ID: 1132811722

View in Genome Browser
Species Human (GRCh38)
Location 16:1802523-1802545
Sequence AGCTGCTTCTGAAAGTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132811719_1132811722 4 Left 1132811719 16:1802496-1802518 CCCAAGATGACAGAGATGTTCTC 0: 1
1: 0
2: 3
3: 38
4: 353
Right 1132811722 16:1802523-1802545 AGCTGCTTCTGAAAGTCTGATGG 0: 1
1: 0
2: 1
3: 18
4: 297
1132811717_1132811722 26 Left 1132811717 16:1802474-1802496 CCTATAACAACTCTTTGCCTAAC 0: 1
1: 0
2: 1
3: 6
4: 168
Right 1132811722 16:1802523-1802545 AGCTGCTTCTGAAAGTCTGATGG 0: 1
1: 0
2: 1
3: 18
4: 297
1132811718_1132811722 9 Left 1132811718 16:1802491-1802513 CCTAACCCAAGATGACAGAGATG 0: 1
1: 2
2: 18
3: 74
4: 559
Right 1132811722 16:1802523-1802545 AGCTGCTTCTGAAAGTCTGATGG 0: 1
1: 0
2: 1
3: 18
4: 297
1132811720_1132811722 3 Left 1132811720 16:1802497-1802519 CCAAGATGACAGAGATGTTCTCC 0: 1
1: 0
2: 3
3: 38
4: 433
Right 1132811722 16:1802523-1802545 AGCTGCTTCTGAAAGTCTGATGG 0: 1
1: 0
2: 1
3: 18
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132811722 Original CRISPR AGCTGCTTCTGAAAGTCTGA TGG Intronic
900524296 1:3120928-3120950 AGCTGTGTCTGAATGTCTGAGGG + Intronic
902713007 1:18253431-18253453 TGCAGCTTCTGCAAGGCTGATGG - Intronic
902781399 1:18707284-18707306 AGCAGGATCTGAAAGTCAGAAGG - Intronic
903046929 1:20571530-20571552 GGCTGCTGCTGAAAGTCAGCTGG - Intergenic
904573117 1:31482810-31482832 ATTTGCTTCTGACAGTGTGAAGG - Intergenic
907621428 1:55984894-55984916 AGGTGCTACTAAAAGTCAGAAGG - Intergenic
908070441 1:60454531-60454553 AGCTCCTTATGCAAGTCTCAGGG - Intergenic
909026347 1:70486609-70486631 AGATGCTTGTGAAACCCTGATGG + Intergenic
909696006 1:78468748-78468770 TGCTTCTGCTGAAAGGCTGAAGG - Intronic
909804651 1:79859049-79859071 AGGAGCATCTGAAAGTCTGGAGG - Intergenic
909861801 1:80615569-80615591 AGTTTCTACTGATAGTCTGATGG + Intergenic
910501723 1:87900129-87900151 GGCTGTTTCAGAAGGTCTGAAGG + Intergenic
913482251 1:119300053-119300075 AGCTGCCTCTGAAAGGCTCTTGG + Intergenic
916197950 1:162242551-162242573 GGCTGCATCTGAAATTTTGATGG - Intronic
916832762 1:168510063-168510085 AGCTGCTCCTGAACGTCAGAGGG + Intergenic
917708060 1:177654712-177654734 AACTGCTTCTGACACTATGATGG - Intergenic
917732133 1:177885112-177885134 AGTTGCTTCTGAAAGGGAGAAGG - Intergenic
918038422 1:180897307-180897329 AGCTGCATCTGAAAGGTTCATGG - Intergenic
918244981 1:182651227-182651249 AGATGCTTCTGAACTTATGATGG + Intronic
918967962 1:191376046-191376068 ACCTGCTTCTGAATGACTGCTGG - Intergenic
921247105 1:213256127-213256149 AACTGCTTTTGAAACTATGAAGG - Intronic
921368094 1:214393923-214393945 AGCTGCTGCTGAAATTCAGCAGG - Intronic
922755266 1:228093097-228093119 AGCCCCTTCTCAAAGTGTGAGGG + Intronic
922927452 1:229361950-229361972 AGCAGCTTCTGAATTTCAGATGG - Intergenic
923045089 1:230349925-230349947 GGCTCCTTCTGCAGGTCTGAGGG - Intronic
924746164 1:246835271-246835293 AGCTGCTTCTAAAATTCATATGG + Intergenic
1062886319 10:1019218-1019240 AGCTGATCCTGAAAGTCTTGGGG - Exonic
1063714697 10:8515058-8515080 AGCGGCTGCTGAAAGTCTGGGGG + Intergenic
1064333612 10:14417527-14417549 ACCACCTTTTGAAAGTCTGAAGG - Intronic
1066175224 10:32896455-32896477 TGTTTCTTCTAAAAGTCTGATGG + Intergenic
1066255413 10:33673788-33673810 AGCTGCTTCTGAAATGCTTAAGG + Intergenic
1066402878 10:35092063-35092085 AGCTGCTTCGGAAACTGAGATGG - Intergenic
1068161871 10:53274790-53274812 ACCTGCTTCTGAATGACTGTTGG + Intergenic
1069067950 10:63964268-63964290 AGCTCCTTCTGGAATGCTGATGG + Intergenic
1069718440 10:70535206-70535228 GGCTGCTTCTGAAAGACTTATGG + Intronic
1069806324 10:71127239-71127261 AGCTGCTCCAGGAAGGCTGAAGG + Intergenic
1070575943 10:77679019-77679041 AGATGCTTCTGACATTCTGAAGG - Intergenic
1071698787 10:87906230-87906252 AGCTGCTTTTGAAATTTCGAAGG + Intronic
1072370668 10:94763890-94763912 AGATGCATCTGAACATCTGAAGG - Intronic
1072877541 10:99189232-99189254 GGCTGCTTCTGCATGTCTCATGG + Intronic
1073242699 10:102068527-102068549 AGCTGCTTCAGAAATCCTGGTGG - Intergenic
1073661193 10:105478263-105478285 AGCTGCTTCTGAATGACTACTGG - Intergenic
1075078164 10:119365431-119365453 AGCTGCTTCTGTCAGCCTGAAGG - Intronic
1075733293 10:124648977-124648999 AGCTGCTTCTGCAAGTCAGTAGG - Intronic
1076381640 10:130027880-130027902 AGCTGCAAGTGAAAGTCTCACGG - Intergenic
1076731597 10:132441804-132441826 AGCTGCCCCTGAATGTGTGAGGG - Intergenic
1077182451 11:1222846-1222868 AGCAGCTTCTGAGAATCGGAAGG - Intergenic
1077579706 11:3408866-3408888 AGCTTCTTCTCAGAGTCTCAGGG + Intergenic
1080694674 11:34592339-34592361 AGCTGCTTCTCAAATTATGATGG - Intergenic
1081210173 11:40323454-40323476 AGCTGTTTATGAAACTATGAAGG - Intronic
1081616829 11:44596219-44596241 AGCTGCTTCCCAAAGTCCTAGGG - Intronic
1083447016 11:62714923-62714945 AGCTGCCTCAGAATGTCAGAAGG + Exonic
1084350447 11:68594725-68594747 AGCTGCTTCTTAAATTCATATGG + Intronic
1086090213 11:82997810-82997832 TCCTGCTTCTGGAAGTCTTAGGG + Intronic
1088726344 11:112639292-112639314 AGCTGGTTCTAAAAATCTTAAGG - Intergenic
1090241828 11:125188996-125189018 AGTTGCTGCTGATGGTCTGATGG + Intronic
1090312171 11:125750668-125750690 AGCTGGTTCTGAAAGTGTTGTGG + Intergenic
1090508587 11:127346681-127346703 AGCTGCTTCAGTAATCCTGATGG + Intergenic
1091213249 11:133882526-133882548 ACCTGCTTCTGAATGTCTACTGG - Intergenic
1093299011 12:17429611-17429633 AGCTGGTGATTAAAGTCTGATGG - Intergenic
1094593423 12:31842395-31842417 AGCTGATTCTGAAAGTATTGTGG - Intergenic
1095403360 12:41840229-41840251 AGTTGTTTGTGACAGTCTGATGG + Intergenic
1097393890 12:59050153-59050175 AGCTACTACTGGAACTCTGAGGG + Intergenic
1097498737 12:60376175-60376197 AGCTGCTCCTGAATGACTCATGG + Intergenic
1101217814 12:102602615-102602637 AGCTGCTTCTGAGAATATAATGG - Intergenic
1101384377 12:104243328-104243350 ATGTGTTTCTGAAAGTCTGTAGG - Intronic
1101924181 12:108957464-108957486 AGCTGTTGCTTAAAGTCTAATGG - Intronic
1102912472 12:116728061-116728083 TGCAGCTCCTGAAAGTCTCAGGG - Intronic
1103238393 12:119393880-119393902 AGGTGCTGGTTAAAGTCTGATGG - Intronic
1103335359 12:120185345-120185367 GAGTGTTTCTGAAAGTCTGAAGG + Intronic
1103541507 12:121669487-121669509 GGCTGCTTCTGCAAGGCTGGAGG + Exonic
1104421309 12:128637904-128637926 TGCTGATTCTGAAAGTCCCAGGG - Intronic
1104934805 12:132358714-132358736 AGCCGCCTCTGAGAGTCTCATGG + Intergenic
1105601480 13:21892228-21892250 AGCTGCTTCCAGAAGCCTGAAGG - Intergenic
1106387814 13:29305019-29305041 ACCTGCTTCTGAAAGACTCTTGG + Intronic
1106434771 13:29713646-29713668 ACTTGCTCCTGAAAGTCTGTGGG + Intergenic
1106948240 13:34853043-34853065 TGCTGCTTCTTTAAGGCTGAAGG + Intergenic
1107535157 13:41322232-41322254 AGCTGGTGGTGAAAGTGTGAAGG + Intronic
1110554236 13:76840367-76840389 TGCTGATACTGAAAGTCTGGTGG - Intergenic
1111267155 13:85831483-85831505 TGCTGTTTCAGAAAGCCTGAAGG + Intergenic
1112443528 13:99443452-99443474 AGCGTTTTCTGAGAGTCTGATGG + Intergenic
1112734733 13:102402851-102402873 TGCTGCTTTTGAAAATGTGAAGG - Intergenic
1112778890 13:102876234-102876256 AGCTACGTCTGAATGTCAGAGGG - Intergenic
1115184200 14:30666287-30666309 ACCTGCTTCTGAATGACTAATGG + Intronic
1116802884 14:49461809-49461831 ATGTGCTTCTGGAAGGCTGAAGG - Intergenic
1119138795 14:72245746-72245768 AACTGCTTCTTCAAGTCTGTTGG - Intronic
1119295105 14:73526575-73526597 AGCTGCTACTCAAAGTCTTCTGG - Intronic
1120380299 14:83769210-83769232 AGATACTTTTGAAAGTTTGAAGG - Intergenic
1120528195 14:85601935-85601957 AGTTGCTTCTGGAAGTCAGGTGG + Intronic
1120650164 14:87122919-87122941 AGTAGCTTCTGAAGATCTGATGG + Intergenic
1121168151 14:91828508-91828530 AGATTTTTCTGAAAGTGTGATGG - Intronic
1121786921 14:96668898-96668920 AGCAAGTTCTGAAGGTCTGAAGG + Intergenic
1123009406 14:105340502-105340524 CGCTGCTTATGAGAATCTGATGG - Intronic
1123046117 14:105516634-105516656 AGCTGATTCTGAAATTCATAGGG + Intergenic
1123958009 15:25360481-25360503 AACTGCTTCTTCAAGTCTGCAGG + Exonic
1124630402 15:31333455-31333477 TGCTGCTTCTTAAAGGTTGAGGG + Intronic
1125779236 15:42249541-42249563 AACTGCTTCTGAATGACTGCTGG - Intronic
1126968555 15:54083764-54083786 CTGTGCTTGTGAAAGTCTGAGGG + Intronic
1127411398 15:58710833-58710855 CTCTGCTTCTCAAAGTCTGCTGG + Intronic
1127631193 15:60828998-60829020 AACTTCTTCTGAAAGTTTTAGGG - Intronic
1127812496 15:62576801-62576823 AGCTGATTCTGGAAATCCGAGGG + Intronic
1128865431 15:71111482-71111504 AGCTGTTTCTAAAAATCTCAGGG - Intronic
1129322919 15:74784537-74784559 AGCTGCTTCTGAGAGGGTGGAGG - Intronic
1129352431 15:74964147-74964169 AGCTGCTTCTGGGTGTCAGATGG - Intronic
1129854189 15:78812051-78812073 AGCCCCTGCTGAAAGTCTGTGGG - Intronic
1132285676 15:100660405-100660427 CGCTGCATCTGAAATTCTGGGGG - Intergenic
1132811722 16:1802523-1802545 AGCTGCTTCTGAAAGTCTGATGG + Intronic
1133167774 16:3960728-3960750 TGCTGGCCCTGAAAGTCTGAAGG - Intronic
1134318077 16:13138189-13138211 AGCAGCATCTGAGAGCCTGATGG + Intronic
1135155621 16:20050493-20050515 AGCTTCTTGTGAAAATCAGAAGG + Intronic
1135996069 16:27249759-27249781 AGCTGATTCTGAAATTCACATGG - Intronic
1137784219 16:51124573-51124595 TTCTGCTTCTGGAAGTCTGGAGG - Intergenic
1138029033 16:53544956-53544978 AGCTGAATATGAAAATCTGAAGG - Intergenic
1139349401 16:66325797-66325819 AACGTCTTCTGAGAGTCTGATGG - Intergenic
1140755898 16:78066405-78066427 GGTTCCTTCTGAAATTCTGAGGG + Intronic
1142975373 17:3640551-3640573 AGCTGATTCTCAAAGTCAAACGG + Intronic
1143243319 17:5462310-5462332 AACTTCCTCTGAAAGTATGAGGG - Exonic
1143728347 17:8865560-8865582 AGCTGCCCCTGAAACCCTGAGGG - Intronic
1144290332 17:13820222-13820244 AGCTGCTTCTGGAAGTTGAAAGG + Intergenic
1144521833 17:15957846-15957868 AGCTGCTTTGGGAAGTCTGCAGG - Intronic
1146670086 17:34731353-34731375 AGCTGCTCCAGTAATTCTGAAGG + Intergenic
1146682006 17:34815241-34815263 ATCTGCTTCTGATATACTGATGG - Intergenic
1150314911 17:64160726-64160748 ATCTGCTTCTCAAAGGCTGGAGG + Intronic
1150729553 17:67680230-67680252 AGGTTCCTCTGAAAATCTGATGG - Intronic
1152500682 17:80706735-80706757 AGCTGCTACTGAAGGTCACAGGG - Intronic
1153746408 18:8184348-8184370 TGCTGTTTTTGAAAGTCAGAGGG + Intronic
1154234915 18:12595826-12595848 AGCAGCTTCTGAAATGCTGGAGG - Intronic
1156626612 18:38917549-38917571 ACCTGCTTCTGAATGACTAATGG - Intergenic
1157661493 18:49448795-49448817 AGCTGCTTTTTAAAGTTTCAGGG - Intronic
1157753697 18:50199592-50199614 GGCTGCTTCTGAAATTATCAGGG + Intergenic
1157779210 18:50422366-50422388 AGCTGCTTCTGATAAAATGAAGG - Intergenic
1158740595 18:60137526-60137548 AGTAGGTTCTGAAAGTCAGATGG + Intergenic
1159773181 18:72573186-72573208 AGCTGCTCTTGAAATTCTGTAGG - Intronic
1160120258 18:76123750-76123772 TGTTGCTTCTGAAAGTCCAAGGG + Intergenic
1160485933 18:79292565-79292587 AGCTGATTCTGAAATTCACATGG + Intronic
1160712925 19:561249-561271 AGCTGCTTCTGTGAGTCTTTGGG + Intergenic
1162051420 19:8036228-8036250 AGCTGCTACTGAAAGGGTTAAGG - Intronic
1162311389 19:9909511-9909533 AGCTGCTTCTGCAATTCAGGAGG + Intronic
1164661684 19:29977649-29977671 AGTTGTTTATGAAAGTCTTAGGG + Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1164813168 19:31174320-31174342 AGCTCCTTCTGATGGACTGATGG - Intergenic
1165340827 19:35211023-35211045 AGCTGCCTCTGCATGTCTTAAGG - Intergenic
1166329796 19:42071201-42071223 AGCTCCTTCTGAGAGGCTGCAGG - Intronic
1167756169 19:51415093-51415115 AGCAGCTTCGGGGAGTCTGAGGG + Exonic
925496728 2:4458910-4458932 AGTTGCTTCTCAAAGTTTCAGGG + Intergenic
926503442 2:13682203-13682225 AGTTGCTTATGAAAGGCTTAAGG - Intergenic
926972948 2:18485035-18485057 ATTTGCTTCTGTAACTCTGAAGG - Intergenic
928917146 2:36484373-36484395 AGCTGATTCTTAATGTCAGAGGG + Intronic
929465370 2:42139242-42139264 TTCTGCTTTTGAATGTCTGATGG - Intergenic
929825022 2:45303312-45303334 AACTGAATCAGAAAGTCTGAGGG - Intergenic
930940343 2:57005302-57005324 AGCTGCCTCTGAAAGTCCTGGGG - Intergenic
931250763 2:60528948-60528970 AGCTGGTTGGGAGAGTCTGAGGG - Intronic
931898763 2:66764308-66764330 AACTTGTTCTGAAAGCCTGATGG - Intergenic
932662425 2:73667757-73667779 ACCTGCTTCTGAAAGACTACTGG - Intergenic
934949654 2:98567558-98567580 AACTGCTCCTGCAAGTCTGTGGG - Intronic
935130882 2:100260027-100260049 AGATGCTTCTGAGTGTGTGAAGG + Intergenic
938310362 2:130285282-130285304 AGCTGGTGCTGATGGTCTGAGGG + Intergenic
938322960 2:130377505-130377527 GGCTGCTGCTGAGAGTCTAATGG + Intergenic
938444572 2:131367087-131367109 AGCTGGTGCTGATGGTCTGAGGG - Intergenic
938806504 2:134811102-134811124 AGATGCATCTGAACATCTGAAGG - Intergenic
939978881 2:148754772-148754794 TACTGCTTCTGAAAGCCAGATGG - Intronic
940437849 2:153675747-153675769 AGCTGCTTCTGGATGACTGTTGG + Intergenic
940920481 2:159300113-159300135 AGCTGTTTCTAAAATTCTCAAGG - Intergenic
942353277 2:175077675-175077697 ACCTAATTCTGAAAGTCTGTAGG - Intronic
945549682 2:211205348-211205370 AGTTCCTTCTGAAGGTGTGAGGG + Intergenic
945664885 2:212728485-212728507 AGCTGATTCTGAAAGTTATATGG + Intergenic
947296136 2:228632457-228632479 AGCTGCTTTAGAAAGTCTGGGGG - Intergenic
947500094 2:230665253-230665275 AGATGCTAGTGAAAGTCTGAAGG - Intergenic
948997266 2:241588422-241588444 AGCTGATTCTGAAATTCATAAGG + Intronic
1169789159 20:9391610-9391632 AACTGCTTCTGCAAGTTCGAGGG - Intronic
1170601976 20:17848325-17848347 AGCTGCTTCTGAGGTTTTGAAGG - Intergenic
1171254404 20:23677879-23677901 ATCTGCTTCTGAATGACTGTTGG - Intergenic
1171260908 20:23733138-23733160 ATCTGCTTCTGAACGACTGTTGG - Intergenic
1171423254 20:25032939-25032961 TCCTCCTTCTGAAAGCCTGAAGG - Intronic
1172090850 20:32431431-32431453 AGCTGCTGCTGGAAGTGTGATGG - Exonic
1172787989 20:37482050-37482072 AGCTGATTCTAAAAGTCATATGG + Intergenic
1174317172 20:49712768-49712790 AGCTGTGGCTGAAAGTCTGGGGG + Intronic
1174823903 20:53751476-53751498 TGCTATTTCTGAAAGTGTGAAGG + Intergenic
1175356235 20:58370708-58370730 ATCTGCTTCTTAAATTCTAATGG - Intergenic
1175600952 20:60272568-60272590 AGGTGCTTCTGAAATGCTGGAGG + Intergenic
1177160910 21:17546943-17546965 TGCTGCTTCTGAATGGCTGCGGG + Intronic
1181974249 22:26717598-26717620 AGCTGCTTCTAACAGCCTCAGGG + Intergenic
1182962705 22:34490507-34490529 CGCTCCTTCTGAATGTGTGAAGG - Intergenic
1183136763 22:35896440-35896462 AGCTGTTTCAGCATGTCTGAGGG - Intronic
1183540788 22:38428242-38428264 ACCTGCTTCTGAGAGTCTTGGGG - Intronic
1183885157 22:40873935-40873957 AGCTGATTTTGAAACTCTTAAGG - Intronic
1183978274 22:41525579-41525601 AGCTGCTGCTGGATGGCTGAGGG - Intronic
1184671903 22:46016986-46017008 AGCTGCTTCTGTAATTCATATGG - Intergenic
950563167 3:13747620-13747642 GGCTGGTTCTGAAAGACTCATGG + Intergenic
950714139 3:14835943-14835965 AGGGGCCTCTGAAAGACTGAGGG + Intronic
952729866 3:36627445-36627467 AGGTGCTTCTGTAAGACAGATGG + Intergenic
954334136 3:49906357-49906379 AGATCCCTCTGAAAGTCTGGAGG - Intronic
955078118 3:55632866-55632888 AGCTGTTTCTGAGAGGCTAAAGG + Intronic
956641699 3:71421867-71421889 AGCTGCCTCTGAACTGCTGATGG + Intronic
956758183 3:72410916-72410938 AGCTGGTTAAGAAAGGCTGATGG + Intronic
959167165 3:102794774-102794796 AGCTGCTTTTAAAAGTCTAAGGG + Intergenic
959945395 3:112120337-112120359 AGATGCTTCGGATAGTCTCAGGG - Intronic
960089951 3:113628791-113628813 AGCTGCTTCTGAGAACCTCAGGG - Exonic
960135674 3:114102523-114102545 AGCTTTTAATGAAAGTCTGAAGG - Intergenic
960989770 3:123302966-123302988 AGCTGCTCAGGACAGTCTGAAGG - Intronic
962846186 3:139275709-139275731 AGATGCTTTTGGAACTCTGAGGG + Intronic
962906360 3:139806700-139806722 AGCTGCTTCTAAAAGTTTGGTGG + Intergenic
963446918 3:145423952-145423974 AGAAGCATCTGAAAGTCAGAGGG + Intergenic
964831532 3:160888853-160888875 AGCTGCTTCTGAATGACTCCTGG + Intronic
965025753 3:163299451-163299473 AATTGCTTCTGAATGTCTGCTGG + Intergenic
966042553 3:175509312-175509334 AGCTACTCATGCAAGTCTGATGG - Intronic
966118514 3:176495004-176495026 AGCACTTTCTGATAGTCTGAAGG + Intergenic
970878529 4:20900651-20900673 AGCTGGCTCTGCAAGTTTGAAGG - Intronic
971265407 4:25092416-25092438 AACTGCTGCTGCAAGGCTGAAGG - Intergenic
971339970 4:25759260-25759282 AGCAGCTTCTGAAAGCCTCCTGG - Intronic
972851148 4:43052313-43052335 AGATGCTTCTCAACTTCTGATGG - Intergenic
973713634 4:53653643-53653665 AGCTGGCTCTGAAAGTCAAAAGG - Intronic
974438537 4:61887295-61887317 AGCTTCTTCTTAAAGTGTTAAGG + Intronic
975919582 4:79369015-79369037 AGCTTCTTCTTAAAGTCAAAAGG - Intergenic
976903309 4:90206457-90206479 ACCTGCTCCTGAAAGACTGCTGG - Intronic
976985098 4:91284587-91284609 AGCTCTTTCTCAAAGTCTGATGG - Intronic
977668979 4:99673667-99673689 ACCTGCTTCTGAAAGACTACTGG + Intergenic
980321300 4:131281035-131281057 AGATGCTCCTGAAATTATGATGG - Intergenic
981520957 4:145661822-145661844 ACCTAATTCTGAAAGTCTCAGGG + Intergenic
981657637 4:147130131-147130153 AGCTGCCTCTAAAATTCTAAAGG - Intergenic
982338312 4:154266176-154266198 GGCTACTACTGAATGTCTGATGG + Intronic
983280210 4:165671324-165671346 AGCAGCTTCTGAAAACCTCAAGG + Intergenic
985184776 4:187304230-187304252 AGCTTATTCTGACAGTCTGCAGG + Intergenic
985193721 4:187405678-187405700 AACTGCTCCTGAAAGACTGCTGG - Intergenic
985529995 5:428504-428526 TTCTACTTCTGAAAGGCTGAGGG - Intronic
986042773 5:4010182-4010204 AGCTGTTTCTCAAACTCTGGAGG + Intergenic
986664252 5:10086406-10086428 ATCATCTTCTGAAAGTCTCAAGG - Intergenic
988304476 5:29477349-29477371 AACAGAGTCTGAAAGTCTGAAGG - Intergenic
988420879 5:31004865-31004887 ATCTGCTCCTGAAAGACTGTTGG - Intergenic
988943522 5:36170413-36170435 AGCTGCTTAGCAAAGTCTGCAGG - Exonic
991500921 5:67276646-67276668 AGCTGATTCTAAAAGTTTTATGG - Intergenic
991975597 5:72181197-72181219 AGCTGTTACTGAAAGTAGGATGG + Intronic
993663783 5:90670306-90670328 AGGTGTTTCTGAAGGTCAGAGGG + Intronic
995022897 5:107385836-107385858 AGCTGCTTTAGAAAGTTTTAAGG - Intronic
995584729 5:113636458-113636480 AGCTGCTGGTGAAAGTCCCAGGG - Intergenic
998388987 5:141774741-141774763 AGCTGCTTCTCAGTGTCAGAAGG - Intergenic
998491170 5:142547859-142547881 AGCTGCTTTTTAAACTCAGATGG + Intergenic
999607116 5:153328073-153328095 AGCTGCTCCTGAATGACTAATGG + Intergenic
1002593479 5:180306833-180306855 AGCTGCTTCTGAGAGGTTGGCGG - Intronic
1003473662 6:6461543-6461565 AGCTCCATCCGCAAGTCTGACGG - Intergenic
1003490134 6:6613952-6613974 AGCTCATTCTCAAATTCTGATGG + Intronic
1003640104 6:7869113-7869135 AGCTGCTGCTGTGAGTATGACGG - Intronic
1006752714 6:36388438-36388460 ACCTTCTGCTGAAAATCTGAGGG + Intergenic
1006905725 6:37532141-37532163 AGCTGCTGCTGTACCTCTGAAGG + Intergenic
1008466118 6:51832685-51832707 AGCTGTATTTGAAACTCTGAGGG + Intronic
1008630948 6:53362573-53362595 AGATGCATCTGAACATCTGAAGG - Intergenic
1010117171 6:72327587-72327609 AGCTGCTTTAGAAAATATGATGG - Intronic
1010902437 6:81443218-81443240 AGCTGCCTATGATAGTCTTAGGG + Intergenic
1014615099 6:123588654-123588676 ATTTACTTCTGAGAGTCTGAAGG + Intronic
1015695685 6:135977214-135977236 AGGGGCTTCTGAGAGGCTGAGGG + Intronic
1017295641 6:152790416-152790438 AGCCACTTCTGAAAGTCAGGAGG - Intergenic
1018061261 6:160091680-160091702 ATCTGATTCTGAATGACTGAAGG - Intronic
1019612320 7:1942777-1942799 AGCTGATTCTGAAACTCACACGG + Intronic
1020205414 7:6111170-6111192 GGCTGATTCTGATAGGCTGATGG - Exonic
1022355070 7:29606940-29606962 AGCTAGGTCTGAAGGTCTGAAGG - Intergenic
1023761527 7:43468960-43468982 ACATGATTCTGAAAGTCCGACGG + Exonic
1024042230 7:45564669-45564691 AGCTGCGTCTGAAAGGCCGGAGG - Intergenic
1025174568 7:56791664-56791686 AGTTGCTTATGAAAGGCTTAAGG + Intergenic
1025697234 7:63784749-63784771 AGTTGCTTATGAAAGGCTTAAGG - Intergenic
1026206084 7:68258683-68258705 AGCTGGGTCAGGAAGTCTGATGG + Intergenic
1028247067 7:88492364-88492386 TGCTGCTGCTGAAAGTGTGTAGG + Intergenic
1028514394 7:91660377-91660399 AGCAGCTTCTGAATCTCTGGAGG + Intergenic
1029898456 7:104012047-104012069 AGCTACTTTTGACAGTCTAATGG + Intergenic
1030616417 7:111742607-111742629 GGCAGATTCTGAAAGTCTGTGGG - Intronic
1032681335 7:134186962-134186984 TGGTGCTTCTGAAACTCTGAGGG - Intronic
1034128772 7:148698024-148698046 AGGAGTTACTGAAAGTCTGAAGG + Intronic
1034256955 7:149729929-149729951 AGCAGCTTTGGAAAGTCTGCTGG - Intronic
1034587866 7:152111859-152111881 AGCTGTTTCTGAAAGTACAATGG - Intronic
1034644188 7:152630115-152630137 AGCTGCTCCTGAATGACTGCTGG - Intergenic
1034890666 7:154836177-154836199 AGATGCTTCTGAAAGCCGGGCGG - Intronic
1035141468 7:156766736-156766758 AGCTGCTGGTGACAGTCTGCAGG + Intronic
1035235051 7:157491622-157491644 AGCTGATTCTGAAGGTCATATGG - Intergenic
1035544964 8:473264-473286 AGTTCCTGCTGAAATTCTGAAGG - Intergenic
1035648458 8:1246764-1246786 AGATGCTTGTGTGAGTCTGATGG + Intergenic
1036648681 8:10628076-10628098 AGCTGCTTCTGGAGGTCTCCAGG + Intronic
1038442215 8:27579277-27579299 AGATGCTTCTGAAAGTCAACAGG - Intergenic
1039116550 8:34097503-34097525 AGCTGCTACTGGAAGTCAAAGGG - Intergenic
1039292034 8:36106659-36106681 AGCTGATTCTAAAATTCAGATGG + Intergenic
1040351069 8:46569034-46569056 AGCTGCTCCTGACAGTCAGGAGG + Intergenic
1041169480 8:55126655-55126677 AGCTAGAACTGAAAGTCTGATGG - Intronic
1041831324 8:62157619-62157641 TCCTTCTGCTGAAAGTCTGAGGG - Intergenic
1042841076 8:73124461-73124483 ATCTGCATCTGAAAGTGTGATGG - Intergenic
1043074188 8:75675151-75675173 GGTTGCATCTGAAAGTCTCATGG - Intergenic
1043295419 8:78656118-78656140 AGCTACTTCTGAAAATAGGATGG + Intergenic
1044818246 8:96134996-96135018 AGCTGCTCCTCAACTTCTGATGG + Intergenic
1044910221 8:97050024-97050046 AGCTTCTCCTGAAACTCTAAGGG + Intronic
1045070067 8:98493751-98493773 ATCTCTTTCTGAATGTCTGATGG + Intronic
1048930689 8:139313416-139313438 ACCTGCCTCTGAGAGTCGGAAGG - Intergenic
1051068984 9:13139388-13139410 AGCTGCCTATGAAAGACTGCTGG + Intronic
1051227716 9:14919694-14919716 AGCTGGATCTGAAAGGATGAGGG + Intergenic
1052176463 9:25469250-25469272 ACCTGCTTCTGAATGACTGTTGG - Intergenic
1052584913 9:30414588-30414610 TGATGCTTGTGAAAGTGTGATGG + Intergenic
1054716234 9:68560060-68560082 GGCTGGTTCTGAAAGTGTGAAGG + Intergenic
1055177753 9:73341251-73341273 TGCTGCTTTTGAAATTTTGAGGG + Intergenic
1055281107 9:74675734-74675756 AGCTCCTCCTGGAAGACTGACGG - Intronic
1056091065 9:83206814-83206836 AACAGCTTCTGGAAGCCTGAAGG - Intergenic
1056473047 9:86924580-86924602 ACCAGCTTCTGAAAGTTTGCTGG + Intergenic
1058489420 9:105480678-105480700 AGATGATTGTGAAAGTTTGAAGG + Intronic
1058639727 9:107071284-107071306 AAATGTTTCTGAATGTCTGATGG + Intergenic
1059342952 9:113609853-113609875 AGCTGCTTCTCTCAGTCTGGGGG - Intergenic
1059792568 9:117656287-117656309 TGCTGCTTCTTAAATTCTTATGG + Intergenic
1060868070 9:127015703-127015725 AGCTGTCTCTGAAAGTTTGCAGG - Intronic
1186112358 X:6272179-6272201 AGCTCTTTCTGAAAGTTTCATGG + Intergenic
1186370874 X:8946263-8946285 AGCTGGTTGTGAAAATATGATGG - Intergenic
1188012874 X:25075968-25075990 ACCAGCTTCTCAAAGTATGAAGG - Intergenic
1189404543 X:40708452-40708474 AGCTGCTTCTTTAAGTATAATGG + Intronic
1190070055 X:47272270-47272292 AGCTGCTTCTGAAAGGGTGATGG - Intergenic
1190086798 X:47402141-47402163 AGCTGCTTCTAAAATTCATATGG - Intronic
1191256549 X:58282014-58282036 ACCTCCTTCTGAAAGGCTGGGGG + Intergenic
1191688899 X:63920217-63920239 ATCTGCTTCTGACAATCAGAAGG + Intergenic
1193182693 X:78477473-78477495 AGCTGATTCTGAAATTCATATGG - Intergenic
1195555100 X:106212636-106212658 GGCTGCTTCTGCTAGGCTGAGGG - Intergenic
1197981183 X:132218620-132218642 CACTGCATCTGAAAGTCTAAGGG - Intronic
1200185508 X:154180561-154180583 TGCTGCTTTCGAAATTCTGAGGG + Intergenic
1200191162 X:154217700-154217722 TGCTGCTTTCGAAATTCTGAGGG + Intergenic
1200196917 X:154255504-154255526 TGCTGCTTTCGAAATTCTGAGGG + Intergenic
1200202567 X:154292621-154292643 TGCTGCTTTCGAAATTCTGAGGG + Intronic