ID: 1132809041

View in Genome Browser
Species Human (GRCh38)
Location 16:1788892-1788914
Sequence CTGGTTGGCCTGCAGTGCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 435}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132809028_1132809041 22 Left 1132809028 16:1788847-1788869 CCCCGACCAGCCCAGCCCCAGGA 0: 1
1: 0
2: 5
3: 66
4: 635
Right 1132809041 16:1788892-1788914 CTGGTTGGCCTGCAGTGCCGTGG 0: 1
1: 0
2: 0
3: 27
4: 435
1132809034_1132809041 7 Left 1132809034 16:1788862-1788884 CCCCAGGATGTGTCGCACCAGCA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1132809041 16:1788892-1788914 CTGGTTGGCCTGCAGTGCCGTGG 0: 1
1: 0
2: 0
3: 27
4: 435
1132809030_1132809041 20 Left 1132809030 16:1788849-1788871 CCGACCAGCCCAGCCCCAGGATG 0: 1
1: 0
2: 5
3: 69
4: 512
Right 1132809041 16:1788892-1788914 CTGGTTGGCCTGCAGTGCCGTGG 0: 1
1: 0
2: 0
3: 27
4: 435
1132809029_1132809041 21 Left 1132809029 16:1788848-1788870 CCCGACCAGCCCAGCCCCAGGAT 0: 1
1: 0
2: 2
3: 42
4: 440
Right 1132809041 16:1788892-1788914 CTGGTTGGCCTGCAGTGCCGTGG 0: 1
1: 0
2: 0
3: 27
4: 435
1132809033_1132809041 11 Left 1132809033 16:1788858-1788880 CCAGCCCCAGGATGTGTCGCACC 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1132809041 16:1788892-1788914 CTGGTTGGCCTGCAGTGCCGTGG 0: 1
1: 0
2: 0
3: 27
4: 435
1132809036_1132809041 5 Left 1132809036 16:1788864-1788886 CCAGGATGTGTCGCACCAGCAGC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1132809041 16:1788892-1788914 CTGGTTGGCCTGCAGTGCCGTGG 0: 1
1: 0
2: 0
3: 27
4: 435
1132809031_1132809041 16 Left 1132809031 16:1788853-1788875 CCAGCCCAGCCCCAGGATGTGTC 0: 1
1: 0
2: 5
3: 50
4: 397
Right 1132809041 16:1788892-1788914 CTGGTTGGCCTGCAGTGCCGTGG 0: 1
1: 0
2: 0
3: 27
4: 435
1132809035_1132809041 6 Left 1132809035 16:1788863-1788885 CCCAGGATGTGTCGCACCAGCAG 0: 1
1: 0
2: 2
3: 6
4: 103
Right 1132809041 16:1788892-1788914 CTGGTTGGCCTGCAGTGCCGTGG 0: 1
1: 0
2: 0
3: 27
4: 435
1132809032_1132809041 12 Left 1132809032 16:1788857-1788879 CCCAGCCCCAGGATGTGTCGCAC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1132809041 16:1788892-1788914 CTGGTTGGCCTGCAGTGCCGTGG 0: 1
1: 0
2: 0
3: 27
4: 435
1132809039_1132809041 -10 Left 1132809039 16:1788879-1788901 CCAGCAGCTCTGCCTGGTTGGCC 0: 1
1: 0
2: 7
3: 41
4: 322
Right 1132809041 16:1788892-1788914 CTGGTTGGCCTGCAGTGCCGTGG 0: 1
1: 0
2: 0
3: 27
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132809041 Original CRISPR CTGGTTGGCCTGCAGTGCCG TGG Exonic
900249410 1:1659593-1659615 CAGGTTGGAGTGCAGTGGCGTGG + Intronic
900260347 1:1724904-1724926 CAGGTTGGAGTGCAGTGGCGTGG + Intronic
900607951 1:3532091-3532113 CAGGGTGGCCAGCAGTGCCCAGG + Intronic
901338713 1:8475327-8475349 CAGGCTGGCGTGCAGTGGCGCGG - Intronic
902313853 1:15602954-15602976 CAGGTTGGAGTGCAGTGGCGCGG - Intergenic
902401292 1:16158754-16158776 CAGGCTGGAGTGCAGTGCCGCGG - Intergenic
903309306 1:22441520-22441542 CAGGTTGGAGTGCAGTGCAGTGG + Intergenic
903397006 1:23009320-23009342 CTGGCTGGAGTGCAGTGCAGTGG + Intergenic
903410845 1:23141611-23141633 CTGCTTGGCCTGTAGTGCTTTGG - Intronic
903778829 1:25809165-25809187 CTGGCTGGCCTGGAGCACCGGGG + Intronic
904346424 1:29874213-29874235 CAGGTTGGAGTGCAGTGGCGTGG - Intergenic
906315309 1:44783288-44783310 ATGGTGGGCCTGCAGCGCTGGGG - Intergenic
906583822 1:46958261-46958283 ATGTATGGCCTGCAGTGCAGGGG - Intergenic
906877700 1:49556889-49556911 CGGGTGGGCCTGCAGTGCTGGGG + Intronic
908772615 1:67610270-67610292 CTGGGGGACCTGCAGTGCCTGGG - Intergenic
909904556 1:81178795-81178817 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
909972492 1:82007225-82007247 TTGGCTGGACTGCAGTGCCCAGG - Intergenic
911228206 1:95331643-95331665 CAGGTTGGAGTGCAGTGGCGCGG + Intergenic
911671729 1:100615473-100615495 CAGGCTGGACTGCAGTGGCGTGG + Intergenic
912058113 1:105631423-105631445 CCGGTGGGCCGGCACTGCCGGGG + Intergenic
913987103 1:143575233-143575255 CTGGTGGGCCAGCACTGCTGGGG - Intergenic
914999198 1:152572790-152572812 ATGGTGGGCCTGGAGTGCTGAGG + Intronic
915217699 1:154350910-154350932 CTGGATGGGCTGCAGTGAGGTGG + Exonic
916115045 1:161479176-161479198 CAGGTGGGCCGGCAGTGCTGGGG - Intergenic
917406344 1:174711569-174711591 CGGGTGGGCCAGCAGTGCTGGGG - Intronic
918853201 1:189718486-189718508 CTGGTGGGCCAGCACTGCTGGGG + Intergenic
918972167 1:191433434-191433456 TTGGTTGGCCTCCAGTCCGGAGG - Intergenic
920038574 1:203081730-203081752 CTGGGTGGGCTGCAGTGCCTTGG - Intergenic
920242311 1:204562235-204562257 CTGGTGGGGCTGCAGTGAGGCGG + Intergenic
920642752 1:207769805-207769827 CAGGATGGCGTGCAGTGGCGCGG + Intronic
920883144 1:209898988-209899010 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
922816460 1:228452888-228452910 CTGGTGGGCCTGTGGGGCCGGGG - Intergenic
923596971 1:235367940-235367962 CAGGCTGGACTGCAGTGGCGCGG + Intronic
924367031 1:243305258-243305280 CAGGTTGGAGTGCAGTGGCGTGG - Intronic
1063365608 10:5488569-5488591 CAGGTTGGCATCCAGTGTCGGGG - Intergenic
1065199089 10:23296825-23296847 ATGTATGGCCTGCAGTGCAGGGG + Intronic
1065359232 10:24873619-24873641 CTGGTTGGCCTGCACTGCAAAGG - Intronic
1066334897 10:34465821-34465843 CTGCTTTCCATGCAGTGCCGGGG - Intronic
1066406752 10:35126521-35126543 CAGGCTGGGCTGCAGTGGCGTGG - Intergenic
1066544236 10:36482186-36482208 CTGGTGGGCTGGCAGTGCTGGGG + Intergenic
1067179469 10:43973887-43973909 TTGGAGGGCCTGCAGTGCCCAGG - Intergenic
1067713089 10:48665919-48665941 ATGTATGGCCTGCAGTGCAGGGG + Intergenic
1068211341 10:53924354-53924376 CTGGCAGGCCTGCACTGCTGGGG - Intronic
1070057198 10:72946961-72946983 CAGGTTGGAGTGCAGTGCAGTGG + Intronic
1071396808 10:85232167-85232189 ATGCTTGGACTGCAGTGGCGAGG + Intergenic
1073008119 10:100340027-100340049 CTGAGGGGCCTGCAGTGCCTGGG + Intergenic
1073130911 10:101188649-101188671 CAGGTTGGAGTGCAGTGGCGGGG - Intergenic
1073789761 10:106928291-106928313 CCGGTGGGCCGGCACTGCCGAGG + Intronic
1073837412 10:107460304-107460326 CTGCTTGGCCTTTAGTGCTGGGG - Intergenic
1074317159 10:112370483-112370505 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
1074367900 10:112874825-112874847 ATGGTGGGCCTGCAGAGCCAGGG - Intergenic
1074502203 10:114036565-114036587 CTGGCTGGAGTGCAGTGGCGTGG + Intergenic
1074996332 10:118760335-118760357 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
1075290745 10:121228579-121228601 CTGGTGGCCCTGCAGTTCTGTGG + Intergenic
1075495747 10:122917185-122917207 CTGGTTGGCCTGCAATTCCATGG - Intergenic
1076399602 10:130172896-130172918 CAGGTTGGAGTGCAGTGGCGTGG - Intronic
1076947819 10:133664484-133664506 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
1076948809 10:133667794-133667816 CTGGCTGGGCTGCAGCGCGGGGG - Exonic
1076949793 10:133671093-133671115 CTGGCTGGGCTGCAGCGCGGGGG - Intronic
1076950777 10:133674392-133674414 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
1076951767 10:133677702-133677724 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
1076952756 10:133681012-133681034 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
1076953740 10:133684311-133684333 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
1076954724 10:133740663-133740685 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
1076955713 10:133743973-133743995 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
1076956703 10:133747283-133747305 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
1076957690 10:133750592-133750614 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
1076958675 10:133753891-133753913 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
1076959664 10:133757201-133757223 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
1076960648 10:133760500-133760522 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
1077334641 11:1997901-1997923 CTGATTGGCCGGCAGGGCAGGGG - Intergenic
1077473348 11:2775112-2775134 CTGGCTTGCCTGCAGGGCCAAGG + Intronic
1077636192 11:3842640-3842662 CAGGCTGGACTGCAGTGGCGCGG + Intergenic
1078658170 11:13261621-13261643 CTGGTTGGTCTGCAGAGCTCTGG + Intergenic
1078687818 11:13549462-13549484 TTGGTTGGCCTTCAGTCACGAGG + Intergenic
1078810747 11:14759591-14759613 CTGGTTGGAGTGCAGTGGCGTGG + Intronic
1080107493 11:28525988-28526010 CTGGTGGGCCAGCACTGCTGGGG + Intergenic
1081115321 11:39192739-39192761 CTGGTGGGCCAGCACTGCTGGGG + Intergenic
1081374698 11:42344521-42344543 CAGGTGGGCCAGCAGTGCTGGGG + Intergenic
1082261213 11:50077357-50077379 CAGATTGGCCTGCAGGGCTGCGG + Intergenic
1083240373 11:61383573-61383595 CAGGTTGGAGTGCAGTGTCGAGG - Intergenic
1083633477 11:64107804-64107826 CTGGTGGGCCTGCAGTCCCTGGG + Intronic
1083674391 11:64317357-64317379 CTCGGTGGCCTGCAGGGCGGAGG + Exonic
1084374706 11:68768448-68768470 CAGGTTGGAGTGCAGTGGCGTGG + Intronic
1084383134 11:68826140-68826162 CAGGTTGGCTTTCAGTGCGGGGG - Intronic
1085601358 11:77858922-77858944 ATGCATGGCCTGCAGTGCAGGGG + Intronic
1086111868 11:83208066-83208088 CTGGCTGGAGTGCAGTGCCCTGG + Intronic
1086441558 11:86834107-86834129 ATGTATGGCCTGCAGTGCAGGGG + Intronic
1087407306 11:97745806-97745828 CTGGTGGGCCAGCACTGCTGGGG + Intergenic
1087966556 11:104422617-104422639 CTGGTGGGCCAGCACTGCTGGGG + Intergenic
1089501247 11:118932672-118932694 CAGGTTGGAGTGCAGTGGCGCGG + Intronic
1089666875 11:120026071-120026093 CTGGTGGGCCAGCACTGCTGGGG - Intergenic
1091048717 11:132348904-132348926 CAGGCTGGAGTGCAGTGCCGTGG - Intergenic
1202817624 11_KI270721v1_random:53083-53105 CTGATTGGCCGGCAGGGCAGGGG - Intergenic
1093291046 12:17322466-17322488 TTGGTTGGCCTCCAGTGAGGAGG + Intergenic
1093381577 12:18500318-18500340 CTGGTGGGCCGGCACTGCTGGGG - Intronic
1094666495 12:32525846-32525868 CCGGTGGGCCAGCAGTGCTGGGG - Intronic
1095587419 12:43864066-43864088 CTGGTGGGCCAGCACTGCTGGGG - Intronic
1096312835 12:50536610-50536632 CTGGCTGGAGTGCAGTGGCGTGG + Intronic
1097017915 12:56000331-56000353 CTGGTGGGCCGGCACTGCTGGGG + Intronic
1097253690 12:57655939-57655961 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
1097863851 12:64543305-64543327 CTGGTGGGCCGGCACTGCTGTGG - Intergenic
1099413705 12:82361605-82361627 CTGGTGGGCCGGCACTGCTGGGG + Intronic
1099927309 12:89033401-89033423 CTGGATGGCCTTCAGTTCCTTGG + Intergenic
1100584704 12:95969307-95969329 CTGGTGGGCCAGCACTGCTGGGG - Intergenic
1100845743 12:98655826-98655848 CAGGTTGGAGTGCAGTGGCGCGG + Intronic
1101849153 12:108388461-108388483 AAGGTTGGCCTGAAGTGCTGGGG + Intergenic
1102085688 12:110137293-110137315 CAGGCTGGGCTGCAGTGGCGCGG - Intronic
1102309765 12:111835826-111835848 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
1103974587 12:124694153-124694175 CAGGTTGGAGTGCAGTGGCGCGG - Intergenic
1104229882 12:126874480-126874502 CTGTCTGGGCTGCAGTGCCCTGG + Intergenic
1104373885 12:128247415-128247437 CTGGCAGGCCGGCAGTGCTGGGG - Intergenic
1104991244 12:132624975-132624997 CAGGTCTGCCTGAAGTGCCGCGG - Exonic
1105270772 13:18873562-18873584 CTGTTTGGTCTGCTGTGCAGAGG - Intergenic
1105553268 13:21418711-21418733 CTGCCTGGGCTGCAGTGCAGTGG + Intronic
1105871134 13:24506994-24507016 CTGGTGGGCCGGCACTGCTGGGG + Intronic
1106490863 13:30220414-30220436 CAGGTTGGGGTGCAGTGGCGTGG - Intronic
1106617057 13:31339854-31339876 CTGGTGGGCCAGCACTGCTGGGG + Intergenic
1107360308 13:39610486-39610508 CAGGTTGGAGTGCAGTGCAGTGG - Intergenic
1107714064 13:43180913-43180935 CTGGCTGGCCTGCTGGGCCTTGG - Intergenic
1108877108 13:55060627-55060649 ATGTATGGCCTGCAGTGCAGGGG - Intergenic
1109566980 13:64131005-64131027 CAGTTTGGCCTGCAGTGGTGAGG - Intergenic
1109603113 13:64658371-64658393 CTGGTTGCTCTTCAGTGCTGGGG - Intergenic
1110450260 13:75632903-75632925 CAGGCTGGAGTGCAGTGCCGTGG + Intronic
1111013001 13:82336687-82336709 CAGGCTGGGCTGCAGTGCAGTGG - Intergenic
1112226510 13:97545449-97545471 CTGGTGGGCCAGCACTGCTGGGG - Intergenic
1112838369 13:103545534-103545556 CAGGTTGGAGTGCAGTGGCGTGG + Intergenic
1113612612 13:111658185-111658207 TTGGTTGGCCTGCTGTGCCTGGG - Intronic
1113964184 13:114143129-114143151 CTGGTTGGCTTGGAGAGCAGTGG - Intergenic
1114291957 14:21295808-21295830 CTGTTTGGGCTGGAGTGCAGTGG + Intronic
1114384728 14:22243075-22243097 ATGTATGGCCTGCAGTGCAGGGG - Intergenic
1114569077 14:23653347-23653369 CTGGTTTTCCTCCAGTGCCCTGG + Intergenic
1114592340 14:23877653-23877675 CAGGCTGGACTGCAGTGGCGTGG - Intergenic
1114719533 14:24866007-24866029 TTGACTGGCCTGCAGTGCCCAGG + Intronic
1115028406 14:28767515-28767537 CTGGGGGGGCTGCGGTGCCGGGG - Exonic
1116624023 14:47242616-47242638 CTGGTGGGCCAGCACTGCTGGGG - Intronic
1116656969 14:47665703-47665725 CTGGTGGGCCAGCAGTGCTGGGG - Intronic
1117198227 14:53362359-53362381 ATGTATGGCCTGCAGTGCAGAGG - Intergenic
1117672842 14:58125498-58125520 ATGTATGGCCTGCAGTGCAGGGG - Intronic
1119241531 14:73064437-73064459 CAGGTTGGAGTGCAGTGGCGCGG + Intronic
1119486788 14:74994321-74994343 CCGGTTGGCCGGCACTGCTGGGG - Intergenic
1120142054 14:80940632-80940654 CAGGCTGGACTGCAGTGGCGCGG - Intronic
1120169690 14:81236265-81236287 CGGGCTGGCCGGCAGTGCTGGGG - Intergenic
1120289300 14:82546372-82546394 CAGGCTGGAGTGCAGTGCCGTGG - Intergenic
1121955200 14:98207105-98207127 CTGGTTGGCCTGCTGAGGCTAGG + Intergenic
1123464705 15:20506451-20506473 CTGCTTGGCCCGGAGCGCCGCGG + Intergenic
1123664657 15:22598889-22598911 CTGGCTGGAGTGCAGTGGCGTGG + Intergenic
1123734974 15:23176222-23176244 CCGGTTGGAGTGCAGTGGCGCGG - Intergenic
1124285481 15:28397514-28397536 CCGGTTGGAGTGCAGTGGCGCGG - Intergenic
1124297214 15:28514122-28514144 CCGGTTGGAGTGCAGTGGCGCGG + Intergenic
1124318492 15:28693339-28693361 CTGGCTGGAGTGCAGTGGCGTGG + Intergenic
1124327989 15:28783628-28783650 CCGGTTGGAGTGCAGTGGCGCGG + Intergenic
1124564949 15:30804107-30804129 CTGGCTGGAGTGCAGTGGCGTGG - Intergenic
1125523927 15:40363792-40363814 CTGGTATTCCTGCAGTGCCCGGG - Exonic
1125605493 15:40937759-40937781 GAGGCTGGCCAGCAGTGCCGTGG - Intronic
1125884691 15:43220075-43220097 CTGGTTGGTCTGGTGTGCGGAGG - Intronic
1125885534 15:43226738-43226760 CCGGTAGGCCGGCAGTGCTGAGG + Intergenic
1125899193 15:43329682-43329704 CTGGACCGCCTGCGGTGCCGTGG - Exonic
1125906000 15:43393252-43393274 CAGGTTGGAGTGCAGTGGCGCGG + Intronic
1126017638 15:44367748-44367770 CAGGCTGGCATGCAGTGGCGTGG - Intronic
1126018648 15:44377413-44377435 CAGGCTGGAGTGCAGTGCCGCGG + Intronic
1126639681 15:50812141-50812163 CTGGTGGGCCAGCACTGCTGGGG - Intergenic
1126797128 15:52268505-52268527 CAGGCTGGCCTGGAGTGCAGTGG - Intronic
1126949882 15:53869211-53869233 CTGGGTGACCTGCAGTTACGTGG + Intergenic
1127211584 15:56779790-56779812 CTGGTGGGCCAGCACTGCTGGGG - Intronic
1129743212 15:78000267-78000289 CAGGTTGGCCTGCGGTGCCAGGG + Intronic
1129842268 15:78751173-78751195 CAGGTCGGCCTGCGGTGCCAGGG - Intergenic
1130276704 15:82481838-82481860 CAGGCTGGAGTGCAGTGCCGTGG - Intergenic
1132511028 16:341436-341458 CCGGTGGGCCGGCACTGCCGGGG - Intronic
1132596994 16:756917-756939 CAGGTTGGCGTGCAGTGGCGTGG + Intronic
1132809041 16:1788892-1788914 CTGGTTGGCCTGCAGTGCCGTGG + Exonic
1133222735 16:4325881-4325903 CAGGCTGGACTGCAGTGGCGTGG - Intronic
1133280948 16:4665008-4665030 CTGGTAGGCCTGCGGCACCGAGG - Intronic
1133725231 16:8530982-8531004 CTGCTTGGACTGCAGTGAAGTGG - Intergenic
1135574148 16:23572328-23572350 CTTGTCGGCCTGCAGTTCCTGGG + Exonic
1136478615 16:30527519-30527541 CTGATTGGCCGGGAGTGCTGTGG + Intronic
1139385450 16:66566268-66566290 CTGGCTGGCCGGCAGCTCCGAGG + Intronic
1139414849 16:66800319-66800341 CAGGTTGGCGTGCAGTGGCGCGG - Intronic
1140891619 16:79289894-79289916 CTGGCTGGAGTGCAGTGGCGTGG + Intergenic
1141558469 16:84851599-84851621 CTGGTGTGCCTGCGGTGGCGTGG + Intronic
1142219964 16:88849327-88849349 CAGGTTGGAGTGCAGTGGCGTGG + Intronic
1142625747 17:1190810-1190832 CAGCTTCGCCTGCAGCGCCGTGG - Intronic
1144686528 17:17229617-17229639 CTGTTCGGCGTGCAGTGCCGTGG - Intronic
1146378588 17:32311953-32311975 CTGGTTGGCCATCAGTGGGGTGG - Intronic
1146964182 17:37010848-37010870 CTGGTGGGCCTGCAGCACAGAGG + Intronic
1147188254 17:38724578-38724600 CTTGTTGGCCAACAGTCCCGGGG - Intronic
1147374740 17:40016814-40016836 CTGGGTGGGCTGCAGGGCAGGGG - Exonic
1148357481 17:46985236-46985258 ATGGTTGGCCTGAACTGCCTGGG - Intronic
1148398155 17:47327208-47327230 CAGGTTGGAGTGCAGTGGCGTGG + Intronic
1150861330 17:68803802-68803824 TTGGTTGGCATGAAGTCCCGTGG + Intergenic
1151567456 17:74907229-74907251 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
1152305756 17:79519386-79519408 CTGGGTGGGCTGCAAAGCCGGGG - Intergenic
1153027334 18:683621-683643 CTGGATGTCCAGCAGTGCCCTGG + Intronic
1153401958 18:4691405-4691427 CTGTATGGCCTGCAGTGCAGGGG - Intergenic
1154149561 18:11895581-11895603 CAGGCTGGACTGCAGTGCCATGG + Intronic
1154212864 18:12395013-12395035 CAGGCTGGAGTGCAGTGCCGTGG + Intergenic
1154417276 18:14186390-14186412 CTGTTTGGTCTGCTGTGCAGAGG + Intergenic
1156253783 18:35376798-35376820 CTGGTTGTCGTGCGGTGTCGGGG - Intronic
1156312340 18:35936052-35936074 CTGGCAGGCCTGCCCTGCCGAGG + Intergenic
1156470830 18:37376389-37376411 CTGGCTGGGCTGCAGTGTCCCGG - Intronic
1156830487 18:41485405-41485427 CAGGCTGGAGTGCAGTGCCGCGG + Intergenic
1156969684 18:43139694-43139716 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
1157727560 18:49976672-49976694 CTGATTGTCCTGCAGGGCTGGGG - Intronic
1158786081 18:60713072-60713094 ATGTATGGCCTGCAGTGCAGGGG - Intergenic
1158825167 18:61210092-61210114 CTGGTTGGCCCCCAGTGCATTGG - Intergenic
1159543663 18:69813395-69813417 ATTGTTGTCCTGCAGTGCCCTGG + Intronic
1160226234 18:77013555-77013577 CTGTTTGTCATTCAGTGCCGTGG - Exonic
1160930432 19:1567561-1567583 CTGGTCGGCCAGCAGCGTCGGGG + Exonic
1161040298 19:2107213-2107235 CAGGCTGGACTGCAGTGGCGCGG - Intronic
1161314570 19:3611819-3611841 CTGTCTGGGCTGCAGGGCCGCGG - Exonic
1161466033 19:4431064-4431086 CAGGTTCGCCTGCAGAGACGTGG - Intronic
1163901029 19:20100375-20100397 ATGTATGGCCTGCAGTGCAGGGG - Intronic
1164299366 19:23947511-23947533 ATGTATGGCCTGCAGTGCAGGGG - Intergenic
1164706130 19:30321511-30321533 CAGGCTGGCGTGCAGTGGCGTGG - Intronic
1164722737 19:30444278-30444300 GTGGTTAGCCTGCAGGGCCAGGG - Exonic
1165041585 19:33071793-33071815 CTGGCTGGAGTGCAGTGCAGTGG + Intergenic
1166024734 19:40072008-40072030 ATGTATGGCCTGCAGTGCAGGGG - Intronic
1167386083 19:49164773-49164795 CAGGTTGGAGTGCAGTGGCGTGG + Intronic
1167430410 19:49451072-49451094 CAGGCTGGAGTGCAGTGCCGAGG + Intronic
1167661333 19:50797747-50797769 CTGCTTGGCCTGCAGTGCTTTGG + Exonic
1168511695 19:56978793-56978815 CTGGTTGGAATGCAGTGGTGCGG + Intergenic
925344335 2:3159930-3159952 CTGGCTGGCCACCAGTGCCCTGG - Intergenic
926864884 2:17345616-17345638 ATGTATGGCCTGCAGTGCAGGGG - Intergenic
928485244 2:31724253-31724275 CTGGTTGTCCTGCTTTGCCTAGG - Intergenic
928617935 2:33057615-33057637 CTGGTGGGCCAGCACTGCTGGGG + Intronic
928888414 2:36176710-36176732 CTGGATGGAGTGCAGTGGCGTGG - Intergenic
929519396 2:42633842-42633864 CAGGTTGGAGTGCAGTGGCGCGG - Intronic
930053921 2:47237578-47237600 CTGGTTGGGCTGTAGTGCAGAGG + Intergenic
931028563 2:58143501-58143523 ATGGTTAGGCTGCACTGCCGTGG - Intronic
931351492 2:61493460-61493482 CAGGTTGGAGTGCAGTGGCGTGG - Intronic
932239941 2:70148478-70148500 CTGGTGGGCCAGCACTGCTGGGG - Intergenic
932572490 2:72945409-72945431 GTGGTAGGTCTGCAGTGCAGTGG - Intronic
933822195 2:86123215-86123237 CAGGTTGGAATGCAGTGGCGTGG - Intronic
934884238 2:98010586-98010608 TTGCTTGGCCTGGAGTGCAGTGG + Intergenic
935123604 2:100202918-100202940 ATGGTTGGCCTGCAGTTCCTAGG - Intergenic
935749139 2:106215019-106215041 ATGTATGGCCTGCAGTGCAGGGG - Intergenic
936140877 2:109938967-109938989 TTGGTTGGCCTCCAGCGACGAGG - Intergenic
936177568 2:110236912-110236934 TTGGTTGGCCTCCAGCGACGAGG - Intergenic
936203816 2:110432519-110432541 TTGGTTGGCCTCCAGCGACGAGG + Intronic
936351253 2:111714287-111714309 CTGGCTGGAGTGCAGTGGCGCGG - Intergenic
936387037 2:112039971-112039993 ATGTATGGCCTGCAGTGCAGGGG + Intergenic
937789428 2:125943112-125943134 CAGGTGGGCCGGCAGTGCTGGGG + Intergenic
938473190 2:131585182-131585204 CTGGTTGTCTTGCAGTGCTTTGG + Intergenic
938726024 2:134109533-134109555 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
939493258 2:142901086-142901108 ATGTATGGCCTGCAGTGCAGGGG + Intronic
939869061 2:147507081-147507103 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
941105480 2:161347084-161347106 CTTTTTGGACTGCAGTGCAGAGG - Intronic
941309791 2:163913786-163913808 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
941370544 2:164658545-164658567 ATGTATGGCCTGCAGTGCAGGGG + Intronic
942732130 2:179072206-179072228 CTGGTTTGCTTGGAGTGGCGAGG - Intergenic
943344767 2:186725297-186725319 CAGGTTGGAGTGCAGTGGCGTGG - Intronic
944188490 2:196976174-196976196 CAGGTTGGAGTGCAGTGCAGTGG + Intronic
946872050 2:224092991-224093013 CTGGTTGGCCTGAGGGCCCGAGG + Intergenic
948820653 2:240542457-240542479 CAGGCTGGCGTGCAGTGGCGCGG - Intronic
1168740988 20:191316-191338 ATGTATGGCCTGCAGTGCAGGGG + Intergenic
1169046392 20:2537339-2537361 CTGGGGAGCCTGCAGTGCCTGGG + Intronic
1171361594 20:24590220-24590242 CAGAGAGGCCTGCAGTGCCGAGG + Intronic
1171455813 20:25271585-25271607 CTGGCCGGCCTGCAGTCCCCTGG - Intronic
1171891187 20:30717659-30717681 CTGTTTGGTCTGCTGTGCAGAGG - Intergenic
1173512875 20:43644057-43644079 CTGGATGGACTGCAGTGGTGTGG - Intronic
1176225170 20:63993792-63993814 CTGGCTGGAGTGCAGTGGCGTGG + Intronic
1176671047 21:9735711-9735733 CTGGTGGGCCAGCACTGCTGGGG - Intergenic
1176856049 21:13972867-13972889 CTGTTTGGTCTGCTGTGCAGAGG - Intergenic
1177263117 21:18753820-18753842 ATGTATGGCCTGCAGTGCAGGGG + Intergenic
1179354867 21:40649772-40649794 CTACCTGGCCTGCAGTGCCCTGG - Intronic
1180297995 22:10961775-10961797 CTCGTTGGCCTGCGGCGGCGCGG + Intergenic
1180741034 22:18053544-18053566 CTGGTGGGCCGGCACTGCTGAGG + Intergenic
1180757097 22:18169687-18169709 CCGGTTGGCCTGCAGAACCATGG + Intronic
1181081255 22:20417310-20417332 CAGGCTGGAGTGCAGTGCCGTGG + Intergenic
1181546822 22:23606967-23606989 CTGGTTGGCCTGCAGGGTGCAGG - Intergenic
1181967030 22:26664049-26664071 CTGTTTGGGCTGCAGTGCAGTGG + Intergenic
1183630903 22:39032026-39032048 CAGGTGGGTCTGCAATGCCGTGG + Intronic
1183976722 22:41516533-41516555 CTGGTTCCCCTGCAGTGATGGGG + Intronic
1184248564 22:43247884-43247906 CATGTGGGCCTGCAGGGCCGGGG + Intronic
1184551977 22:45209376-45209398 CTTGTCGGGCTGCAGTGCTGAGG - Intronic
1184895575 22:47404654-47404676 CTGTTTTGCGTGCAGTGCAGGGG + Intergenic
1185345702 22:50309633-50309655 CTGGGTGGCCAGCATTGCCCTGG - Exonic
950429280 3:12941571-12941593 CTGCTTGTCCTGCAGGTCCGAGG + Exonic
950635007 3:14308203-14308225 CTGGTGAGCCTCGAGTGCCGGGG + Intergenic
951024851 3:17817873-17817895 CTGGTGGGCCAGCACTGCTGGGG + Intronic
951323196 3:21271809-21271831 CGGGTGGGCCAGCAGTGCTGGGG + Intergenic
951878699 3:27458948-27458970 CAGGCTGGAGTGCAGTGCCGTGG - Intronic
951878905 3:27461352-27461374 CAGGTTGGAGTGCAGTGGCGTGG - Intronic
952918254 3:38266079-38266101 CTGGGTGACCTGCAGTGTCCAGG - Exonic
953033161 3:39190975-39190997 CTGGCTGGCCTGCAGCCCAGGGG - Intronic
953085261 3:39659431-39659453 ATGTATGGCCTGCAGTGCAGGGG - Intergenic
953164951 3:40456730-40456752 CAGGTTGGAGTGCAGTGGCGGGG - Intergenic
954868645 3:53750473-53750495 ATGGTTGGCTTGCCGTGCCTGGG - Intronic
954879463 3:53823715-53823737 CAGGTTGGCCACCAGGGCCGCGG + Exonic
955415375 3:58686633-58686655 CTTCCTGGCCTGCAGGGCCGTGG + Intergenic
956438829 3:69260447-69260469 CAGGTGGGCCAGCAGTGCTGGGG - Intronic
956955845 3:74338811-74338833 CAAGTTGGCATGCAGTGCCATGG - Intronic
957419662 3:79951558-79951580 CTGGTGGGCCAGCACTGCTGGGG + Intergenic
957995111 3:87679271-87679293 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
959703921 3:109322843-109322865 CTGGCTGGAATGCAGTGGCGAGG - Intergenic
960560035 3:119073590-119073612 CCGGTGGGCCGGCAGTGCTGGGG + Intronic
961608258 3:128114565-128114587 CTGTTTGGCCTGCAGTCTCATGG + Intronic
962177237 3:133167579-133167601 CGGGTGGGCCGGCAGTGCTGGGG + Intronic
962495869 3:135938261-135938283 ATGTATGGCCTGCAGTGCAGGGG - Intergenic
963169352 3:142235339-142235361 CAGGCTGGCATGCAGTGCAGTGG + Intergenic
963533273 3:146497471-146497493 CTGGTGGGCCAGCACTGCTGGGG - Intergenic
966108199 3:176362410-176362432 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
966186153 3:177228792-177228814 CGGGTGGGCCAGCAGTGCTGGGG + Intergenic
966353977 3:179059508-179059530 ATGTATGGCCTGCAGTGCAGGGG - Intronic
968352745 3:198074403-198074425 CTGCTTGGTCTGCTGTGCAGAGG - Intergenic
968546705 4:1202641-1202663 CTGGTGGCCCTGCAGTCCTGGGG + Intronic
968601558 4:1512270-1512292 CTGGCTGCCCTGCAGGGGCGTGG - Intergenic
968630139 4:1646143-1646165 CAGGTTGGAGTGCAGTGGCGCGG + Intronic
969804080 4:9592798-9592820 CAGGTTGGAGTGCAGTGCCATGG - Intergenic
969945069 4:10775179-10775201 CAGGTTGGAATGCAGTGCCCGGG - Intergenic
970948843 4:21728413-21728435 CAGCTTGGCCTGCAGTTCTGGGG - Intronic
971635116 4:29047693-29047715 CTGGTGGGCCAGCACTGCTGGGG - Intergenic
971799194 4:31266504-31266526 CTGGCTGGAGTGCAGTGCAGTGG - Intergenic
971852104 4:31996562-31996584 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
972505774 4:39718688-39718710 CTGGTGGGCCAGCACTGCTGGGG + Intronic
972913312 4:43846342-43846364 CAGGTGGGCCGGCAGTGCTGGGG - Intergenic
974445359 4:61974010-61974032 CAGGTTGGAGTGCAGTGGCGTGG + Intronic
974555474 4:63441514-63441536 CTGGCTGGAGTGCAGTGTCGTGG + Intergenic
975720944 4:77248089-77248111 CTGCTGGGCCTGCAGTACCATGG + Intronic
975754823 4:77562041-77562063 CTGGTGGGCCAGCACTGCTGGGG - Intronic
977470694 4:97438272-97438294 CTGGTGGGCCAGCACTGCTGGGG + Intronic
977606926 4:98993673-98993695 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
978207190 4:106092588-106092610 CTGGTGGGCCAGCACTGCTGGGG + Intronic
978285534 4:107073268-107073290 CTGGTGGGCCAGCACTGCTGGGG - Intronic
978466264 4:109012650-109012672 CGGGCGGGCCAGCAGTGCCGGGG - Intronic
978581855 4:110239784-110239806 CAGGTTGGAGTGCAGTGGCGGGG + Intergenic
978748574 4:112222606-112222628 CTGGTGGGCCAGCAGTGCTGGGG - Intergenic
978809098 4:112830980-112831002 CAGGTGGGCCAGCAGTGCTGGGG - Intronic
978909970 4:114051171-114051193 ATGTATGGCCTGCAGTGCAGGGG - Intergenic
978998037 4:115179605-115179627 CCGGTGGGCCGGCAGTGCTGGGG + Intergenic
979224199 4:118265731-118265753 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
979920469 4:126490183-126490205 CAGGCGGGCCAGCAGTGCCGGGG - Intergenic
980815561 4:137942244-137942266 CTGGTGGGCCGGCAGTGCTGGGG - Intergenic
982252743 4:153423757-153423779 CTGGCTGGAGTGCAGTGGCGTGG - Intergenic
982770157 4:159390133-159390155 CGGGTGGGCCGGCAGTGCTGGGG - Intergenic
983162864 4:164438532-164438554 CAGGCTGGAGTGCAGTGCCGTGG - Intergenic
985446110 4:190022000-190022022 CTGGCTGGGCTGCAGCGCGGGGG + Intergenic
985451272 4:190065283-190065305 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
985452263 4:190068578-190068600 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
985453247 4:190071875-190071897 CTGGCTGGGCTGCAGCGCGGGGG - Exonic
985454237 4:190075168-190075190 CTGGCTGGGCTGCAGCGCGGGGG - Exonic
985455225 4:190078461-190078483 CTGGCTGGGCTGCAGCGCGGGGG - Exonic
985456213 4:190081761-190081783 CTGGCTGGGCTGCAGCGCGGGGG - Exonic
985457197 4:190085055-190085077 CTGGCTGGGCTGCAGCGCGGGGG - Intergenic
985458184 4:190088348-190088370 CTGGCTGGGCTGCAGCGCGGGGG - Exonic
985459173 4:190091648-190091670 CTGGCTGGGCTGCAGCGCGGGGG - Exonic
985463426 4:190174417-190174439 CTGGCTGGGCTGCAGCGCGGGGG - Exonic
985986697 5:3522104-3522126 CTGGTTGGCCTGCCCAGCCCTGG - Intergenic
986008036 5:3684351-3684373 CTGACTGGCCTGCTGTGCCGGGG + Intergenic
987249557 5:16084596-16084618 CTGGCTGGATTGCAGTGGCGTGG - Intronic
987283739 5:16436356-16436378 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
987788644 5:22535197-22535219 CAGGCTGGACTGCAGTGGCGCGG + Intronic
988143049 5:27267385-27267407 CGGGTGGGCCGGCAGTGCAGGGG + Intergenic
988915887 5:35893054-35893076 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
988956893 5:36329318-36329340 ATGTATGGCCTGCAGTGCAGGGG + Intergenic
988982393 5:36584558-36584580 CTAGGTGGCCTGCACTGCCTGGG + Intergenic
989659711 5:43786953-43786975 CTGGTTGGCCTGAGGACCCGAGG - Intergenic
992941827 5:81770063-81770085 CAGGTTGGAGTGCAGTGCAGTGG - Intergenic
993320925 5:86466868-86466890 CTGGTGGGCCAGCACTGCTGGGG + Intergenic
994251509 5:97542067-97542089 CCGGTGGGCCGGCACTGCCGGGG + Intergenic
996147666 5:119995726-119995748 CAGGTTGGAGTGCAGTGGCGTGG + Intergenic
996298547 5:121954125-121954147 CGGGTGGGCCGGCAGTGCTGGGG + Intergenic
996494082 5:124133083-124133105 CTGATTAGCCTGCAGTGGCAGGG + Intergenic
996530402 5:124521796-124521818 CTGGTGGGCCAGCACTGCCGGGG - Intergenic
998117547 5:139549517-139549539 CAGGTGGGCCTGCAGTGCTGGGG - Intronic
1000084752 5:157879455-157879477 CAGGTGGGCCGGCAGTGCTGGGG - Intergenic
1000085875 5:157887022-157887044 CAGGTGGGCCGGCAGTGCTGGGG - Intergenic
1001841554 5:174880842-174880864 CTGGTGGGCCAGCACTGCTGGGG - Intergenic
1001843570 5:174901692-174901714 CTGGTGGGCCAGCACTGCTGGGG - Intergenic
1002793214 6:450155-450177 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
1003069679 6:2935982-2936004 CCGGTGGGCCAGCAGTGCTGGGG - Intergenic
1003445199 6:6177797-6177819 GAGGTTGGCCTGCAGTGCATGGG + Intronic
1003581990 6:7348097-7348119 CTGGTTGGCCTCCTGTGAGGAGG - Intronic
1004483220 6:16040521-16040543 CAGGTGGGCCGGCAGTGCTGGGG + Intergenic
1005265813 6:24111206-24111228 CTGGTTAGTCTGCACTGCAGAGG - Intergenic
1005332871 6:24766122-24766144 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
1005648656 6:27866251-27866273 CAGGCTGGCGTGCAGTGGCGTGG - Intergenic
1005909619 6:30297086-30297108 CAGGCTGGACTGCAGTGGCGTGG + Intergenic
1006349902 6:33513314-33513336 CTGGGTTGCCTGCAGTGCTGAGG - Intergenic
1006364338 6:33606538-33606560 CAGGTTGGCCTGGAGAGCCTAGG + Intergenic
1007914084 6:45544728-45544750 CTGGATGCCCTGCAATGCAGAGG + Intronic
1008534082 6:52493605-52493627 CTGGATGGAGTGCAGTGGCGTGG - Exonic
1008581914 6:52915304-52915326 ATGTATGGCCTGCAGTGCAGGGG + Intergenic
1008844843 6:55950484-55950506 CGGGTGGGCCAGCAGTGCTGGGG - Intergenic
1009511974 6:64564319-64564341 CAGGTTGGAGTGCAGTGGCGTGG + Intronic
1009644375 6:66378345-66378367 TTGGTTGGCCTCCAGTGCGGAGG - Intergenic
1011209936 6:84944664-84944686 ATGTATGGCCTGCAGTGCAGGGG - Intergenic
1014654809 6:124088367-124088389 TTGGTTGGGCTGGAGTGCAGTGG - Intronic
1015865080 6:137719552-137719574 ATGTATGGCCTGCAGTGCAGGGG + Intergenic
1017132269 6:151117827-151117849 CAGGTTGGAGTGCAGTGGCGTGG - Intergenic
1017459129 6:154632741-154632763 CAGGTTGGAGTGCAGTGCAGTGG + Intergenic
1017839498 6:158209974-158209996 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
1018727921 6:166627593-166627615 CTGATTGGCGGGCAGTGCTGTGG - Intronic
1018761465 6:166897609-166897631 ATGAATGGCCTGCAGTGCAGGGG - Intronic
1019000255 6:168743971-168743993 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
1019679224 7:2335756-2335778 CAGGCTGGAGTGCAGTGCCGCGG - Intronic
1021065754 7:16170767-16170789 CAGGTGGGCCAGCAGTGCTGGGG + Intronic
1021109512 7:16677692-16677714 ATGTATGGCCTGCAGTGCAGGGG + Intronic
1024465912 7:49711427-49711449 CTGGTCGGCCAGCACTGCTGGGG - Intergenic
1025298799 7:57799362-57799384 CAGGTTGGAGTGCAGTGCAGTGG - Intergenic
1026516573 7:71078163-71078185 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
1026942967 7:74298570-74298592 CAGGTTGGAGTGCAGTGGCGTGG + Intronic
1027139575 7:75647717-75647739 CTGGTTGGTCTGCAGGGACCTGG + Intronic
1027210903 7:76148199-76148221 CAGGTTGGAGTGCAGTGGCGTGG + Intergenic
1028852508 7:95552649-95552671 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
1029445436 7:100609790-100609812 CTGGCTGGACTGCAGTGCAGTGG + Intergenic
1029863774 7:103603453-103603475 CTGGGTGGCATTCAGTGCCTTGG + Exonic
1030494969 7:110287644-110287666 CAGGCTGGAGTGCAGTGCCGTGG + Intergenic
1031253130 7:119413539-119413561 CTGGTGGGCCAGCACTGCTGGGG + Intergenic
1031264973 7:119570194-119570216 ATGTGTGGCCTGCAGTGCAGGGG - Intergenic
1032089377 7:128903732-128903754 CAGGTTGGGCAGCAGTGCCCAGG + Exonic
1033077637 7:138264506-138264528 CTGGATGGAGTGCAGTGGCGCGG + Intergenic
1033517380 7:142121219-142121241 CTGGCTGGAGTGCAGTGGCGCGG + Intronic
1034167749 7:149038884-149038906 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
1034587754 7:152110773-152110795 CAGGTTGGAGTGCAGTGGCGTGG + Intronic
1034783890 7:153907500-153907522 TTGGCTGGGCTGCAGTGCCCAGG + Intronic
1035214490 7:157355196-157355218 CAGGTTGGAGTGCAGTGGCGCGG + Intronic
1035281828 7:157783448-157783470 CTCTTGGGCCAGCAGTGCCGAGG - Intronic
1037425600 8:18751229-18751251 CTGGTGGGCCGGCACTGCTGGGG + Intronic
1037703643 8:21297049-21297071 CAGGCTGGAGTGCAGTGCCGTGG + Intergenic
1038154145 8:24971599-24971621 CTGGTTGCCTTGCCGTGCCTAGG - Intergenic
1038420314 8:27430294-27430316 CTGATTGGCCCGCAGTCCTGTGG + Intronic
1041867706 8:62595975-62595997 ATGTATGGCCTGCAGTGCAGGGG + Intronic
1042121453 8:65493063-65493085 CAGGCTGGACTGCAGTGGCGAGG + Intergenic
1042910597 8:73821959-73821981 ATGTATGGCCTGCAGTGCAGGGG - Intronic
1044441655 8:92230949-92230971 CTGGTGGGCCAGCACTGCTGGGG - Intergenic
1045407380 8:101880185-101880207 CTGGTGGGCCGGCACTGCTGTGG + Intronic
1045734030 8:105274548-105274570 CTAGTTGGCTTGTAGTGCTGGGG - Intronic
1046251888 8:111643000-111643022 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
1046260313 8:111758942-111758964 CAGGTAGGCCAGCAGTGCTGGGG + Intergenic
1048590258 8:135814731-135814753 CTGCATGTCCTGCAGTGCCCAGG + Intergenic
1049818705 8:144621176-144621198 CTGGTTGGCCTGCAGAGTCCAGG - Intergenic
1050294920 9:4195471-4195493 CTGGCGGGCCGGCAGTGCTGGGG - Intronic
1050734502 9:8747879-8747901 ATGTATGGCCTGCAGTGCAGGGG - Intronic
1051305663 9:15706327-15706349 TTGGTTGGGCTGGAGTGCAGTGG + Intronic
1051331071 9:16025412-16025434 CAGGCTAGGCTGCAGTGCCGTGG - Intronic
1052058668 9:23932798-23932820 CAGGTTGGAGTGCAGTGCAGTGG + Intergenic
1052868432 9:33480908-33480930 CTGGCTGGAGTGCAGTGGCGCGG - Intergenic
1052985341 9:34482951-34482973 CTGGTGGGCCAGCACTGCTGGGG + Intronic
1053547908 9:39042544-39042566 CTGGTGGGCCGGCACTGCTGGGG + Intergenic
1057682496 9:97202491-97202513 CTGCTTGGTCTGCTGTGCAGAGG - Intergenic
1059112493 9:111570352-111570374 TTGATTGGCCAGCAGTCCCGTGG - Intronic
1059466390 9:114471420-114471442 TTGGCTTGCCTGCAGTGCCTGGG + Intronic
1059468933 9:114488866-114488888 CTGGTTGCTCTGCAGTGACTGGG - Intronic
1060118720 9:120967764-120967786 CAGGTTGGAGTGCAGTGGCGTGG + Intronic
1061507162 9:131037939-131037961 GTGGGGGGCCTGCAGTGCAGGGG - Intronic
1061980047 9:134097277-134097299 CAGGTTGGAGTGCAGTGCAGTGG + Intergenic
1062475638 9:136725623-136725645 CTGCATGTCCTGCAGTGCCTGGG - Intergenic
1185583853 X:1230683-1230705 CAGGCTGGAGTGCAGTGCCGCGG - Intergenic
1187139055 X:16575626-16575648 CTGGTGGGCCGGCACTGCTGGGG - Intergenic
1190045865 X:47111191-47111213 CTGGTTGGCTGGCACTGCTGGGG + Intergenic
1191166631 X:57399210-57399232 TTGTATGGCCTGCAGTGCAGGGG + Intronic
1193307104 X:79962449-79962471 ATGTATGGCCTGCAGTGCAGGGG - Intergenic
1194071594 X:89331217-89331239 CTGGTGGGCCAGCACTGCTGGGG + Intergenic
1194204472 X:90995579-90995601 CGGGTGGGCCAGCAGTGCTGGGG - Intergenic
1194815839 X:98440159-98440181 TTGGTTGGCCTCCAGTGAGGAGG - Intergenic
1197807337 X:130410429-130410451 CTGGTTGGAGTGCAGTGGCGTGG + Intronic
1199612997 X:149633523-149633545 CTTGTGGGCCTGCAGAGCAGTGG - Intergenic
1200550312 Y:4571020-4571042 CGGGTGGGCCAGCAGTGCTGGGG - Intergenic
1200725832 Y:6666946-6666968 CTGGTGGGCCAGCACTGCTGGGG + Intergenic
1201244163 Y:11986744-11986766 CTGCGTGGCCCGCAATGCCGCGG + Intergenic
1201424253 Y:13831521-13831543 CAGGTGGGCCGGCAGTGCTGCGG - Intergenic
1202202421 Y:22367345-22367367 CTGGTTGGCTGGCACTGCTGGGG + Intronic