTGGG + Intergenic
1091981457 12:4867566-4867588 GAGCAGCGCCTCTGCCTGGTTGG + Intergenic
1093429317 12:19066052-19066074 CAATAGCAGGTCTGCCTCGTAGG - Intergenic
1094059006 12:26293647-26293669 CACCTGAGGCTCTGCCTGTTGGG - Intronic
1094142540 12:27195813-27195835 CACCTACAGCTTTGCCTGGGGGG + Intergenic
1095944004 12:47743771-47743793 CACCTGCAGCTCAGCCTCTTGGG - Intronic
1097064561 12:56311370-56311392 CTCCAGCAGCTCTGTGAGGTGGG + Exonic
1097100331 12:56583576-56583598 CACCACAACCTCTGCCTGCTGGG - Intronic
1100641254 12:96484188-96484210 CACCTGTAGGTCTGCCTGCTAGG - Intergenic
1101338975 12:103824480-103824502 GACCAGCAGCTGTGACTGGAGGG - Intronic
1101445579 12:104734692-104734714 CACCAACAGCCTTTCCTGGTAGG + Intronic
1101820932 12:108183912-108183934 CCCCAGGGGCTCTGCTTGGTAGG - Intronic
1102170001 12:110835137-110835159 GACCAGCAGCTATGGCGGGTGGG - Intergenic
1103783082 12:123412529-123412551 CACTACCAGCTCTTCCTGGAAGG + Exonic
1104435421 12:128752549-128752571 TCCCAGTAGCTTTGCCTGGTGGG - Intergenic
1104903150 12:132199814-132199836 GGCCAGCAGCACTGCCTGGGTGG + Intronic
1104959447 12:132481320-132481342 CACCACCATCTCTGCCTCCTGGG - Intergenic
1105761327 13:23517508-23517530 CACCAGCAGCACAGGCTGGAGGG - Intergenic
1105987928 13:25587841-25587863 CATTAAAAGCTCTGCCTGGTAGG - Intronic
1108519804 13:51236127-51236149 GAGCAGCAGCTGTGCCTAGTTGG - Intronic
1110857180 13:80309881-80309903 CACCACAACCTCTGCCTGCTGGG - Intergenic
1111485607 13:88895440-88895462 CAGCTGCAGCTGTGCCTGGAAGG - Intergenic
1113420067 13:110164474-110164496 CCCCAGGAGCGCTGCCTGATTGG - Intronic
1113582310 13:111438099-111438121 CAGGAGCGGCTTTGCCTGGTGGG - Intergenic
1116928509 14:50667600-50667622 AACCAACAACTCTGCCTGGTGGG + Intronic
1117063334 14:51984525-51984547 AGTTAGCAGCTCTGCCTGGTGGG + Intergenic
1117412821 14:55466210-55466232 CACCAGCATCTCAGCTTGTTGGG - Intergenic
1117491397 14:56251193-56251215 CAGCAGGAGCTCAGCCTGGGAGG + Intronic
1118002775 14:61539065-61539087 CTCAAGCAGCTCTGACTGATGGG - Intronic
1118877083 14:69794860-69794882 CACCAGAGGCTCTGCCTGGGTGG + Intronic
1119741288 14:77015269-77015291 CACGAGCTGCTGTGGCTGGTGGG + Intergenic
1119832109 14:77712518-77712540 CACCACAAGCTCTGCCTCCTGGG + Intronic
1120213734 14:81659917-81659939 CAGCACAAGCTCTGCTTGGTTGG + Intergenic
1120589963 14:86363666-86363688 CAGCTGCAGCTATGCCTGGGAGG - Intergenic
1121380794 14:93464071-93464093 CACTACCAGCTCTGCCTCCTGGG - Intronic
1121496476 14:94394966-94394988 CCCCAGCAGCTCTGCAAGGAAGG + Intergenic
1122046819 14:99029853-99029875 CACCCGAAGCTCTGCCCGATAGG - Intergenic
1122305735 14:100765262-100765284 CACCTGAAGCTCTGCCCAGTGGG + Intergenic
1122355881 14:101122606-101122628 CTCTAGCAGCTCTGCCTCCTTGG + Intergenic
1122361495 14:101169505-101169527 CACCAGCACCACTGGCTGATGGG + Intergenic
1122547834 14:102534340-102534362 CACCACAAGCTCTGCCTCCTGGG - Intergenic
1122859475 14:104576101-104576123 CATGGACAGCTCTGCCTGGTGGG + Intronic
1123717788 15:23043117-23043139 CCCCAGCACCTCTGGCAGGTGGG - Intergenic
1125527893 15:40389855-40389877 CTCCAGCAGCTCTACCTTCTGGG - Exonic
1125894703 15:43292929-43292951 CCCCAGCAGCTCTGACGGCTTGG + Exonic
1126408708 15:48349743-48349765 CTCCAGCAGGGCTCCCTGGTAGG + Intergenic
1127497022 15:59523083-59523105 CTCCAGCATCTCTGTCTTGTGGG + Exonic
1128083051 15:64867572-64867594 CACCAGCAGCCATGGCTGGCTGG + Exonic
1128107544 15:65055687-65055709 CACCCACAGCTCTGGCTTGTGGG + Intronic
1128495672 15:68197169-68197191 CTCCAGCTGCCCTGCCTTGTGGG + Intronic
1129667894 15:77589780-77589802 CTCCAGCAGCTCTGTCTTGCTGG + Intergenic
1130314354 15:82782322-82782344 CACCGCCAGCTCTGCCTCCTGGG - Intronic
1130908952 15:88257810-88257832 CACAAGCACCCCTTCCTGGTAGG + Intergenic
1132305239 15:100807388-100807410 TTGCTGCAGCTCTGCCTGGTGGG - Intergenic
1132566336 16:625268-625290 CTGCACCAGCTCTGCCTGGAGGG + Intronic
1132685402 16:1159955-1159977 CTCCAGGAGCCCGGCCTGGTGGG - Intronic
1132809038 16:1788877-1788899 CACCAGCAGCTCTGCCTGGTTGG + Exonic
1132908595 16:2297163-2297185 CACAAGCCCCCCTGCCTGGTTGG + Intronic
1132951723 16:2566615-2566637 CGCCAGCAGGTCTTCCTGGGGGG + Intronic
1132962627 16:2633555-2633577 CGCCAGCAGGTCTTCCTGGGGGG - Intergenic
1133649985 16:7803362-7803384 CACCACAAGCTCTGCCTCGCAGG - Intergenic
1133668218 16:7992010-7992032 CACCATAACCTCTGCCTGCTGGG + Intergenic
1133896567 16:9934885-9934907 CACCACCAGCCCTGCATGGATGG + Intronic
1134480497 16:14614770-14614792 CACCACCACCTCTGCCTCCTGGG - Intronic
1135026795 16:19005162-19005184 CACCACAAGCTCTGCCTCCTGGG + Intronic
1135198869 16:20419366-20419388 CACCAGCAGCTTGGTCTGGAGGG - Exonic
1136014492 16:27386766-27386788 CACCAGCTGCTCTACCTTCTCGG + Intergenic
1137476254 16:48811839-48811861 GACCAGCACCTCTGCCTGGGAGG - Intergenic
1137594361 16:49714034-49714056 CAGAAGCAACTGTGCCTGGTGGG - Intronic
1138283219 16:55788207-55788229 CACTACCAGCTCTGCCTCCTGGG + Intergenic
1139088799 16:63618637-63618659 CGCCTGCAGCTGTGCCTGGGAGG + Intergenic
1139150861 16:64380949-64380971 CAGCTGCAGCTGTGCCTGGGAGG - Intergenic
1139163293 16:64536971-64536993 CACCACCACCTCTGCCTCCTGGG + Intergenic
1139429793 16:66905021-66905043 CAACATCAGCCCTGTCTGGTAGG + Intergenic
1139674426 16:68513328-68513350 CACCACAAGCTCTGCCTCCTGGG - Intergenic
1139684614 16:68593263-68593285 CCTCATCAGCTCTGCCAGGTAGG - Intergenic
1140816008 16:78621678-78621700 CACCACGAGCTCTGCGTCGTGGG + Intronic
1142012092 16:87720682-87720704 TAGCAGCAGCTCTGCCTGGAGGG - Intronic
1142129463 16:88426095-88426117 CACCACCAGCTCAGGCCGGTGGG + Intergenic
1142983460 17:3684474-3684496 CACCTGCAGCCCTGGCTAGTGGG + Intronic
1143169998 17:4923483-4923505 CACCAGAACCTCTGCCTCCTGGG + Intergenic
1144145838 17:12397036-12397058 CACCATGACCTCTGCCTAGTTGG - Intergenic
1144661218 17:17072213-17072235 AAGCAGCAGCTCTTCCTGGGAGG + Intronic
1144675239 17:17157750-17157772 CACCACAACCTCTGCCTGCTGGG - Intronic
1144808587 17:17984068-17984090 CGGCAGAAGCTCTGCCTGCTGGG + Intronic
1144857561 17:18278083-18278105 CACCAGCAGCCGTGGGTGGTGGG + Exonic
1145216348 17:21055428-21055450 CACTACCAGCTCTGCCTCCTGGG - Intergenic
1145902068 17:28495867-28495889 CACCAGGGGTTCTGCCTGCTGGG + Intronic
1146086830 17:29837994-29838016 CAGCTGCAGCTATGCCTGGGAGG - Intronic
1146458340 17:33024436-33024458 CCCCACCTTCTCTGCCTGGTGGG + Intronic
1147242657 17:39100768-39100790 CAGCATCTGCTCTGACTGGTTGG - Intronic
1147684230 17:42277048-42277070 CTCCCGCAGCTCTGACTGGTGGG - Intergenic
1147948805 17:44095686-44095708 AAACAGCAGCTGTGCCTGGGGGG + Intronic
1148774318 17:50086974-50086996 CACCACCAGCTCTGCCTCCCAGG - Intronic
1148947331 17:51275119-51275141 CACCACAACCTCTGCCTGTTGGG - Intronic
1149256960 17:54837289-54837311 AAGCAGCAGCTGTGCCTGGGAGG + Intergenic
1149471564 17:56920365-56920387 CACCACAACCTCCGCCTGGTGGG + Intergenic
1150120971 17:62602187-62602209 ATCCAGGAGCTCTGCCAGGTTGG + Intronic
1150223813 17:63511922-63511944 CAGGAGCAGGTCTCCCTGGTGGG + Intronic
1150429529 17:65104011-65104033 GTCCAGCGGCTCTGCCTGGGGGG + Intergenic
1151560345 17:74866443-74866465 CACCAGCACCACAGCGTGGTAGG + Exonic
1151624838 17:75270386-75270408 CACCAGAAGCCAAGCCTGGTGGG - Intronic
1152077115 17:78166618-78166640 CAACAGCAGGTGTGCCAGGTGGG - Intergenic
1152205375 17:78971862-78971884 TTCCAGCAGCTCTGGATGGTGGG + Exonic
1152312785 17:79561005-79561027 CGCCCCCAGCTCTGTCTGGTGGG - Intergenic
1152391424 17:80006099-80006121 CACCAACACCCCTGCCTGGCGGG + Intronic
1152439173 17:80295017-80295039 CACCAGCTGCTCTACCTGCTGGG + Intronic
1152539206 17:80966492-80966514 CACCAGCAGCTCTGCGTCCCGGG + Intergenic
1152674705 17:81633052-81633074 CACCACAAGCTCTGCCTCCTGGG - Intronic
1153676656 18:7461666-7461688 CACCTACAGCCCAGCCTGGTTGG - Intergenic
1157570879 18:48711417-48711439 TTCCAGCATCACTGCCTGGTAGG + Intronic
1158476922 18:57788477-57788499 CACCAGGACCTCTGCCTCCTGGG - Intronic
1159800846 18:72897803-72897825 CACCAGCATCTCTGAATGTTTGG + Intergenic
1159867817 18:73727131-73727153 CCCCAGCACCACTGCCTGTTTGG + Intergenic
1160246779 18:77165696-77165718 CACCAGCTGCACTGCCAGGCTGG - Intergenic
1160824945 19:1075071-1075093 CGCCCCCAGCTCTGCCTGGAAGG + Intronic
1160863244 19:1246393-1246415 CACCATCACCTCAGTCTGGTCGG - Intergenic
1161546614 19:4884760-4884782 CACCAGAACCTCTGCCTCCTGGG - Intergenic
1161602405 19:5192455-5192477 CACTATCAGCTCTGCCTCCTGGG - Intronic
1162033625 19:7927699-7927721 CATCACCAGCTGTGCCTGGAAGG + Exonic
1162415464 19:10533828-10533850 CAACAACTGCTCTGCCTGGGAGG + Intergenic
1162902715 19:13804972-13804994 CAGCCGCAGCTCCACCTGGTGGG - Exonic
1162939104 19:13997409-13997431 CCTCAGCAGCCCCGCCTGGTAGG - Intronic
1163789217 19:19296569-19296591 CACCATAAGCTCTGCCTCCTGGG - Intronic
1164952914 19:32353711-32353733 CAGCAGCTGCTGCGCCTGGTGGG + Exonic
1165795976 19:38519355-38519377 CACCAGCAGCTCGCCCTCCTGGG - Exonic
1166239634 19:41481076-41481098 CAGCAGCAGTGCTGCCTTGTGGG - Intergenic
1167260291 19:48454349-48454371 GCCCAGCCGCTCTGCCTGGCTGG + Exonic
1167492059 19:49798740-49798762 CCCCAGCAGGTGTGCCAGGTGGG + Intronic
1167607181 19:50487680-50487702 CCCCTGCATCCCTGCCTGGTGGG - Exonic
1168176323 19:54630508-54630530 CACACGCAGCTCAGCCTGGGCGG + Exonic
1168259917 19:55187587-55187609 CCCCAGCAACTCTCCCTGGTGGG - Exonic
925222494 2:2153403-2153425 CACCTCCAGCTCTGACTGCTTGG - Intronic
927476916 2:23420653-23420675 CACCAGGAGCTCTGGCAGGTGGG - Intronic
927499803 2:23575093-23575115 CAGCAGCAGCTCTGCAGGCTCGG + Intronic
927710122 2:25319843-25319865 CACCACAACCTCTGCCTTGTGGG + Intronic
930774882 2:55161709-55161731 CAATAGCAGCTCTGCTTGCTGGG - Intergenic
931150306 2:59565599-59565621 CAGCAGAAGCTCTGCCCGTTTGG - Intergenic
932042728 2:68318402-68318424 CACCCGCAGTTCTTCCGGGTAGG + Intronic
933662493 2:84939199-84939221 CACCAGCAGGTCTGCAGGGAAGG + Intergenic
934531482 2:95092036-95092058 CATCAGCAGCACTGCCAAGTAGG - Intronic
937880276 2:126859249-126859271 GACCTGCAGCTCTGCTTGGCAGG + Intergenic
938241931 2:129748738-129748760 CAGCAGCAGCTCTTCCTGTCTGG + Intergenic
940129976 2:150370070-150370092 CATCAGCTGCTCTGGCGGGTAGG - Intergenic
941181516 2:162264945-162264967 CACCACCACCTCTGCCTCCTGGG + Intergenic
942912719 2:181265044-181265066 CACCGCAAGCTCTGCCTTGTGGG - Intergenic
944762237 2:202828186-202828208 CACCACCACCTCTGCCTTCTAGG - Intronic
944954125 2:204787922-204787944 CCCCAGGAGCTCCGTCTGGTAGG - Intronic
946531172 2:220571783-220571805 CACCAAAAGCTCTGCCTCCTGGG - Intergenic
1168821423 20:775969-775991 CCCCAGCCGCTCTGCATGGGAGG + Intergenic
1168983518 20:2027351-2027373 CAGCTGCAGCTGTGCCTGGGAGG + Intergenic
1169190010 20:3652742-3652764 CACCTGCACCTCTTACTGGTTGG - Intergenic
1170571354 20:17634579-17634601 GTCCAGAAGCTCTGGCTGGTGGG - Intronic
1171395683 20:24831483-24831505 CACCAGCAGATCCACTTGGTGGG - Intergenic
1171409842 20:24938805-24938827 CACAAGCTGCTCTGCCAGGTGGG - Intergenic
1172588471 20:36101339-36101361 GACCAGCAGCCCTGACTGGGAGG - Intronic
1172924152 20:38515128-38515150 CTCCAGCAGCAGTGCCTGCTGGG - Intronic
1173172798 20:40741234-40741256 CAGCAGGAGCTCTACCTGGGAGG + Intergenic
1173325185 20:42026664-42026686 CACCTGCAACTCTGCCTGCTTGG - Intergenic
1173473183 20:43339183-43339205 CACCACCAACTCTGCCTCCTGGG + Intergenic
1173946193 20:46952694-46952716 CACCTGGAGCTCTTCCTGGCAGG + Intronic
1174199900 20:48799848-48799870 CACCAGTACCTCTCCCTGGCTGG + Intronic
1174364275 20:50047047-50047069 TTCCAGCATCCCTGCCTGGTGGG + Intergenic
1174837139 20:53867240-53867262 CAGCAACAGCTCAGCCTGGCAGG - Intergenic
1174982022 20:55407518-55407540 AACAAGAATCTCTGCCTGGTAGG - Intergenic
1175310521 20:58008616-58008638 CTCCCACTGCTCTGCCTGGTGGG - Intergenic
1175316599 20:58052980-58053002 CTCAAGCAGCTCTGAGTGGTTGG + Intergenic
1175621267 20:60449467-60449489 CACCAGAAGGTCAGCCTGGCTGG - Intergenic
1176069879 20:63220663-63220685 CACCAGGAGCTCTGCTGGGCAGG - Intergenic
1176090392 20:63316001-63316023 CACCTGCGGCTCTGCGCGGTGGG + Intronic
1179549857 21:42137177-42137199 GACCAGCAGGTCCTCCTGGTGGG - Intronic
1179608881 21:42536127-42536149 CAGAGGCAGCTCTGCGTGGTGGG + Intronic
1179876922 21:44273289-44273311 CACCAGCACCTCCGCCGGGCAGG + Intergenic
1180958580 22:19752030-19752052 CACAGGCAGCTTTCCCTGGTCGG - Intergenic
1183095808 22:35551689-35551711 CACCAGCAGCTCGGCCTCGGTGG - Exonic
1183200830 22:36385031-36385053 AAACAGCATCTCTGCCTGCTGGG - Intronic
1183316697 22:37141069-37141091 CAGCTGCAGCCCTGCCTGGGAGG - Intronic
1183765207 22:39866976-39866998 CACCGCCAGCTCTGCCTCCTGGG + Intronic
1184114232 22:42412958-42412980 AAGCAGCAGCCCTGCCTGGGGGG + Intronic
1185043626 22:48518087-48518109 AAGCAGCAGGGCTGCCTGGTGGG - Intronic
1185328491 22:50239857-50239879 CCCCAACTGCTCTGCCTGGCAGG + Intronic
950001616 3:9660901-9660923 TACCAGAAGCTCTGACTGGCTGG + Intronic
950635074 3:14308513-14308535 CTCCTGCAGCCCTGCTTGGTTGG - Intergenic
950837491 3:15934858-15934880 CACCAGCTGCTCAGCCTTGCTGG - Intergenic
951284358 3:20790978-20791000 CACCAGGATCTCTGCCAGGAAGG - Intergenic
951696377 3:25449510-25449532 CACAAGCAGCTGTCCCTGGCAGG - Intronic
951778606 3:26338117-26338139 CACCAGCACTTGTTCCTGGTGGG - Intergenic
953507549 3:43501139-43501161 CACCAGCATCTCCATCTGGTGGG + Intronic
953854556 3:46491156-46491178 CCCCAGGAGCTCTGCCAGTTAGG + Intergenic
953891283 3:46753466-46753488 GGCCAGCTGCTCTGCCAGGTGGG - Intronic
954004476 3:47579794-47579816 CACCAGGAGGTCTGCTTAGTCGG + Exonic
954299421 3:49691501-49691523 CACCAGCAGGTATGGCTGGGTGG + Exonic
955611094 3:60758133-60758155 GACCAGCAGCCCTGGGTGGTGGG - Intronic
957598913 3:82306499-82306521 CACAATAAGCTCTGCCTGCTTGG + Intergenic
957614432 3:82509179-82509201 CAGCTGCAGCTGTGCCTGGATGG - Intergenic
960247938 3:115420199-115420221 TACCAGCAGTTCTGCCTTCTAGG + Intergenic
961368576 3:126416153-126416175 CAACAGCTGCCCTGCCTGCTTGG + Intronic
961743320 3:129047125-129047147 CACCTCCAGCTCTGCCCCGTGGG + Intergenic
961946233 3:130691948-130691970 CACCACAAGCTCTGCCTCCTGGG + Intronic
962344220 3:134607867-134607889 CTCCAGCACCTCTGCCTGGCTGG - Intronic
962876904 3:139542078-139542100 CACCAGGGGCTGTGCCTGGGAGG - Intergenic
963764842 3:149323965-149323987 CAGAAGCAGCTCTGCCATGTAGG + Intronic
965744226 3:171907329-171907351 CACCAGCAGCTCTGAGTGCGGGG + Intronic
967017732 3:185496942-185496964 CTCCCGCAGCTCTGCCAGGTCGG + Exonic
967030910 3:185605783-185605805 CACCAGCAGCTGTGACTGGGTGG + Intronic
967102324 3:186225850-186225872 CACCAGCAGCTCAGACAGGAAGG - Intronic
968891474 4:3371683-3371705 CTGCTGCAGCTCTGCCTGGCTGG + Intronic
969037829 4:4269543-4269565 CACCAGGAGCCCTGCCCGGCAGG + Intronic
969073488 4:4558536-4558558 CTCCTGCAGCTCTGCCTTGCTGG + Intergenic
969371830 4:6736364-6736386 CACCACCAGCTCTGCCTCCCGGG - Intergenic
969418806 4:7077863-7077885 CTGCAGCAGCTCTGCAAGGTGGG + Intergenic
969537692 4:7766797-7766819 GACCTGGAGCTGTGCCTGGTGGG + Intronic
970163878 4:13215856-13215878 CAACAGGAGCTCAGGCTGGTAGG + Intergenic
972586192 4:40438783-40438805 CGCCAGCAGTGCTGCCTCGTTGG + Exonic
973633113 4:52838070-52838092 CACCAGCAGCTGGGGCTGCTGGG - Intergenic
974040533 4:56853348-56853370 CACCAGAACCTCTGCCTCCTAGG - Intergenic
974179059 4:58360917-58360939 CAGCTGCAGCTGTGCCTGGGAGG + Intergenic
977321612 4:95523228-95523250 CAAGAGCTGCTTTGCCTGGTAGG - Intronic
978561927 4:110042674-110042696 CAACAGCAGCTGCGCCTGGCAGG + Intergenic
978663526 4:111155060-111155082 CAGCTGCAGCTGTGCCTGGGAGG + Intergenic
982137199 4:152282827-152282849 CACCAGCAGCTATGTCTGGGGGG - Intergenic
982138306 4:152293855-152293877 CAGCTTCAGCTCTGCCTGATCGG + Intergenic
982771469 4:159400939-159400961 CAGCAGCAGTTCTGCAGGGTGGG - Intergenic
984230388 4:177090694-177090716 CACTGCAAGCTCTGCCTGGTGGG - Intergenic
984826436 4:183928877-183928899 CACCAGCAGCTGTGGTGGGTTGG - Intronic
985365077 4:189221867-189221889 CACCAGCTGCTCTGAGTGGCTGG - Intergenic
987069549 5:14322918-14322940 CACCTGCTGATCTTCCTGGTGGG + Intronic
989672853 5:43938452-43938474 CACCACAAGCTCTGCCTCCTGGG - Intergenic
991457933 5:66824279-66824301 CACCAAGAACTCTGACTGGTGGG + Intronic
991941905 5:71861534-71861556 CAGCAGCAGCTCTGTGGGGTTGG + Intergenic
994095337 5:95842660-95842682 CAGCAGCAGTTCTGATTGGTTGG + Intergenic
996273874 5:121640779-121640801 CAGCAGCAGCTCTTCTTGTTGGG + Intergenic
998548292 5:143050897-143050919 CACCATCACCTTTGCCTGTTGGG + Intronic
999200326 5:149811855-149811877 CCAAGGCAGCTCTGCCTGGTAGG - Intronic
1001477314 5:172059794-172059816 TACCAGCAGCTTTGCTTGGGGGG - Intronic
1001638371 5:173228776-173228798 CTCCAGGAGCTCAGCCTGGTAGG + Intergenic
1002984083 6:2170917-2170939 CACCACAAGCTCTGCCTCCTGGG - Intronic
1003026127 6:2557280-2557302 CACCGGAAGCCTTGCCTGGTGGG + Intergenic
1003859644 6:10310601-10310623 CACCAGCAGTTCAGTCGGGTTGG + Intergenic
1004516961 6:16328453-16328475 CAACAGCAGCTCTGGATGCTGGG + Exonic
1004644736 6:17549385-17549407 CACCACAACCTCTGCCTGCTGGG - Intronic
1004645376 6:17555268-17555290 CACCACAAGCTCTGCCTCATGGG + Intronic
1005011692 6:21341968-21341990 AACCACCTGCTCTACCTGGTGGG - Intergenic
1005495552 6:26384830-26384852 GACCAGTAGCTGTGGCTGGTCGG - Intronic
1006131448 6:31871593-31871615 GGCCAGGAGCTCTGCCTGGAGGG + Intronic
1006182905 6:32164592-32164614 CAGAAGCAGCTCAGACTGGTGGG - Exonic
1014324131 6:119969792-119969814 CACCACAAGCTCTGCCTCCTGGG - Intergenic
1015793297 6:136985901-136985923 CACCACAAGCTCTGCCTCCTGGG + Intergenic
1016181760 6:141155532-141155554 CATCAGCATCTCTTCCTGGTAGG - Intergenic
1017048111 6:150365988-150366010 CACCATGACCTCTGCCTGGAAGG + Intergenic
1017732777 6:157332654-157332676 GGCCAGCAGCTCTGCCTAGTGGG + Intergenic
1018273848 6:162108966-162108988 CAGCAGCAGCGCTGCCCCGTAGG + Intronic
1019423125 7:960610-960632 ATCCAGCAGCTCTTCCTGCTTGG + Intronic
1019452510 7:1107036-1107058 CAGCATCAGCTCTGCCTGGAAGG + Intronic
1019747433 7:2708728-2708750 CCCCAGCAGCTGTGCGTGGGGGG + Intronic
1019835298 7:3377541-3377563 AAGCAGCAGCTCTGCCTGACAGG - Intronic
1020085696 7:5309028-5309050 CATCAGCAGCCCTGCCCAGTGGG - Intronic
1020709145 7:11584170-11584192 CATCAGCAGCTCAGCCTTGCTGG + Intronic
1020742503 7:12039583-12039605 CACTACAAGCTCTGCCTCGTGGG - Intergenic
1021220693 7:17972371-17972393 CACCAGAACCTCTGCCTGCCAGG - Intergenic
1021724846 7:23538829-23538851 CACCAAAAGCTCTGCCTCCTAGG + Intergenic
1022494070 7:30842366-30842388 TGCCATCAGCTCTCCCTGGTGGG + Intronic
1022672776 7:32471795-32471817 CACAAGCAGATCTTCCTGGGTGG + Intergenic
1024053799 7:45646701-45646723 CAGCTGCAGCTCAGCCTGCTGGG + Intronic
1024295624 7:47839676-47839698 CAGCAGCATCTCAGCCGGGTGGG + Intronic
1024640023 7:51320817-51320839 CACCAGCTGCTCTTTCTGGAGGG + Intergenic
1025079710 7:55970875-55970897 CACCATCAGCTTGGCCTGGGAGG - Intronic
1025101157 7:56136339-56136361 TACCAGCAGATCTGTTTGGTGGG + Intergenic
1025191291 7:56897823-56897845 CACCAGGTGCTGGGCCTGGTGGG - Intergenic
1025208616 7:57008136-57008158 CATCAGCAGCCCTGCCCAGTGGG + Intergenic
1025616104 7:63118344-63118366 CACCAGAACCTCTGCCTCCTGGG - Intergenic
1025663331 7:63568742-63568764 CATCAGCAGCCCTGCCCAGTGGG - Intergenic
1025680655 7:63679111-63679133 CACCAGGTGCTGGGCCTGGTGGG + Intergenic
1026318190 7:69245727-69245749 CACCAGCAGATCTGTTTGGTGGG - Intergenic
1027027437 7:74863820-74863842 CACCACAACCTCTGCCTGATGGG - Intergenic
1027060315 7:75080276-75080298 CACCACAACCTCTGCCTGATGGG + Intergenic
1027924635 7:84445416-84445438 CACTAGAAGCTCTGCCTCCTGGG - Intronic
1029074592 7:97925879-97925901 GACCAACAGCTCTTCCTGGAGGG - Intergenic
1029872901 7:103714560-103714582 CAGAAGCTGCTCTGCATGGTGGG - Intronic
1030364759 7:108632715-108632737 CACTAGCAGCTCTGCCTAAATGG - Intergenic
1031265196 7:119572457-119572479 CAGCTGCAGCTGTGCCTGGGAGG - Intergenic
1031974541 7:128085364-128085386 AGCCAGCAGATCTGCCTGGGAGG - Intronic
1033035981 7:137876729-137876751 CACCAGCACTTCTGCTTGCTGGG - Exonic
1033048514 7:137983555-137983577 AGTCAGCAGCTTTGCCTGGTTGG - Intronic
1033611824 7:142970615-142970637 CACCAGCACCTCTGACAGGAGGG - Intergenic
1034997002 7:155583959-155583981 CTCCTGAAGCTCTCCCTGGTTGG - Intergenic
1035090752 7:156308020-156308042 CACCCCCAGCACTGCATGGTGGG - Intergenic
1035141466 7:156766724-156766746 CACCAGCAGCTAGGACTGCTTGG - Intronic
1036829616 8:12011781-12011803 GACCAACAGCTCTTCCTGGAGGG - Intergenic
1037578283 8:20228507-20228529 TTCCACCAGCTCTGCCTCGTGGG + Intergenic
1037647674 8:20808216-20808238 CACCAGCATCTTTTTCTGGTGGG - Intergenic
1037785829 8:21902585-21902607 CTTCAACAGCTCTGCCAGGTGGG - Intergenic
1037995968 8:23352563-23352585 CAGCAGCAGCTCTGTCTGTCTGG - Intronic
1038478020 8:27882454-27882476 GACCAGCAGCCTTGCCTGCTAGG + Intronic
1038556210 8:28519652-28519674 CACCACCACCTCTGCCTCCTAGG - Intronic
1038659630 8:29486112-29486134 CCCCAGCAGGCCTGCCTGGCAGG + Intergenic
1039279152 8:35963717-35963739 CATGAGCCGTTCTGCCTGGTTGG + Intergenic
1039830803 8:41212355-41212377 TTCCAGCATCTCTGCCTAGTAGG - Intergenic
1039846372 8:41328487-41328509 CACCACAACCTCTGCCTGCTGGG - Intergenic
1040546798 8:48404285-48404307 CTCCAGGAGCTGTGCCTGGTAGG - Intergenic
1040888255 8:52288919-52288941 CACCACTAGCTCTGCCTCCTTGG + Intronic
1041738183 8:61133114-61133136 GGCCAGATGCTCTGCCTGGTGGG + Intronic
1043483242 8:80673898-80673920 CCCCAGAGGCTCTGCCTGGGTGG + Intronic
1043607403 8:82019016-82019038 CAAAAGGAGCTCTGCCTGTTGGG + Intergenic
1043782001 8:84347787-84347809 CATCAGCAGCTTTGCCTCTTAGG + Intronic
1044318373 8:90775153-90775175 TACAAGCAGCCCTGCCTAGTGGG - Intronic
1046213252 8:111107554-111107576 CACTAGGAGCTCTGCCTCCTGGG + Intergenic
1047482834 8:125301188-125301210 CCCCAGCAGCACAGGCTGGTGGG + Intronic
1047781323 8:128113726-128113748 CACCACAAGCTCTGCCTCCTGGG - Intergenic
1048299994 8:133244554-133244576 CACCAGCAGCCTTGCCTGGTGGG - Intronic
1048429586 8:134357750-134357772 CCTCTGCAGCTCTGCCTGCTTGG + Intergenic
1049236018 8:141512836-141512858 CAACTTCAGCTCAGCCTGGTGGG - Intergenic
1051667352 9:19477609-19477631 CACCATAAGCTCTGCCTCCTGGG + Intergenic
1052339749 9:27353521-27353543 CAGCAGCAGCTCTACAAGGTAGG + Intronic
1053362935 9:37502416-37502438 CACCACCAGCTCTCCCAGTTGGG - Intronic
1053690570 9:40584791-40584813 CACCAGCAGTGCAGCCTGGATGG - Intergenic
1054274246 9:63052704-63052726 CACCAGCAGTGCAGCCTGGATGG + Intergenic
1054301826 9:63385762-63385784 CACCAGCAGTGCAGCCTGGATGG - Intergenic
1054400595 9:64712265-64712287 CACCAGCAGTGCAGCCTGGATGG - Intergenic
1054434201 9:65196580-65196602 CACCAGCAGTGCAGCCTGGATGG - Intergenic
1054496188 9:65825100-65825122 CACCAGCAGTGCAGCCTGGATGG + Intergenic
1055672585 9:78622371-78622393 CACCAGCAGATCTCCTTGGGAGG - Intergenic
1056410756 9:86324290-86324312 CAGCAGCAGCAGAGCCTGGTGGG - Intronic
1056666024 9:88581511-88581533 CACCACAACCTCTGCCTCGTAGG + Intronic
1058920428 9:109609373-109609395 CACCACCACCTCTACCTGGGAGG + Intergenic
1059375290 9:113876319-113876341 CACCAGCAGCCCGGCCCGGGAGG + Exonic
1061248136 9:129411987-129412009 CACCACCAGCTCTGCGTGGACGG + Intergenic
1061580087 9:131531095-131531117 CACCAGCGGCCCTTCCTGATAGG - Exonic
1061699734 9:132406816-132406838 CAACAGCAGCACTTCCGGGTTGG - Exonic
1062071044 9:134555126-134555148 CACCAGCCACTCTGCATGGCTGG - Intergenic
1062422600 9:136490560-136490582 CACCAGCAGCGGTTCCTGGTGGG - Intergenic
1062683971 9:137800474-137800496 CACCAGCAGCCTTGGCTGGCAGG - Intronic
1185676374 X:1852558-1852580 CACCACAAGCTCCGCCTGCTGGG + Intergenic
1186006179 X:5074898-5074920 CACCAGCAGCTCTACAGGGTAGG - Intergenic
1186168470 X:6852365-6852387 CATCAGCAGCTCTGGCTGCTGGG - Intergenic
1186791486 X:13003976-13003998 CACCACAACCTCTGCCTGCTGGG + Intergenic
1188116826 X:26254712-26254734 GCCCAGCAGCACTGTCTGGTGGG - Intergenic
1188240162 X:27776604-27776626 AACCAACAGATGTGCCTGGTAGG + Intergenic
1189459899 X:41231652-41231674 CACCACCACCTCTGCCTCCTGGG - Intronic
1190580770 X:51891991-51892013 CAACATCAGTTCTGCCTGGCTGG - Intronic
1190631325 X:52389643-52389665 CACCTGTGTCTCTGCCTGGTAGG + Intergenic
1192190925 X:68990770-68990792 CTCCAGCAGCCCTGCCTGGGAGG + Intergenic
1193256501 X:79355159-79355181 CCCCTGCAGCACTGCCTAGTGGG + Intergenic
1194699522 X:97096581-97096603 CACCACCAGCTGTGCCCCGTGGG - Intronic
1195089234 X:101442647-101442669 CAAAAGCAGGTCTGCCTGTTGGG + Intronic
1195998866 X:110759911-110759933 CACCAGCACCTCTGCTGGGTTGG + Intronic
1197269313 X:124408594-124408616 CACCAGCAACTTTGCCTCATTGG + Intronic
1197600489 X:128521124-128521146 AACAAGAATCTCTGCCTGGTTGG + Intergenic
1200048061 X:153413042-153413064 CTCCAGCCGTTCTGCCAGGTGGG + Intergenic
1200116452 X:153771757-153771779 CCCCAGCAGCTCGGCCTGGCTGG + Intronic
1200765098 Y:7074171-7074193 CACCAGCATCTGTGGCTGATGGG + Intronic
1202045495 Y:20733703-20733725 CACCAGCATCTCTGGCTGATGGG + Intergenic