ID: 1132812763

View in Genome Browser
Species Human (GRCh38)
Location 16:1809488-1809510
Sequence AGAGGACACGGAGGGCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 629}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132812749_1132812763 21 Left 1132812749 16:1809444-1809466 CCACTGCAGAGGAAGGCGACTCG 0: 1
1: 0
2: 1
3: 6
4: 69
Right 1132812763 16:1809488-1809510 AGAGGACACGGAGGGCGGGGAGG 0: 1
1: 0
2: 1
3: 48
4: 629
1132812748_1132812763 27 Left 1132812748 16:1809438-1809460 CCAGGGCCACTGCAGAGGAAGGC 0: 1
1: 0
2: 1
3: 28
4: 326
Right 1132812763 16:1809488-1809510 AGAGGACACGGAGGGCGGGGAGG 0: 1
1: 0
2: 1
3: 48
4: 629
1132812752_1132812763 -8 Left 1132812752 16:1809473-1809495 CCGAGCCCAGCCCTCAGAGGACA 0: 1
1: 1
2: 3
3: 64
4: 577
Right 1132812763 16:1809488-1809510 AGAGGACACGGAGGGCGGGGAGG 0: 1
1: 0
2: 1
3: 48
4: 629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132812763 Original CRISPR AGAGGACACGGAGGGCGGGG AGG Intronic
901051290 1:6427009-6427031 AGAGGGCACGGAGGGAGCTGGGG - Intronic
901123494 1:6913269-6913291 AGAGCAAGCGGAGGGTGGGGAGG - Intronic
901461342 1:9393601-9393623 AAAGGACACGGAGAGAGAGGGGG + Intergenic
901626910 1:10629813-10629835 GGAGGACAAGGAGGACGAGGAGG + Exonic
901630961 1:10647962-10647984 GGAGGGCACGGAGGCCGGGCTGG + Exonic
902343794 1:15801103-15801125 GAAGGACACGGAGGGCAGGCAGG + Intergenic
902491771 1:16787656-16787678 ACTGGACACAGAGGGCAGGGTGG - Intronic
902631486 1:17707133-17707155 AGAGGAAACGGAGGTCAGGGAGG + Intergenic
902690472 1:18107690-18107712 GGAGGGCAAGGAGGGCGGGGGGG + Intergenic
903251113 1:22053361-22053383 AGAGGACGCGGCCGGCGCGGAGG - Intronic
903285166 1:22272585-22272607 TGAAGCCACGGAGGACGGGGTGG + Intergenic
903325567 1:22566885-22566907 AGAGGAAGAGGAGGGAGGGGAGG + Intronic
903777218 1:25800556-25800578 AGGGGACACGGGAGGCGGGTGGG + Intronic
903792970 1:25906754-25906776 GGAGCAGGCGGAGGGCGGGGGGG + Intronic
904005432 1:27360932-27360954 GGAGGAGGCGGAGGGCGCGGGGG - Exonic
904170971 1:28592136-28592158 AGAGGAGGCGGGGGGTGGGGCGG + Intronic
904349506 1:29895786-29895808 GGAGGACACTGAGGGCTGAGGGG + Intergenic
904642077 1:31938426-31938448 AGCGAACGCGGAGGGCGGGCCGG - Intronic
904762735 1:32817466-32817488 AGTGGGCACGGTGGGCGGTGCGG + Exonic
905032975 1:34900044-34900066 TAAGGACAGGGAGGGCCGGGGGG - Intronic
905085382 1:35370575-35370597 AGAGGAGGCGGTGGGCGGGCAGG - Exonic
905202016 1:36322115-36322137 AGAAGACCCCGGGGGCGGGGAGG - Exonic
905639127 1:39576520-39576542 GGAGGGCACGGCGGGCCGGGCGG + Intronic
905752319 1:40477118-40477140 TGAGGAAACGGGGGGCGGCGTGG + Intergenic
906784598 1:48603514-48603536 AGGGGACACAGAGGGGGGTGAGG + Intronic
907421147 1:54348232-54348254 AGAAGGCATGGGGGGCGGGGGGG + Intronic
907752263 1:57273634-57273656 AGAAGACAGGGAGGGAGGGAGGG - Intronic
908007311 1:59740069-59740091 GGAGGACAGGGAGGGAGGAGAGG - Intronic
908414297 1:63897976-63897998 AGAGGAGAGGGAAGGCGTGGAGG + Intronic
912557439 1:110526360-110526382 AGAAGACAAGGAGGGCTGGAGGG + Intergenic
914999221 1:152572923-152572945 AGAGGAGATGGGGGTCGGGGAGG + Intronic
915313874 1:155017471-155017493 AGAGGGCAGGGCGGGCCGGGCGG + Exonic
915325665 1:155080235-155080257 AGGGGACCGGGAGGGCCGGGCGG + Intronic
915477454 1:156161280-156161302 GGAGGACACGCGGGGCTGGGGGG + Intronic
915895386 1:159807866-159807888 AGAAGACAAGGAGGGTGGGTGGG + Intronic
916128282 1:161590243-161590265 AAGGGGCATGGAGGGCGGGGCGG - Intronic
916138202 1:161672074-161672096 AAGGGGCATGGAGGGCGGGGCGG - Intronic
916207353 1:162328209-162328231 AGAGGAGTCGGAGAGTGGGGAGG + Intronic
917337299 1:173938771-173938793 AGAGGACCCTGAGGGAGGAGGGG - Exonic
917409364 1:174742147-174742169 AGAGGAGAGGGAGGGGGAGGAGG + Intronic
918712642 1:187750053-187750075 ACAGGACAGGCTGGGCGGGGTGG + Intergenic
919362014 1:196608439-196608461 AGGGGACAGGGAGGGGGAGGGGG + Exonic
919791870 1:201296436-201296458 AGAAGGCAGGGAGGGTGGGGAGG + Intronic
920279066 1:204829463-204829485 AGAGGCCACTGAGGGAGGGCTGG - Intronic
920367728 1:205456922-205456944 GGGGGGCGCGGAGGGCGGGGTGG - Intergenic
920604938 1:207371886-207371908 AGCGGACACGGAGGCCGAGGAGG + Intergenic
921121178 1:212139022-212139044 AGAGGGGACGGAGGGAGGGGTGG + Intergenic
921457993 1:215394898-215394920 AGCGGACACCGAGGCCGAGGAGG + Intergenic
921909176 1:220528635-220528657 AGAGGACGCGGAGGAAGAGGAGG - Exonic
922306943 1:224352603-224352625 GGAGCCCACGGAGGTCGGGGAGG + Intergenic
922596975 1:226821609-226821631 AGGGGACAGGAAGGGAGGGGAGG + Intergenic
922771544 1:228186878-228186900 AGAGGCCAGGGAGGGTGGGGAGG - Intergenic
923193422 1:231642033-231642055 GGAGCCCACGAAGGGCGGGGAGG + Intronic
923386004 1:233465902-233465924 AGTGGACACCGAGGCCGAGGAGG - Intergenic
923528674 1:234794883-234794905 ACTGGACACAGAGGGCAGGGTGG + Intergenic
1062801954 10:387545-387567 TGTGGACAGGCAGGGCGGGGTGG + Intronic
1063267283 10:4467446-4467468 AGAGGAGAAGGAGGGTGGAGAGG - Intergenic
1064014593 10:11762570-11762592 AGAGGACACGGTGAGGAGGGAGG + Intronic
1064255884 10:13742431-13742453 AGAGGACAGGGAGGGTGAAGAGG - Intronic
1064694850 10:17954816-17954838 AGAGGCGAGGGAGGGAGGGGAGG + Intronic
1064963251 10:20989562-20989584 AGAAGACAGGGAGGGAGGAGGGG + Intronic
1065515847 10:26523639-26523661 ATAGGACATGGAGGGGCGGGGGG + Intronic
1065639855 10:27770560-27770582 AGAAGAAAAGGAAGGCGGGGAGG - Intergenic
1066615132 10:37285657-37285679 AGTGGACACTGAGGCCGAGGAGG + Intronic
1067028674 10:42866025-42866047 GGAGGGCAGGGAGGGTGGGGAGG - Intergenic
1067225935 10:44375598-44375620 AGAGGAAGTGGAGGGCGGGCTGG + Intronic
1067251140 10:44587936-44587958 AGGGCCCAGGGAGGGCGGGGAGG - Intergenic
1067499191 10:46786647-46786669 AGCGGATTCCGAGGGCGGGGTGG + Intergenic
1067582118 10:47452488-47452510 TGAGGACACTGAGGACGGGAGGG - Intergenic
1067595450 10:47553705-47553727 AGCGGATTCCGAGGGCGGGGTGG - Intergenic
1067820081 10:49520763-49520785 TGAGGACAGGGAGGGCAGGTGGG - Intronic
1067837046 10:49648006-49648028 AGGGGACACTGGGGGCGGGAGGG + Intronic
1069739500 10:70678585-70678607 AGAAGACACGCGGGGCAGGGGGG + Intronic
1069874141 10:71551387-71551409 GGAGGAGAAGGAGGGAGGGGTGG + Intronic
1070694168 10:78549526-78549548 AGAAGAAACGGAGGGAGGGAAGG - Intergenic
1071484254 10:86087907-86087929 AGAGGACAGAGGGGGTGGGGAGG - Intronic
1071600380 10:86956014-86956036 AGAGGACCCGGTGGACGGGAGGG - Intronic
1071618221 10:87095099-87095121 AGGGGAGAGGAAGGGCGGGGAGG + Intronic
1074915867 10:117954399-117954421 AGAGGACAGGAGGGGAGGGGAGG - Intergenic
1075644344 10:124087710-124087732 AGGGGGCCTGGAGGGCGGGGGGG - Intronic
1075800709 10:125151904-125151926 AGTGGGCACGGAGCGGGGGGAGG + Intronic
1076663459 10:132070433-132070455 AGAGGACAGGTCGGGCGCGGTGG - Intergenic
1076806691 10:132862426-132862448 AGAGGACAGGGTGGGTGGGGCGG + Intronic
1076878753 10:133230115-133230137 TTAGGACCCGGCGGGCGGGGCGG + Intergenic
1077014135 11:392556-392578 GGGGGCCTCGGAGGGCGGGGTGG - Intergenic
1077092676 11:786840-786862 TGAGGACATGGGGTGCGGGGAGG - Intergenic
1077383870 11:2259961-2259983 AGAGGACATGGAGGGCTGAGGGG + Intergenic
1077571189 11:3339701-3339723 AGAGGACACGGAGGTGGAGGGGG + Intronic
1077889797 11:6410879-6410901 AGAGGAGAAGGCGGCCGGGGAGG - Exonic
1078708191 11:13765154-13765176 AGAGCACAGGGTGGGTGGGGTGG - Intergenic
1078937864 11:15967891-15967913 AGAGGTAAGGGTGGGCGGGGTGG - Exonic
1079003061 11:16773793-16773815 AGAGGACTCTGGGGGTGGGGGGG + Intergenic
1080108504 11:28538744-28538766 AGATGACAGGGAGGGAGGGAGGG - Intergenic
1081324531 11:41728574-41728596 AGTGGACACTGAGGCCGAGGAGG + Intergenic
1082003801 11:47408830-47408852 AGAGGACAGCGAGGGAGGGATGG - Intronic
1083080835 11:60091523-60091545 AGAGGACAAGGAGTGGAGGGAGG - Intronic
1083637042 11:64126349-64126371 AGAGGTGACGGAGGGTGGAGTGG + Intronic
1083657106 11:64234916-64234938 AGAGGGCACGGCGGGCGGGCGGG - Intronic
1083664232 11:64265904-64265926 GGAGGACACGAAGGAGGGGGAGG + Exonic
1083680360 11:64348892-64348914 AAAGGCCACGGAGGGCTGGAGGG - Intronic
1083728738 11:64642215-64642237 AAAGGACAGACAGGGCGGGGAGG + Intronic
1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG + Intronic
1085086053 11:73667905-73667927 AGAGGACAGGGAGTGGGGGTGGG + Intergenic
1085348718 11:75784634-75784656 AGAGGTCCTGGAGGGCGGAGAGG - Exonic
1085396130 11:76208074-76208096 AGGGGACACCGAGGCTGGGGTGG - Intronic
1085612525 11:77964756-77964778 AGAAGAGAGGGAGGGAGGGGAGG + Intronic
1085821634 11:79800011-79800033 AGAGGACAAGGTGGATGGGGAGG + Intergenic
1086921736 11:92595303-92595325 AGAGGACACACAGGCTGGGGAGG - Intronic
1087093645 11:94300020-94300042 AGAGGAAAGGCAGGGAGGGGAGG + Intergenic
1088469549 11:110178038-110178060 AGAGGCCATGGTGGGTGGGGAGG - Intronic
1088978055 11:114833261-114833283 AGAGGAAACTGAGGCCTGGGAGG - Intergenic
1089395856 11:118136026-118136048 GGAGGGCACGGTGGGGGGGGGGG + Exonic
1090021945 11:123136421-123136443 GGGGGACAAGGAGGGCGGGGTGG - Intronic
1090657861 11:128859685-128859707 AGAGGGCACGCAGGGAAGGGAGG - Intronic
1090726326 11:129530429-129530451 AGAGGAGAGGCAGGGCAGGGTGG + Intergenic
1091194142 11:133717681-133717703 AGAGGACAGGGACCGCGGTGGGG + Intergenic
1091216874 11:133907554-133907576 AGAAGGCCCCGAGGGCGGGGTGG - Intergenic
1091451799 12:576647-576669 AAAGAGCACGGAGGCCGGGGTGG - Intronic
1091792902 12:3281609-3281631 TGAGGCCAGGGAGGGCTGGGAGG + Intronic
1092198356 12:6563734-6563756 AGAGGAGACCGAGGACGAGGAGG - Exonic
1092205684 12:6613233-6613255 AGAGGAAATGGAGGGGAGGGGGG + Intergenic
1092889506 12:12955631-12955653 AGAGGCCATGGAAGGCAGGGTGG - Intergenic
1093464973 12:19439837-19439859 AGAGGAGGCGGAGGCCGAGGCGG + Exonic
1094107907 12:26833123-26833145 AGTGGACACGGAGTGGGGAGCGG - Exonic
1094200327 12:27788433-27788455 AGATGACACAGAGGTCTGGGTGG - Intronic
1095687485 12:45051512-45051534 GGAGCGCCCGGAGGGCGGGGTGG + Intergenic
1096179864 12:49544719-49544741 AGAGGATGCGGGGGGAGGGGTGG - Intronic
1096396015 12:51267468-51267490 GGGGGACACGGAGTGGGGGGGGG - Intronic
1096521294 12:52186180-52186202 AGAGGACAGGCAGGGTGGGGAGG - Intronic
1096521436 12:52186884-52186906 AGAGGACAGCCAGGGTGGGGAGG - Intronic
1097020474 12:56017225-56017247 AAAGGACGGGGGGGGCGGGGGGG - Intronic
1097232932 12:57523065-57523087 AGAGGACGCGGAGGGGGCAGAGG - Intronic
1097265888 12:57744721-57744743 AGGGGAGACGGCGGGAGGGGCGG - Intronic
1097891420 12:64780994-64781016 TGAGGACACGGAGCCCGGCGAGG + Intergenic
1099478602 12:83139989-83140011 AGTGGACACCGAGGCCGAGGAGG - Intergenic
1101098168 12:101365206-101365228 AGAGAACAGGGAGGGAGTGGAGG + Intronic
1102587461 12:113933273-113933295 CGAGGACAACGAGGGCTGGGGGG - Intronic
1103342066 12:120226008-120226030 ATGGGACCCGGAGGGCGGGGCGG - Intronic
1103601466 12:122057276-122057298 AGAGGCCAGGGTGGCCGGGGAGG + Intronic
1103738855 12:123078100-123078122 AGCGGAGAGGGAGGGCGGGAAGG + Intronic
1103948583 12:124540222-124540244 GGAGGGCAGGGAGGGCAGGGAGG + Intronic
1103953805 12:124566087-124566109 GGAGGACCCTGTGGGCGGGGTGG - Intronic
1103953884 12:124566428-124566450 GGAGGGCACGGCGGGCGGGAGGG - Intronic
1104205493 12:126634658-126634680 AGAGGACACAGGAGGCAGGGAGG - Intergenic
1104894233 12:132153961-132153983 GGAGCCCAAGGAGGGCGGGGAGG - Intergenic
1104968781 12:132521834-132521856 AGAGGACACGGGGGCTGGTGTGG + Intronic
1105237233 13:18568206-18568228 AGCGGACATGGAGGCCGAGGAGG + Intergenic
1105454282 13:20525899-20525921 CGCGGACCGGGAGGGCGGGGAGG + Intergenic
1106208526 13:27620892-27620914 AGAGGAATCGCGGGGCGGGGTGG + Exonic
1107161914 13:37240104-37240126 AGATCACATGGAGGGAGGGGAGG + Intergenic
1107307372 13:39037673-39037695 AGAGTCCACGGGCGGCGGGGAGG + Exonic
1108575426 13:51786363-51786385 ATGGGAGAGGGAGGGCGGGGAGG - Intronic
1112440349 13:99420494-99420516 AGAGGAAAAGGAGTGTGGGGTGG + Intergenic
1113541018 13:111109559-111109581 AGAGGACAGGAAGGGTGGAGGGG + Intergenic
1113680194 13:112238564-112238586 AGTGGACACCGAGGCCGAGGAGG - Intergenic
1113695900 13:112345211-112345233 AGAGGCTGCGGAGGGCAGGGTGG - Intergenic
1113731578 13:112645356-112645378 AGAGGACACCGAGGATGGCGAGG + Intergenic
1113731589 13:112645410-112645432 CGAGGACACCGAGGACGGCGAGG + Intergenic
1113731593 13:112645428-112645450 CGAGGACACCGAGGACGGCGAGG + Intergenic
1114080775 14:19200274-19200296 AGAGGACACAGAAGGAGGGAGGG + Intergenic
1114454792 14:22847450-22847472 AGAGGAGAGGGATGTCGGGGGGG + Exonic
1114522666 14:23348695-23348717 AGAGGAGAGGGAGGCCAGGGAGG + Intronic
1114524637 14:23360003-23360025 AGGGCACCCGGAGGGCGGTGGGG + Exonic
1118006334 14:61567432-61567454 AGAGGACACTGGAGGCTGGGAGG - Intronic
1118038265 14:61891533-61891555 AGAGGACAAGTAGGGCTGGAGGG + Intergenic
1119484740 14:74980085-74980107 AGAGGACACGGAGGATGCGTGGG + Intergenic
1120359848 14:83485432-83485454 AGAGAACATGGCGGGGGGGGGGG - Intergenic
1120429718 14:84399471-84399493 GGAGCCCACGGAGGGCGGGGAGG + Intergenic
1120521361 14:85531101-85531123 AGAGGACAAGCAGGGCTGGAAGG - Intronic
1120787502 14:88550743-88550765 ACAGGACCCGGAAGGCAGGGTGG + Intronic
1120949757 14:90030191-90030213 GGAAGACACGGAGGGCAGGCAGG - Intronic
1121052749 14:90830158-90830180 GGAGGAGACGGAGGACGGAGAGG + Intergenic
1121209762 14:92199471-92199493 GGAGGAGACGAAGGGCAGGGTGG + Intergenic
1121275888 14:92667167-92667189 AGAGGACAGGGAGGGAGGTCAGG + Intronic
1121547048 14:94770149-94770171 AGCGGACGCAGGGGGCGGGGAGG - Exonic
1121592361 14:95125676-95125698 AGGGGACAGGGAGGGGGAGGAGG + Intronic
1121720872 14:96107873-96107895 AGAGGACAGAGAGGGGAGGGAGG - Intergenic
1122428971 14:101628034-101628056 AGAGGAGACGGGGGACTGGGAGG + Intergenic
1122473141 14:101985845-101985867 AGAGGGCACGGAAGCCTGGGAGG + Exonic
1122931174 14:104933631-104933653 AGGGGACCGGGAGGGCGGGAGGG + Exonic
1122931240 14:104933802-104933824 AGGGGACAGGGAGGGCGGGAGGG + Exonic
1122931284 14:104933904-104933926 AGGGGACCGGGAGGGCGGGAGGG + Exonic
1122931324 14:104934007-104934029 AGGGGACGGGGAGGGCGGGAGGG + Exonic
1122931356 14:104934077-104934099 AGGGGACGGGGAGGGCGGGAGGG + Exonic
1123473505 15:20571350-20571372 AGAGGACCTGGAGAGCAGGGAGG + Intergenic
1123644504 15:22429003-22429025 AGAGGACCTGGAGAGCAGGGAGG - Intergenic
1123665820 15:22608911-22608933 AGAGGACCTGGAGAGCAGGGAGG - Intergenic
1123733803 15:23166361-23166383 AGAGGACCTGGAGAGCAGGGAGG + Intergenic
1123777660 15:23596852-23596874 TGAGCACTGGGAGGGCGGGGTGG - Intronic
1124319643 15:28703324-28703346 AGAGGACCCGGAGAGCAGGGAGG - Exonic
1124482868 15:30092106-30092128 AGAGGACCCGGAGAGCAGGGAGG + Exonic
1124489322 15:30144177-30144199 AGAGGACCTGGAGAGCAGGGAGG + Exonic
1124520708 15:30405112-30405134 AGAGGACCCGGAGAGCAGGGAGG - Exonic
1124537951 15:30561107-30561129 AGAGGACCTGGAGAGCAGGGAGG + Exonic
1124544411 15:30613168-30613190 AGAGGACCCGGAGAGCAGGGAGG + Exonic
1124564373 15:30800604-30800626 AGAGGACCTGGAGAGCAGGGAGG + Intergenic
1124754207 15:32394150-32394172 AGAGGACCTGGAGAGCAGGGAGG - Exonic
1124760701 15:32446479-32446501 AGAGGACCCGGAGAGCAGGGAGG - Exonic
1124777932 15:32602584-32602606 AGAGGACCTGGAGAGCAGGGAGG + Exonic
1125724645 15:41862065-41862087 AGAGGAAGGGGAGGGCAGGGCGG + Intronic
1125756513 15:42069045-42069067 AAAGGACACAGAGAGCTGGGAGG - Intronic
1126307999 15:47283149-47283171 AGAGGAAAATGAGGGTGGGGTGG - Intronic
1127521604 15:59748203-59748225 GGAGGACATGGAGGGCAGGAGGG - Intergenic
1127555435 15:60082815-60082837 AGAGGACACAGAGGGCCTTGGGG + Intergenic
1127821063 15:62656669-62656691 AGAGGAAAGGGAGGGAGGGAAGG - Intronic
1128498417 15:68210993-68211015 AGCGGGCACTGAGGGCTGGGCGG + Intronic
1128702923 15:69817133-69817155 AGAGGGGAGGGAGGGAGGGGGGG + Intergenic
1128972395 15:72118647-72118669 AATGGAAACGGAGGTCGGGGCGG - Intronic
1129038450 15:72665008-72665030 AGAGGACCTGGAGAGCCGGGAGG + Exonic
1129211439 15:74072223-74072245 AGAGGACCTGGAGAGCCGGGAGG - Exonic
1129398964 15:75268861-75268883 AGAGGACCTGGAGAGCCGGGAGG + Exonic
1129402572 15:75293137-75293159 AGAGGACCTGGAGAGCCGGGAGG + Exonic
1129476103 15:75785563-75785585 AGAGGACCTGGAGAGCCGGGAGG + Intergenic
1129728562 15:77916499-77916521 AGAGGACCTGGAGAGCCGGGAGG - Intergenic
1129997173 15:80016754-80016776 GGAGCCCACGGAGGGCGGGCAGG - Intergenic
1130146133 15:81275046-81275068 AGAGGTCGCAAAGGGCGGGGCGG + Intronic
1130312963 15:82771009-82771031 AGAGGACATGGAGAGGGGCGAGG - Intronic
1130564627 15:84982436-84982458 AGAGGGCACCGAGGCCGGGTGGG - Intronic
1130904861 15:88233231-88233253 AGATTACACTGGGGGCGGGGGGG - Intronic
1131333708 15:91526614-91526636 AGAGGAGACAGAGGGCTGAGGGG - Intergenic
1131703792 15:94970847-94970869 GGAGGACACGGAGGGCACGGTGG - Intergenic
1131969225 15:97875607-97875629 AGCGGACGCAGAGGACGGGGAGG - Intergenic
1132184043 15:99788385-99788407 AGAAGAAATGGAGGGAGGGGAGG - Intergenic
1132184453 15:99791614-99791636 AGAGGACCTGGAGAGCTGGGAGG + Intergenic
1132515576 16:364245-364267 GGAGGGCGGGGAGGGCGGGGAGG + Intergenic
1132701696 16:1224867-1224889 GCAGGACCTGGAGGGCGGGGAGG - Intronic
1132788676 16:1672824-1672846 TGAGGAGACGGAGGACGGGAGGG - Intronic
1132812763 16:1809488-1809510 AGAGGACACGGAGGGCGGGGAGG + Intronic
1132868240 16:2104252-2104274 AAAGGACGGGGAGGACGGGGGGG + Intronic
1133406483 16:5528651-5528673 AGAGGACAGGAGGGGAGGGGAGG - Intergenic
1133738833 16:8636107-8636129 AGGTGACACGGTGGGAGGGGTGG - Intronic
1134462243 16:14439414-14439436 AGAAGACAGGGAGGGAGGGAGGG + Intronic
1135340105 16:21637850-21637872 AGCGGACACCGAGGCCGAGGAGG + Intronic
1136553130 16:30992394-30992416 AGAGGACAGAGAGGGCGTGATGG + Exonic
1137621782 16:49881111-49881133 AGATGACAAGGAGGGCTGTGAGG - Intergenic
1137684248 16:50374776-50374798 AGAGGAGACTGAGGAGGGGGAGG + Intergenic
1137990637 16:53151214-53151236 AGAGGAAAGGGAGGGGAGGGGGG - Intronic
1138104810 16:54282360-54282382 AGAGGAAAAAGAGGGCGCGGAGG + Intergenic
1138130623 16:54476603-54476625 AGGGGAGACAGAGGGAGGGGGGG + Intergenic
1138168762 16:54829688-54829710 AGTGGGCACGGAGGCCGAGGAGG - Intergenic
1138223205 16:55270600-55270622 TGAGGAAACGGAGGGCAGAGAGG - Intergenic
1138264171 16:55647548-55647570 AGAAGAAACGGAGGGAGGGAGGG + Intergenic
1138567039 16:57841188-57841210 GGAGGACATGGAGGGATGGGTGG + Intronic
1139292944 16:65874432-65874454 TCAGGACAGGGAGGGCAGGGAGG + Intergenic
1139472282 16:67184639-67184661 AGAGAAGCCGGAGGGCGGGGAGG - Intronic
1139511826 16:67432125-67432147 AGAGGACCAGGAGGGCTTGGGGG - Intronic
1139655845 16:68386917-68386939 AGAGGACTCTGAGGGTGGGATGG + Intronic
1140337211 16:74118747-74118769 AGAGGAGAAGGAGGGAGGGAGGG + Intergenic
1140814125 16:78604906-78604928 AGAAGACAGGGAGGGAGGGAGGG - Intronic
1140914600 16:79482912-79482934 AGAGGAGAGGGAGGGAGGGAAGG - Intergenic
1203083209 16_KI270728v1_random:1161933-1161955 TCAGGACACGGGGGGGGGGGGGG + Intergenic
1142523005 17:518269-518291 GGTGGACAGGAAGGGCGGGGGGG + Exonic
1142736734 17:1905693-1905715 AGAGGGTGGGGAGGGCGGGGTGG - Intergenic
1143094180 17:4468151-4468173 AGAGGACAGGCTGGGCGTGGAGG + Intronic
1143171554 17:4933495-4933517 AGAGGACACTGAGGGCGATAAGG + Exonic
1143283397 17:5771493-5771515 GGAGCCCACGGAGGTCGGGGCGG - Intergenic
1143747339 17:9003883-9003905 AGAGGAGCCGGCGGGCGCGGCGG - Intergenic
1144176232 17:12710323-12710345 AGAGGACACGGGGCCCGGGGAGG + Intronic
1145253179 17:21307541-21307563 AGAGGAGAGGGAGGGAGGGTTGG + Intronic
1145323391 17:21780377-21780399 AGAGGAGAGGGAGGGAGGGTTGG - Intergenic
1145765528 17:27456295-27456317 GGAGGGCAGGGAGGGCGGCGCGG + Intergenic
1145941212 17:28744272-28744294 AGGGGACAGCGGGGGCGGGGCGG + Intronic
1146003847 17:29148779-29148801 AGAGGAGAAGGAGGGCTGAGAGG + Intronic
1146179415 17:30687670-30687692 GGTGGACACAGAGGGAGGGGCGG - Intergenic
1146670801 17:34736325-34736347 AGAGGAGGAGGAGGGCGAGGAGG + Intergenic
1147597218 17:41724937-41724959 AGAGGAGACCGAGGGCTGGGAGG - Exonic
1148334914 17:46834655-46834677 AGAGGACAGGGAAGGGGAGGAGG - Intronic
1148638370 17:49166342-49166364 AGAGGAGGGGGAGGGAGGGGAGG + Intronic
1148774490 17:50087974-50087996 AGAGGACAGGGAGGAAGGGTGGG - Intronic
1150256608 17:63750872-63750894 AGAGGACAGGCCGGGCGTGGTGG - Intronic
1150726893 17:67658492-67658514 AGAGGATACTGGGGGTGGGGTGG - Intronic
1150783450 17:68142872-68142894 GGAGGACAAGGAGGGAGGGAAGG - Intergenic
1150784976 17:68154844-68154866 AGAAGAAAGGGAGGGAGGGGAGG - Intergenic
1150929841 17:69572986-69573008 AGGGGAGACGAAGGGAGGGGAGG - Intergenic
1151440954 17:74128784-74128806 AGAGGACAGAGAGGGCAAGGTGG + Intergenic
1151570574 17:74923541-74923563 AGGGGTGCCGGAGGGCGGGGTGG + Intergenic
1151660841 17:75517104-75517126 GGAGGGCAGGGAGGGCAGGGAGG - Intronic
1151671437 17:75573663-75573685 AGAGGGCAGGGAGGGGCGGGAGG - Intronic
1151778664 17:76227009-76227031 CGTGGACCCTGAGGGCGGGGAGG + Intronic
1152031234 17:77844843-77844865 AGCGGTCACGGAAGGCGGGCTGG - Intergenic
1152214688 17:79025211-79025233 AGAAGCCATGGAGGGCTGGGTGG - Intronic
1152360715 17:79832013-79832035 TGAGGGCCAGGAGGGCGGGGAGG - Intergenic
1152768156 17:82152045-82152067 AGAAGGCAGGGATGGCGGGGAGG - Intronic
1153574150 18:6504082-6504104 GGAAGAGACGGAGGGCGGGAAGG + Intergenic
1153815396 18:8786115-8786137 AAAGGAGGGGGAGGGCGGGGGGG - Intronic
1155858951 18:30872086-30872108 AGAAGAGACAGAGGGAGGGGGGG - Intergenic
1157475546 18:48021241-48021263 AGAAGAAAGGGAGGGAGGGGAGG - Intergenic
1157867104 18:51196972-51196994 AGAGGACGAGGAGGAGGGGGAGG - Exonic
1158239534 18:55361293-55361315 AGAGGAAAGAGAGGGCTGGGAGG - Intronic
1159627701 18:70714016-70714038 AAAGGAGATGGAGGGAGGGGTGG + Intergenic
1160050606 18:75429913-75429935 GGAGGAAAAGGAGGGAGGGGTGG - Intergenic
1160499253 18:79394301-79394323 TGGGGAGAAGGAGGGCGGGGCGG + Intergenic
1160535576 18:79589769-79589791 GGGAGACATGGAGGGCGGGGAGG - Intergenic
1160735214 19:659252-659274 AGAAGACAGGGTGGGCCGGGGGG + Intronic
1161058114 19:2200664-2200686 AGAGGACAAAGAGTGCTGGGAGG - Intronic
1161152417 19:2716681-2716703 AGAGGTCACGACGGGCCGGGTGG + Exonic
1161208202 19:3053279-3053301 AGAGGACCAGGTGGGCGTGGAGG + Exonic
1161286688 19:3472077-3472099 CGAGGACACCGAGGATGGGGGGG + Intergenic
1161332895 19:3696737-3696759 GGAGGGCAGGGAGGGCAGGGAGG + Intronic
1161478956 19:4501243-4501265 AGAGGACAAGGAGCACGAGGAGG + Exonic
1161502326 19:4623186-4623208 CGGGGACACTGGGGGCGGGGTGG + Intergenic
1161509726 19:4663675-4663697 TGAGGACAGGGTGGGTGGGGAGG - Intronic
1161590937 19:5128845-5128867 AGTGGAGGCGGGGGGCGGGGGGG + Intronic
1161591450 19:5131045-5131067 AGAGGAGAGGGAGGTCAGGGAGG - Intronic
1161865998 19:6832577-6832599 AGAGGAAGAGGAGGGCGAGGAGG - Intronic
1161906640 19:7161750-7161772 AGAGAACAAGGAAGGCAGGGAGG + Intronic
1162108993 19:8390204-8390226 CCAGGACACCGAGGGCGAGGAGG + Exonic
1162134315 19:8545785-8545807 AGAGGACATGGGGGGAAGGGTGG - Intronic
1162391249 19:10391402-10391424 AGAGGCCAGGGAGGGCTGGGCGG + Exonic
1162398714 19:10432168-10432190 GGAGGAGACGGGGGGGGGGGGGG + Intronic
1162671288 19:12259934-12259956 AGAGGACAGGGAGGGAAGGTGGG - Intronic
1162956110 19:14099046-14099068 AGAGGCCAAGGCGGGGGGGGCGG + Intronic
1162979211 19:14227889-14227911 GGCGGACACAGAGGGAGGGGCGG + Intergenic
1163051846 19:14690169-14690191 GGAGGGCGGGGAGGGCGGGGAGG + Intronic
1163093215 19:15035809-15035831 AGAGGAGAAGGAGGGAGGGAGGG + Intergenic
1163378254 19:16947464-16947486 TGAGGATACGGAGGGCTGTGGGG - Intronic
1163472702 19:17506574-17506596 AGAGGAGAGGGAGGGAGGGAGGG + Intergenic
1163477226 19:17533451-17533473 AAAGGAGAGGGAGGGAGGGGTGG + Intronic
1163554352 19:17983800-17983822 AGAGGGCAGGAGGGGCGGGGGGG - Intronic
1163926759 19:20353256-20353278 AGAGCACACAGAGGGGGGAGGGG - Intergenic
1164426062 19:28142721-28142743 AGAGGGGAGGGAGGGAGGGGAGG + Intergenic
1164839444 19:31381285-31381307 AGAGGACACAGAGGGCATGGTGG - Intergenic
1164868664 19:31625726-31625748 AGAGGAAAAGGAGGAGGGGGAGG - Intergenic
1165093079 19:33396694-33396716 GGAGGCCAGGGAGGGTGGGGGGG + Intronic
1165259493 19:34599701-34599723 AGAGGACAGGGAGGGAAGAGAGG - Intronic
1165837834 19:38770332-38770354 GGAGGACTCGAAGGGCGGCGCGG - Intergenic
1165847414 19:38827106-38827128 GGAGGAGAGGGAGGGAGGGGAGG + Intronic
1166105098 19:40594248-40594270 AGAGGGCATGGGGGGAGGGGTGG + Intronic
1166384136 19:42370835-42370857 AGAGGAACCGGGGGGGGGGGGGG + Intronic
1167032277 19:46970772-46970794 GGAGGCCAGGGAGGGCTGGGAGG + Intronic
1167504248 19:49862898-49862920 AGAGACCACGGAGGGGGGAGGGG - Intronic
1167620556 19:50557681-50557703 AGAGGGCTGGGAGGGCTGGGTGG + Intronic
1167940556 19:52942698-52942720 AGAACAGACAGAGGGCGGGGCGG + Intronic
1168186121 19:54700728-54700750 AGAGGTCACAGAGGTCAGGGTGG - Intronic
1168189238 19:54725987-54726009 TGAGCACAGGGAGGGAGGGGCGG + Intronic
1168193510 19:54756808-54756830 AGAGCACAGGGAGGGAGGGGTGG + Intronic
1168195573 19:54771546-54771568 AGAGCACAGGGAGGGAGGGGCGG + Intronic
1168206133 19:54851932-54851954 TGAGCACAGGGAGGGAGGGGTGG + Intronic
1168290564 19:55355145-55355167 GGAGGACGAGGGGGGCGGGGGGG - Intronic
1168323964 19:55528733-55528755 GGAGGACAGGGACGGAGGGGAGG + Intergenic
925590919 2:5508067-5508089 AGAGGCCACAGAGGGGGTGGAGG + Intergenic
926055302 2:9770852-9770874 AGAGAACAGGGAAGGCGGAGGGG - Intergenic
926292005 2:11538913-11538935 AGGGGACACGAGGGGAGGGGAGG - Intronic
926292014 2:11538933-11538955 AGGGGACACGAGGGGAGGGGAGG - Intronic
926570576 2:14525356-14525378 AGAGGAGAAGGAGGGAGGGTGGG + Intergenic
927193290 2:20531678-20531700 TGAGAACAGGGAGGGTGGGGTGG + Intergenic
928132738 2:28664837-28664859 AGAGGACAAGGAGGAGAGGGTGG - Intergenic
929538563 2:42801392-42801414 GGAAGACAGGGAGGGAGGGGTGG - Intergenic
929547058 2:42862706-42862728 AGGGGCCACTGAGGGCAGGGGGG + Intergenic
932457180 2:71857280-71857302 AGCGGGCATGGAGGGAGGGGAGG + Intergenic
932468634 2:71939759-71939781 AGAGGAAGAGGAGGGTGGGGAGG + Intergenic
934763910 2:96869971-96869993 AGAGGCCGCGGAGGGCTGGCGGG - Exonic
936116565 2:109707584-109707606 GGAGGATAGGGAGGGCAGGGCGG - Intergenic
936172677 2:110190316-110190338 GGAGCCCACAGAGGGCGGGGAGG + Intronic
936972027 2:118185550-118185572 AGAGGGCACGGCGGGGGAGGGGG + Intergenic
937072536 2:119074912-119074934 AGAGGCAAGGGAGGGCGTGGAGG + Intergenic
937227807 2:120379620-120379642 AGAGGACAGGGAGGCCTGGGAGG + Intergenic
937265956 2:120614789-120614811 AGAGGACAGGGAGGGCAGAAAGG + Intergenic
937818154 2:126276256-126276278 AGAGGAGAGGAAGGGAGGGGAGG + Intergenic
938303387 2:130231463-130231485 AGAGGACAAGGAGGAGGGCGAGG + Intergenic
938371167 2:130769026-130769048 AGAGGACAGGGAGGACGGGCAGG + Intergenic
940694404 2:156959996-156960018 AGAGCACAGGGATGGCTGGGTGG + Intergenic
941347579 2:164389342-164389364 AGAGGAGAGGGAGGGAGGGAGGG - Intergenic
942151016 2:173076017-173076039 GGAGCCCGCGGAGGGCGGGGAGG + Intronic
942965852 2:181891900-181891922 AGGGGACAGGGAGGGAGGGAGGG - Exonic
944586692 2:201179079-201179101 AGAGGACAAAGAGGGCAGAGAGG + Intergenic
945216301 2:207437553-207437575 AGAGTGAACGGAGGGCGGGAGGG + Intergenic
946328293 2:218996220-218996242 AGCTGGCGCGGAGGGCGGGGTGG + Intergenic
947527435 2:230887012-230887034 GGAGGACAGGGAGGGGAGGGAGG + Intergenic
947643389 2:231720449-231720471 AGAGCTGACGGAGGGCGGGAGGG - Intergenic
947748755 2:232522390-232522412 TGGGGGCACGGAGGGCGGGCCGG - Intronic
948208142 2:236173523-236173545 AGAGGGCACGGAGGGGTGAGGGG + Intergenic
948344363 2:237282750-237282772 AGAGGAGAGGAAGGGAGGGGAGG + Intergenic
948393267 2:237627414-237627436 AGGGGCCAGGGACGGCGGGGCGG - Intergenic
948493575 2:238330488-238330510 GGAGGACACTGAGGTCGGGAAGG + Intronic
949052165 2:241903182-241903204 AGGGGACAAGGACGGCGCGGTGG + Intergenic
1168855334 20:1003830-1003852 AGAGGACAGGCTGGGTGGGGTGG - Intergenic
1169214839 20:3786834-3786856 GGTGGGCGCGGAGGGCGGGGAGG - Intronic
1169945991 20:10988944-10988966 GGAGGACAGGGAGGACAGGGAGG + Intergenic
1170545678 20:17433979-17434001 AGAGGACAGGGAGAGAGGAGAGG - Intronic
1170938284 20:20828011-20828033 AGAGGACAGGCAGGGAGGGAGGG + Intergenic
1171391022 20:24801884-24801906 AGAGGACATGGAAGGCCAGGGGG + Intergenic
1171413272 20:24960499-24960521 AGAGGCCACCGAGGGCTGGAGGG + Intergenic
1171427165 20:25056646-25056668 TGAGGAGACTGAGGGCTGGGGGG + Intronic
1172114056 20:32563249-32563271 GGAGGTCAGGGAGGGTGGGGAGG + Intronic
1172958285 20:38778032-38778054 AGAGGACATGGAGTGGGGTGGGG + Intergenic
1173065101 20:39703054-39703076 AGAGGGCAGGGAAGGGGGGGAGG + Intergenic
1173122023 20:40302162-40302184 GGAGGAGAAGGAGGGAGGGGAGG + Intergenic
1174370719 20:50085564-50085586 AGAGGGCACGGATGCCGGAGAGG - Intronic
1174729863 20:52905379-52905401 AGAGGACCTGGAGGGGGAGGTGG - Intergenic
1175349601 20:58309149-58309171 AGAGTGCACGAAGCGCGGGGCGG - Intergenic
1175606992 20:60319265-60319287 AGATGACAGTGAGGGCTGGGTGG - Intergenic
1175745113 20:61451126-61451148 GGATGACACGGAGGGAAGGGGGG - Intronic
1176002771 20:62840405-62840427 AGAGGCCACAGCGGGTGGGGAGG - Intronic
1176173784 20:63708226-63708248 AGAAGAGACGCCGGGCGGGGGGG + Intronic
1176201471 20:63862758-63862780 AGAGGAGCTGGAGGGCGAGGAGG + Exonic
1176781218 21:13196488-13196510 AGCGGACATGGAGGCCGAGGAGG + Intergenic
1178988749 21:37333504-37333526 AGAAGACATGGAGGGTGGGGAGG - Intergenic
1179503759 21:41826013-41826035 AGAGGACCTGGAGGCCGGTGGGG - Exonic
1179610628 21:42547854-42547876 AGTGGACATGGGGAGCGGGGCGG - Intronic
1179985341 21:44917879-44917901 AGAGAACACGCAGCCCGGGGTGG + Intronic
1180054097 21:45348181-45348203 AGAGGACAGAGGGCGCGGGGCGG + Intergenic
1180127721 21:45803602-45803624 ACAGGACACTGAGGGCAGGAAGG + Intronic
1180499998 22:15922411-15922433 AGAGGACACAGAAGGAGGGAGGG - Intergenic
1180899393 22:19359609-19359631 AGAGGAGAGGGAGGGCAGGTAGG + Intronic
1181273438 22:21674029-21674051 AGGGCCCACGGAGGGCGGGGAGG + Intronic
1181456736 22:23064146-23064168 AAAGGGCACTGAGGGCGGGCTGG + Intronic
1182397735 22:30048469-30048491 AGAGGTCAGGCAGGGTGGGGAGG - Intergenic
1182857190 22:33528124-33528146 AGAGGTCGGGGGGGGCGGGGCGG + Intronic
1183234435 22:36606635-36606657 AGATGAAAGGGAGGGCAGGGAGG + Intronic
1183332566 22:37229280-37229302 AGAGGGCAAGGAGGGTGAGGGGG + Intronic
1183367351 22:37414006-37414028 AGAGGACAGTGAGGCCAGGGAGG - Intronic
1183713530 22:39520619-39520641 CGTGGACCCTGAGGGCGGGGAGG - Exonic
1184015525 22:41783077-41783099 AGAGGACAGGGAAGGTGGGTGGG - Intronic
1184043642 22:41958715-41958737 ACAGGACAGGGAGGGAGGGCAGG - Intergenic
1184319587 22:43730213-43730235 AGAGGAAAAGGAGGGCAGGAGGG + Intronic
1184551133 22:45204703-45204725 AGGGCACTGGGAGGGCGGGGAGG - Intronic
1184571420 22:45327426-45327448 AGAGGCCACGGAGGCAGGAGAGG - Intronic
1185009327 22:48304551-48304573 AGAGGACAGGGATGGAGGAGAGG - Intergenic
1185178002 22:49341264-49341286 AGAGGACAGGGAGAGAGGTGTGG - Intergenic
1185184008 22:49381762-49381784 ACAGGAGAAGGAGGGCGGGAAGG - Intergenic
1185193666 22:49454720-49454742 AGAGGCCAGGGAGGGAGGTGAGG + Intronic
1185270366 22:49926858-49926880 AGAGGGGACCGAGGGTGGGGGGG - Intronic
950046638 3:9952155-9952177 AGAGGAGACGGAGGAGGAGGAGG - Intronic
950123181 3:10495322-10495344 AGAGGAGACTGAGGCCGGAGAGG - Intronic
950200065 3:11036411-11036433 GGAGGACACTGAGGACTGGGAGG + Intronic
950285578 3:11742226-11742248 AGAGGGCACAGTGGGAGGGGAGG - Intergenic
950899289 3:16482802-16482824 AGAGGCCAGGGAGGGCGCAGGGG + Intronic
952227420 3:31392651-31392673 AGAGGACATGGAAGGCAGGAAGG - Intergenic
953453968 3:43027556-43027578 AGAGGAAAGGGAGGGCAAGGAGG + Intronic
953908891 3:46882197-46882219 AGAGGCCCGGGAGGGCGCGGGGG + Intronic
953980979 3:47412902-47412924 GGAGGAAAGGGGGGGCGGGGAGG - Exonic
954089402 3:48272413-48272435 AGCGGACGCTGAGGCCGGGGAGG + Intronic
954717608 3:52534152-52534174 AGAGGACCCGGGGGCCCGGGGGG - Intronic
954912730 3:54122505-54122527 AGAGGAGAGGGAGGGAGGAGAGG - Intergenic
955051567 3:55415920-55415942 AGGAGACAGGGAGGGCTGGGTGG - Intergenic
955166002 3:56511963-56511985 AGAGGACTAGGAGAGCAGGGAGG + Intergenic
956479550 3:69660537-69660559 AGTGGACACCGAGGCCTGGGAGG - Intergenic
960119114 3:113928160-113928182 AGGGGACACAGAGGGCAGAGAGG - Intronic
961356828 3:126344669-126344691 AGGGGAAACGGAGGCCTGGGAGG + Intronic
961563324 3:127746445-127746467 AGAGAAAAGGGAGGGCAGGGTGG - Intronic
961793414 3:129392712-129392734 AGAGGGCATGGAGGGCACGGAGG + Intergenic
961807411 3:129499330-129499352 AGAGGGCATGGAGGGCACGGAGG + Intronic
961811120 3:129522394-129522416 AGAGGACACTGAGGCCAGAGAGG + Intergenic
962753526 3:138451637-138451659 AGAGGACATGGAAGGCGAGGAGG - Intronic
965599036 3:170437280-170437302 AGAGGACAGGGAGGCCAGTGTGG + Intronic
966725394 3:183103830-183103852 AGAGCCCACGGAGCGGGGGGAGG + Intronic
966863041 3:184241294-184241316 AGCCGACAGGGAGGACGGGGAGG - Exonic
967462791 3:189765718-189765740 AGAGGACAGGCCGGGCGCGGTGG - Intronic
968029921 3:195474893-195474915 AGAGGAGAGGGGGGGAGGGGAGG + Intergenic
968058060 3:195708237-195708259 AGAGGACACTGTGGTCTGGGTGG - Intergenic
968556223 4:1247756-1247778 AGAGGCCGGGGAGGGGGGGGGGG + Intronic
968827423 4:2909482-2909504 AGAGGAGACGGGGAGGGGGGAGG - Intronic
969306868 4:6330866-6330888 GGAGGACACGGGGGCTGGGGAGG - Intronic
969459884 4:7323518-7323540 AGAGCACCAGGAGGGCTGGGAGG + Intronic
969480592 4:7445012-7445034 GGAGCAGAGGGAGGGCGGGGAGG + Intronic
969513271 4:7631772-7631794 AGAGGGAAGGGAGGGCTGGGAGG - Intronic
971264804 4:25088232-25088254 AGGGGACAGGGAAGGCTGGGTGG - Intergenic
972557209 4:40193505-40193527 AGAGGAGAGGAGGGGCGGGGTGG + Intronic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
973293440 4:48491086-48491108 AGAGGCCCAGGAGGGCGAGGCGG + Exonic
973303598 4:48617676-48617698 AGAGGACAGGGAGGATGAGGGGG + Intronic
973996880 4:56467610-56467632 GGAGGAGACGAGGGGCGGGGCGG - Exonic
974029506 4:56763518-56763540 AGAGGAGAGGGAGGGAGGGAGGG - Intergenic
974473883 4:62355152-62355174 AGAGGAAATGGAGGGAGGGAGGG - Intergenic
974769311 4:66389962-66389984 AGAGGACACAGATGATGGGGAGG - Intergenic
975464258 4:74691854-74691876 AGAGGACAGAGAGGGCAAGGTGG - Intergenic
976225997 4:82796409-82796431 AGAGGACACTGGGGCCTGGGAGG + Intronic
976390057 4:84497857-84497879 GGAGGAACCGGAGGGCGAGGCGG + Exonic
978158956 4:105523222-105523244 AGAGGAAAGGGTGGGCGCGGTGG - Intergenic
978766685 4:112412048-112412070 AGAAGACACTGAGGACGCGGGGG - Intronic
980988415 4:139717746-139717768 CTAGGACACGGAGGGAGGAGGGG + Exonic
981057035 4:140373784-140373806 CGAGGGCCTGGAGGGCGGGGCGG + Intronic
981094297 4:140762643-140762665 AGAAGACAGGGAGGGAGGGAGGG - Intergenic
981615295 4:146638654-146638676 AGAGGCGGCGGAGGGCGCGGTGG + Intergenic
981886471 4:149679363-149679385 AGAGGCCATGAAGGGCAGGGAGG + Intergenic
982546991 4:156746178-156746200 AGAGGACAGGGAGGTTGGGGAGG + Intergenic
982746119 4:159104610-159104632 AGAGGCCACGGAGGGCGGCTGGG - Intronic
984534774 4:180960663-180960685 AGGGGAGACGGGGGGTGGGGGGG - Intergenic
984777139 4:183491561-183491583 AGAGGAGACTGAGGAGGGGGTGG - Intergenic
984905354 4:184621086-184621108 GGAGGCCAAGGCGGGCGGGGTGG + Intergenic
984999658 4:185471210-185471232 GGAGGGCGGGGAGGGCGGGGCGG + Intronic
985054482 4:186024347-186024369 AGAGGACAGGTGGGGCGTGGTGG + Intergenic
985323040 4:188735387-188735409 AGTGGACACCGAGGCCGAGGAGG + Intergenic
985423616 4:189807378-189807400 AGAGGACACTGAGGCCGAGGAGG + Intergenic
985486347 5:153615-153637 AGAAGAAACAGAGGACGGGGTGG - Intronic
985531945 5:438939-438961 AGAGGGCATGGGGGGCAGGGTGG - Intergenic
985660568 5:1155086-1155108 AGGGGCCTGGGAGGGCGGGGCGG - Intergenic
985781112 5:1872342-1872364 CCAGGCCACGGGGGGCGGGGGGG - Intergenic
985890459 5:2711620-2711642 ACAGGACACGGAGGCGGAGGGGG - Intergenic
985973191 5:3393430-3393452 CGAGGACACGGTGGGGGGCGGGG - Intergenic
986183628 5:5416976-5416998 AGAGGGGAAGGAGGACGGGGAGG + Intergenic
986646582 5:9921925-9921947 AGAGCACACTGAAGGCTGGGAGG + Intergenic
988369294 5:30346030-30346052 GGAGCCCACGGGGGGCGGGGGGG - Intergenic
988377192 5:30452186-30452208 AGAGGACAGGTAGGGCGTGGTGG + Intergenic
988460179 5:31428265-31428287 AGAGGACAGGGAGGAGGTGGGGG + Intronic
989207088 5:38821767-38821789 AGCGGACGCGGAGGCCGAGGAGG - Intergenic
991330202 5:65485556-65485578 GGAGCCCACGGAGGCCGGGGGGG + Intergenic
992050289 5:72935109-72935131 AGTGGACACCGAGGCCGAGGAGG - Intergenic
992090628 5:73312887-73312909 AGAGGAGAAGGAGGGGGAGGAGG - Intergenic
992621854 5:78601748-78601770 AGAGGACTTGGAGGGTGGAGAGG + Intronic
992732865 5:79689994-79690016 GGAGGAGTCGGAGGGCGAGGAGG + Exonic
992907341 5:81359212-81359234 AGAGCACAATGAGGGAGGGGAGG - Intronic
993365500 5:87030065-87030087 AGAGGACCTGGGGGGAGGGGCGG - Intergenic
993975810 5:94479009-94479031 AGAGGAAACTAAGGGCAGGGAGG - Intronic
994166947 5:96618382-96618404 AGTGGACACCGAGGCCGAGGAGG - Intronic
994459396 5:100053287-100053309 AGAGGATACGTAGGGATGGGAGG + Intergenic
995157218 5:108930341-108930363 AGAGGAGAGGGGAGGCGGGGAGG - Intronic
995815006 5:116158161-116158183 AGGGGAGACGGAGGGAGAGGAGG - Intronic
996035132 5:118750364-118750386 GGAGGTCATGGAGGTCGGGGAGG + Intergenic
996693530 5:126367475-126367497 AGAGGAAAAGGAGGGAGAGGAGG + Intronic
997584094 5:135034447-135034469 CGAGGCCGCGGGGGGCGGGGAGG - Intronic
999506852 5:152207279-152207301 AGAGAAGACGCGGGGCGGGGGGG + Intergenic
999578592 5:153008740-153008762 AGAGGACACAGAGGTAGGTGAGG - Intergenic
1001582028 5:172805437-172805459 AGAAGATACGGAGGGAGGGAGGG + Intergenic
1001602796 5:172939896-172939918 GGAGCCCTCGGAGGGCGGGGTGG + Intronic
1001752443 5:174141966-174141988 AGAGGAGACTGAGGGATGGGAGG + Intronic
1002073132 5:176692525-176692547 AGAGGACAGGGATTGTGGGGAGG + Intergenic
1002096982 5:176837261-176837283 ACAGTACACAGAGGGAGGGGTGG - Intronic
1002098901 5:176847820-176847842 GGGGGACACGGGGGGAGGGGAGG - Intronic
1002102030 5:176862439-176862461 GGAGGACATGGAGGCCCGGGTGG + Intronic
1002461140 5:179374436-179374458 AGAGGACTCAGAGGGCGTTGGGG + Intergenic
1002461155 5:179374508-179374530 AGAGGGCACGGAGGACGTTGGGG + Intergenic
1002461171 5:179374580-179374602 AGAGGGCACGGAGGACGTCGGGG + Intergenic
1002461190 5:179374676-179374698 AGAGGGCACGGAGGACGTCGGGG + Intergenic
1002461210 5:179374772-179374794 AGAGGGCACGGAGGACGTTGGGG + Intergenic
1002540910 5:179906339-179906361 AGGGGACACGGAGAGTGAGGTGG + Intronic
1002888067 6:1312968-1312990 GGAGGGCGCGGAGGCCGGGGCGG + Exonic
1002912530 6:1501247-1501269 AGAGGCCAGGGAGGGTGGCGGGG + Intergenic
1003462392 6:6342069-6342091 TGAGGACACTGAGGCCAGGGAGG - Intergenic
1003856943 6:10286050-10286072 GGAGGAGAAGGAGGGAGGGGAGG + Intergenic
1005022572 6:21432141-21432163 AGGGGAGACGAAGGGAGGGGAGG + Intergenic
1005278179 6:24242498-24242520 GGAGGACACGGAGAGGTGGGGGG - Intronic
1006333933 6:33410914-33410936 GGAGGAGCCGGAGGGGGGGGCGG - Intronic
1006511023 6:34521233-34521255 AGAGGACAGGGAGGAGGTGGGGG + Intronic
1007247573 6:40473420-40473442 AGTGGAAACGGAGGCCTGGGGGG - Intronic
1008000200 6:46352399-46352421 AGAGGGGAAGGAGGACGGGGTGG - Intronic
1008076562 6:47151978-47152000 AGAGGAGAGGAAGGGAGGGGAGG + Intergenic
1008318920 6:50082656-50082678 AGAATGCACGGCGGGCGGGGGGG - Intergenic
1008612208 6:53195161-53195183 AGAGGACAGGAGGGGAGGGGAGG + Intergenic
1010871146 6:81041981-81042003 TGAGGATACGGAGGGCAGGGAGG + Intergenic
1011392251 6:86867281-86867303 AGAGCACCCAGAGGGAGGGGTGG + Intergenic
1011970093 6:93211509-93211531 AGAGGGGAGGGAGGGAGGGGTGG + Intergenic
1013694775 6:112689449-112689471 GGAGCCCACGGAGCGCGGGGAGG + Intergenic
1014802241 6:125790565-125790587 GGAGGTCGCGGGGGGCGGGGAGG + Intronic
1016330106 6:142945965-142945987 GGAGGAGAAGGAGGACGGGGAGG + Intergenic
1016698226 6:147022996-147023018 AGAGGACACTGAGGGCACCGAGG - Intergenic
1017041839 6:150314324-150314346 AGAGGAAAAGGAGGAGGGGGAGG + Intergenic
1017067967 6:150547718-150547740 AGAGGAAAGGGAGGGAGGAGGGG + Intergenic
1017656474 6:156634083-156634105 AGAGAACACGGAGGGCTGGTGGG + Intergenic
1018848941 6:167574036-167574058 AGAGGCCAGGGAGGCCAGGGGGG - Intergenic
1018962034 6:168456054-168456076 AGAGCCCAGGGAGGGCGGAGTGG + Intronic
1018966764 6:168495869-168495891 GGAGGCCAAGGAGGGCAGGGCGG - Intronic
1019279004 7:191028-191050 AGAGGCCAAGGAGGGTGAGGAGG - Intergenic
1019379413 7:713070-713092 AGAGGTCACGGAGGCCTAGGAGG + Exonic
1019415304 7:924246-924268 TGTGGACCTGGAGGGCGGGGAGG - Intronic
1019538648 7:1541573-1541595 AGAGGGCGCGGCGGGTGGGGAGG + Exonic
1019795147 7:3043544-3043566 AGATGACACGGTGGCGGGGGGGG - Intronic
1021924579 7:25521950-25521972 AGAGGAATCGGAGGGCAAGGAGG + Intergenic
1023605527 7:41927545-41927567 AGAGGACAAGGGTGGCGGGCTGG - Intergenic
1023654541 7:42406636-42406658 AGAGGGGGCGGAGGGCGGGATGG - Intergenic
1023710972 7:42992266-42992288 AGGGGACAGGGAGGGCACGGTGG - Intergenic
1023730289 7:43185138-43185160 AAAGGACAGGGATGGTGGGGGGG + Intronic
1023882454 7:44328043-44328065 AGATGACACGGGGGTTGGGGTGG - Intronic
1023955785 7:44885567-44885589 CGAGGCCGCGGAGGGCGGGACGG - Intergenic
1026767065 7:73166825-73166847 GGAGGAGAGGGAGGGGGGGGAGG - Intergenic
1027174169 7:75892876-75892898 AGAGGCCACCCAGGCCGGGGTGG + Intergenic
1027232556 7:76281399-76281421 ACAGGGCACGGAGGGGGGAGAGG - Intronic
1027433990 7:78144883-78144905 AGAGCACATGGGGGGCAGGGGGG - Intronic
1029270404 7:99374179-99374201 CGAGGACACGGAGGGCCAAGGGG + Intronic
1029367679 7:100127165-100127187 CGAGGACGCCGAGGGAGGGGCGG + Intronic
1029649969 7:101885009-101885031 AGAGGACATGCAGGGAGGGGAGG - Intronic
1030464743 7:109886590-109886612 AGAGGAAAAGGAAGGTGGGGAGG - Intergenic
1030593448 7:111508545-111508567 AGAGGGCACAGAGGGTGGGAGGG + Intronic
1030643391 7:112031431-112031453 AGAGAAGAGGGAGGGAGGGGAGG - Intronic
1032066569 7:128775798-128775820 AGAGGACTCAGAGGGGGGTGTGG - Intergenic
1032521001 7:132545139-132545161 AGAGGACACTGGGGGAGGGGTGG - Intronic
1034489883 7:151387481-151387503 ACAGGACAGGGAGAGCGGGGTGG + Intronic
1034491179 7:151393858-151393880 TAAGGACACGGAGGGAGGGCCGG + Intronic
1034535042 7:151721080-151721102 AGGGGACACAGAGGGCAGAGGGG + Intronic
1035018821 7:155788583-155788605 CGAGGGCAGGGAGGGCAGGGAGG + Intergenic
1035018825 7:155788592-155788614 GGAGGGCAGGGAGGGCAGGGAGG + Intergenic
1035018829 7:155788601-155788623 GGAGGGCAGGGAGGGCAGGGAGG + Intergenic
1035018833 7:155788610-155788632 GGAGGGCAGGGAGGGCAGGGAGG + Intergenic
1035018881 7:155788794-155788816 AGAGGACACGGGGGCTGGAGAGG - Intergenic
1035563754 8:627927-627949 AGAGAACACAGGGGCCGGGGGGG + Intronic
1035605229 8:926202-926224 AGAGCCCACGGAGGGAGTGGTGG - Intergenic
1035856352 8:2980395-2980417 AGAGGACAAGGAGGTGGAGGAGG - Intronic
1036784602 8:11677543-11677565 AGAGGACACCAAGGGCTGCGGGG - Intronic
1036928727 8:12931791-12931813 AGTGGACACCGAGGCCGAGGAGG + Intergenic
1037289465 8:17335926-17335948 AGAGGAGAGGGAGGGTGGGCCGG - Intronic
1037835831 8:22214228-22214250 AGAGGACAGGGAGGAAGAGGAGG + Intergenic
1038311516 8:26449371-26449393 AGAGGAGAAGGAGGGAGGGGCGG + Intronic
1040079796 8:43274983-43275005 AGAGGAGACGGAGGAAGGGAAGG - Intergenic
1040362238 8:46677249-46677271 AGAGGACATGTGGGGCGGTGAGG - Intergenic
1040560001 8:48515223-48515245 GGAGGACACGGAGGTGGGGGCGG - Intergenic
1040971403 8:53140502-53140524 AGAGGACATGGATGAGGGGGTGG + Intergenic
1041738884 8:61138574-61138596 AGGGGAGACGGGGGGCAGGGAGG + Intronic
1042554405 8:70022022-70022044 AGAGAGCACTGAGGGAGGGGAGG + Intergenic
1042937324 8:74073063-74073085 AGAGGAGACCGAGGGCAGGTAGG + Intergenic
1043011764 8:74889786-74889808 AGAGGACAGGGAAGATGGGGGGG - Intergenic
1043301859 8:78744213-78744235 AGAGGTCTCAGAGGGAGGGGTGG - Intronic
1043602063 8:81952595-81952617 AGAGGAGAGGGAGGGAGAGGAGG - Intergenic
1043998421 8:86847668-86847690 AGAGGAAAGGGAGGGAGGGAGGG + Intergenic
1045096148 8:98800458-98800480 AGTGGACACCGAGGCCGAGGAGG - Intronic
1045423883 8:102043711-102043733 AGGGGACAGGGAGGGGGAGGAGG + Intronic
1046260386 8:111759245-111759267 AGCGGACACTGAGGCCGAGGAGG + Intergenic
1046573274 8:115993326-115993348 AGAAGTCACAGAAGGCGGGGTGG + Intergenic
1048985984 8:139735206-139735228 AGAGGAAACGGAGGCCCAGGAGG - Intronic
1049273126 8:141706644-141706666 AAAGGACACGGAGGAGGGGCAGG + Intergenic
1049292565 8:141812399-141812421 GGAGGGCGGGGAGGGCGGGGAGG + Intergenic
1049362556 8:142219314-142219336 AGATGACGAGGAGGGAGGGGAGG + Intronic
1049501646 8:142970708-142970730 AGAGGAGACGGAGGGGTGGAGGG + Intergenic
1049847151 8:144808353-144808375 GGAGGACACAGAGGGCAGGCGGG + Exonic
1049899651 9:146886-146908 AGAGGACAGGCCGGGCGCGGTGG + Intronic
1050357741 9:4799008-4799030 AGAAGACAGGGAGGGAGGGAAGG - Intronic
1050537725 9:6645212-6645234 GGAGGCCGCGGAGGGCCGGGTGG + Intronic
1051520058 9:17976717-17976739 AGGGGGCAGGGAGGGAGGGGAGG - Intergenic
1052077322 9:24159230-24159252 AGAGGAGGTGGAGGGCTGGGGGG - Intergenic
1052289550 9:26826432-26826454 AGGGGACATGGATGACGGGGTGG - Intergenic
1052769695 9:32676264-32676286 AGAGGACCTGGAAGGCTGGGGGG + Intergenic
1053742700 9:41157172-41157194 AGAGGACAGGCTGGGCGCGGTGG + Intronic
1054454049 9:65420476-65420498 AGAAGAGAGGGAGGGAGGGGAGG + Intergenic
1054685642 9:68274127-68274149 AGAGGACAGGCTGGGCGCGGTGG - Intronic
1054724302 9:68634898-68634920 AGAGAACGTGGAGGGCTGGGAGG + Intergenic
1055381322 9:75710097-75710119 AGAGGAGAGGGAGGGAGGGAGGG - Intergenic
1056546885 9:87620678-87620700 AGAGGACAGGGAGGAGGAGGAGG + Intronic
1056897809 9:90567116-90567138 ACAGGACACGGCGGGCACGGTGG - Intergenic
1057040592 9:91844864-91844886 ATGGGACAGGGAAGGCGGGGCGG + Intronic
1059118293 9:111618244-111618266 AGAGGAGAGGGAGGGGGAGGGGG + Intergenic
1059499050 9:114735068-114735090 GGAGGCCAAGGGGGGCGGGGTGG + Intergenic
1060016914 9:120094667-120094689 AGGGGACACACAGGGCGGGGGGG + Intergenic
1060198918 9:121640556-121640578 AGAGGACATGGTGTGGGGGGAGG - Intronic
1060315662 9:122508088-122508110 AGAGGACAGAGAGGGAGGGAAGG + Intergenic
1060563321 9:124566819-124566841 AGAGGACAGGCCGGGCGCGGTGG + Intronic
1060916904 9:127397325-127397347 AGCGGACGCGGAGGGGCGGGAGG - Intronic
1061287667 9:129633363-129633385 AGGGAACATGGAGGGAGGGGAGG - Intronic
1061289276 9:129641681-129641703 GGCGGAGACGAAGGGCGGGGAGG - Intronic
1061418905 9:130462746-130462768 TGAGGACACTGAGGTGGGGGCGG - Intronic
1061942582 9:133891498-133891520 AGAGGAGAAGGATGGAGGGGAGG + Intronic
1062014197 9:134283082-134283104 AGAGGGCAAGGCGGGGGGGGAGG - Intergenic
1062033177 9:134371271-134371293 AAAGGACACAGAGGCCTGGGGGG - Intronic
1062192167 9:135253628-135253650 AGAGGAGCATGAGGGCGGGGAGG - Intergenic
1062194241 9:135264141-135264163 AGAGGACAGGGAGGGAGAGAGGG - Intergenic
1062236497 9:135512393-135512415 ACAGTACACTCAGGGCGGGGGGG + Intergenic
1062363532 9:136198468-136198490 AGTGGCCACCCAGGGCGGGGAGG + Intronic
1062511193 9:136907133-136907155 AAAGGACACAGAGGGAAGGGAGG - Intronic
1062523875 9:136970509-136970531 AGGGGAGACGGAGGGCTGTGGGG + Intronic
1062568344 9:137173076-137173098 ATGGGACACGGGGGGTGGGGGGG + Intergenic
1062675896 9:137743700-137743722 GGAGGGCAGGGAGGACGGGGTGG - Intronic
1062690198 9:137837634-137837656 AGAGGAGAAAGAGGGAGGGGAGG - Intronic
1185462779 X:340192-340214 GGAGGAGACGGGGGGGGGGGGGG + Intronic
1185603470 X:1354521-1354543 AGAGGAAAAGGAGGGGGAGGAGG + Intronic
1185642612 X:1596949-1596971 AGAGGACACAGCGGGAGGGACGG - Intronic
1185999194 X:4989237-4989259 GGAAGAGACGGAGGGAGGGGAGG - Intergenic
1186264563 X:7818540-7818562 GGAGGAGAAGGAGGGCGGGGAGG + Intergenic
1186430695 X:9501912-9501934 AGAAGGCGCGGAGGGCGGAGGGG - Intronic
1187195559 X:17080318-17080340 AGAGGACACGGGGGTCGGGGTGG - Intronic
1187327874 X:18308349-18308371 AAAGGACAGGGAGGGAGGGAGGG + Intronic
1188112032 X:26205036-26205058 GGAGCACACGGAGGCGGGGGAGG - Intergenic
1189008384 X:37018954-37018976 AGAGGACAAGGAGGAAGAGGAGG - Intergenic
1189040343 X:37536056-37536078 AGAGGACAAGGAGGAAGAGGAGG + Intronic
1190266549 X:48830667-48830689 AGAGGGCACTGAGGGTCGGGAGG - Intergenic
1190498650 X:51053634-51053656 AGAGGAGAGGGAAGGTGGGGAGG - Intergenic
1191053983 X:56223042-56223064 AGTGGGCACGGAGGCCAGGGAGG + Intergenic
1192723471 X:73724367-73724389 AGAGTACCCAGAGGGTGGGGTGG - Intergenic
1194422034 X:93687325-93687347 TGAGGACTCGGATGGAGGGGTGG + Intronic
1195334015 X:103831996-103832018 GGAGGACCCGGAAGGCCGGGAGG - Intronic
1195821339 X:108948093-108948115 AGAGGGGAAGGAGGGAGGGGAGG - Intergenic
1195909580 X:109875978-109876000 GGAGCCCACGGAGGGCGGGGAGG + Intergenic
1196782841 X:119399050-119399072 AGAGGAGAGGCAGGGAGGGGCGG + Exonic
1197261132 X:124319464-124319486 AGAGGCCAGGAAGGGCAGGGAGG + Intronic
1197767643 X:130069518-130069540 AGAGGCCACAGAGGCCGTGGAGG + Exonic
1198100006 X:133415186-133415208 AGGGGAGAAGGAGGGCGTGGAGG + Exonic
1199447697 X:147944979-147945001 AGAGGAGACGGACGGCGGCGTGG + Exonic
1199599803 X:149535215-149535237 AGAGGAAAAGGAGGAGGGGGTGG - Intergenic
1200058502 X:153473778-153473800 ACAGGACGGGGAGGGAGGGGAGG - Intronic
1200065465 X:153502418-153502440 AGAGAACAGGAAGGGCAGGGTGG - Intronic
1201743948 Y:17350870-17350892 AGTGGACATGGATGGAGGGGGGG + Intergenic