ID: 1132813670

View in Genome Browser
Species Human (GRCh38)
Location 16:1815574-1815596
Sequence GGTCACAGCAGAGCAACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132813670 Original CRISPR GGTCACAGCAGAGCAACAGC TGG Intronic
900698176 1:4025911-4025933 CTTCCCAGCAGAGGAACAGCCGG + Intergenic
901216328 1:7557457-7557479 TGTCACAGCTGGGGAACAGCTGG - Intronic
904865036 1:33571619-33571641 GGTCACAGATGAGCATCAGCTGG + Exonic
904942845 1:34177163-34177185 GGGGGCAGCAGAGCAGCAGCGGG + Intronic
905335058 1:37239313-37239335 GGTGACAGCTGAGCTAAAGCTGG - Intergenic
905915204 1:41679613-41679635 GGTGCCAGCAGAGCCACAGCTGG - Intronic
905916486 1:41688205-41688227 GGTCAGAGGAGAACAACAGAAGG - Intronic
905916491 1:41688228-41688250 GGCCAGAGGAGAGCAACAGAAGG - Intronic
906709856 1:47921211-47921233 GGTCACGGTAGACCAACTGCTGG + Intronic
907630940 1:56081157-56081179 AGTTACAGCAGAGAAAAAGCAGG - Intergenic
907859243 1:58335402-58335424 GTTCTGAGCAAAGCAACAGCAGG + Intronic
908404136 1:63797340-63797362 GGGCACAGCAGAAAAAAAGCTGG - Intronic
912418921 1:109530492-109530514 TGTCACAGCTGGGGAACAGCTGG - Intergenic
913359175 1:117960658-117960680 GCTCACTGCATAGCAACAGGAGG + Exonic
914672850 1:149885083-149885105 AGTCACCTCAGTGCAACAGCTGG - Exonic
915834933 1:159169217-159169239 GATCACTGCAGAGCAGCAGATGG + Intergenic
916175087 1:162031409-162031431 GGTCACAGCAGAGGGAGAGAGGG + Intergenic
916521176 1:165564671-165564693 GGTAAGAGCAGAGCAACTGCTGG + Intergenic
918506543 1:185261086-185261108 GGTGACAGCAGCACAAGAGCAGG - Intronic
920960801 1:210662515-210662537 GGTTAAAGAAGAGAAACAGCTGG + Intronic
922608179 1:226904167-226904189 GGTAAAAGCAGAGCAGCAGCTGG - Intronic
923165907 1:231361480-231361502 GGTTACAGCATAGGAACAGAAGG + Intergenic
1062814880 10:492077-492099 CATCAGAGCAGAGCAACAACTGG - Intronic
1062834003 10:624224-624246 GGTGACAGCAAAGCTTCAGCTGG - Intronic
1062885975 10:1016202-1016224 GGCCACAGCTGAGCACCAGGAGG + Intronic
1063253016 10:4294829-4294851 GGGGAGAGCAGTGCAACAGCTGG + Intergenic
1064667961 10:17676666-17676688 GGACATAACAGAGGAACAGCAGG - Intronic
1065777589 10:29135460-29135482 GGTCACAACAGATAAACAGGAGG + Intergenic
1070087765 10:73253222-73253244 GATCACAGCACGGCAAAAGCAGG - Intergenic
1070130628 10:73653249-73653271 GGTAACAGCAGAGCCTCAGCTGG + Exonic
1074517324 10:114182209-114182231 GGTCACAGGGCAGCAACAGCTGG + Intronic
1074971761 10:118544786-118544808 GGTCACTGCTGAGCAACCTCTGG - Intergenic
1075452707 10:122563227-122563249 GGTCACAGAGGATCCACAGCAGG - Intronic
1075644262 10:124087232-124087254 GGACACAGAAAAGCAAAAGCAGG + Intronic
1077137253 11:1006901-1006923 CGTCACAGGAGAGTAAGAGCAGG - Intronic
1081335426 11:41859821-41859843 GGTCACAGGCCAGCGACAGCAGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082804583 11:57439633-57439655 AGGGACAGCAGAGCATCAGCAGG + Intergenic
1083840935 11:65303973-65303995 GGACACTGCAGAGCATCAGATGG + Intronic
1084562421 11:69912268-69912290 GGCCCCAGCAGGGCCACAGCAGG - Intergenic
1085456349 11:76667585-76667607 GGTGAGAGCAGAGCAGCTGCAGG - Intronic
1085803354 11:79611812-79611834 GGGCACAGAAGAGCAGCAGCTGG + Intergenic
1088031906 11:105261881-105261903 AGTCAGAACAAAGCAACAGCTGG + Intergenic
1088561629 11:111121520-111121542 GGTCACATCACAGCCTCAGCAGG + Intergenic
1088814855 11:113413847-113413869 GGACGCAGCAGAGCAGCTGCGGG - Intronic
1089353278 11:117833518-117833540 GGCCCCATCAGATCAACAGCTGG + Intronic
1089576576 11:119448549-119448571 GGTCACAGTAGAGCCAAGGCCGG + Intergenic
1091542020 12:1470560-1470582 GGACCCATCAGAGCAGCAGCAGG - Intronic
1092973748 12:13724219-13724241 GGTCATAGCACAACTACAGCTGG + Intronic
1096206356 12:49725468-49725490 GGGCACAGCAGGGTATCAGCTGG + Intronic
1097791344 12:63818459-63818481 GGTAACAGCACAGCCACAGCTGG + Intergenic
1099036044 12:77588952-77588974 GGACACAGCAGAGCTATACCTGG + Intergenic
1101604690 12:106239377-106239399 CGTCACCGTAGAGCACCAGCTGG + Exonic
1102730725 12:115106529-115106551 GGGAACAGAAGTGCAACAGCAGG - Intergenic
1104850001 12:131868293-131868315 GGCCACAGCAGGGCCACAGCAGG + Intergenic
1104884679 12:132099888-132099910 GGGCACAACAGAGCTGCAGCAGG - Intronic
1108636602 13:52341436-52341458 AGTCACTGCAGGGCAAGAGCTGG + Intergenic
1108651451 13:52484119-52484141 AGTCACTGCAGGGCAAGAGCTGG - Intergenic
1110820399 13:79908836-79908858 CTTCATAGCAGAGCAACAGGAGG + Intergenic
1110872459 13:80468340-80468362 GGTCACAGCAGAACAAGGGGAGG - Intergenic
1112143777 13:96675025-96675047 GAGCACAGCACAGCAAAAGCTGG - Intronic
1113935215 13:113990334-113990356 GTTCCCAGCAGAGGAAGAGCTGG + Intronic
1114014010 14:18408092-18408114 GGCCACAGTAGAGGCACAGCTGG - Intergenic
1116802090 14:49453709-49453731 GGCCACATCAGAGCAACTCCAGG + Intergenic
1117962574 14:61177851-61177873 GCTCACTGAAGAGCAGCAGCAGG - Intergenic
1119547465 14:75482677-75482699 GGGCCCACCTGAGCAACAGCTGG + Intergenic
1120303983 14:82744479-82744501 GGTGACAGGAGAAAAACAGCTGG + Intergenic
1121536618 14:94695435-94695457 GGACACAGTAGCGCAGCAGCGGG - Intergenic
1121611256 14:95282446-95282468 GGTCAGATCAGAGCAATATCAGG + Intronic
1121811065 14:96890855-96890877 TGTCTTAGCAAAGCAACAGCTGG + Intronic
1124884601 15:33673271-33673293 GCTCACAGCAGAGGGACTGCGGG - Intronic
1125095243 15:35842849-35842871 GGTCACAGTAGAGAAGCAGCAGG + Intergenic
1127996892 15:64158393-64158415 AGCCCCAGCAGAGCAACAGCGGG + Intronic
1128350757 15:66886905-66886927 AGTCAGAGCAGAGCACCAGGAGG - Intergenic
1128689006 15:69709024-69709046 CTCCACAGGAGAGCAACAGCAGG - Intergenic
1128887504 15:71302410-71302432 GGACACAGCAGAGCAGCAGCAGG + Intronic
1130560915 15:84958294-84958316 GGTGACAGCTGAGCAGCAGCAGG - Intergenic
1130849080 15:87776507-87776529 GGCCACAGCAGGGTCACAGCAGG + Intergenic
1131153287 15:90060033-90060055 GGACCCAACAGAGCAAGAGCGGG - Intronic
1132600218 16:769767-769789 GGTCCCAGGAGAGCAGCCGCAGG - Intronic
1132813670 16:1815574-1815596 GGTCACAGCAGAGCAACAGCTGG + Intronic
1133272421 16:4616703-4616725 GGCGACAGAAGAGCAATAGCCGG + Intronic
1134193919 16:12143751-12143773 AGTTACATCTGAGCAACAGCAGG - Intronic
1134562923 16:15226356-15226378 CATCACAGCAGAGCTACAGTGGG + Intergenic
1134923460 16:18137989-18138011 CATCACAGCAGAGCTACAGTGGG + Intergenic
1135938201 16:26798736-26798758 GTTCACAGCAGAACAACAAGAGG + Intergenic
1137933759 16:52613673-52613695 GGTCATAGCTGAGCTTCAGCAGG - Intergenic
1141289888 16:82708030-82708052 GGTGACGTCTGAGCAACAGCTGG - Intronic
1141657370 16:85423354-85423376 GGCCACGGCAGAGCAGCAGCTGG - Intergenic
1142149227 16:88505416-88505438 GGACACAGCCGTTCAACAGCCGG + Intronic
1142236777 16:88926158-88926180 GGGCAGAGCAGAGCCGCAGCCGG + Intronic
1142282290 16:89154862-89154884 GGTCACGGCAGAGCAGCTCCGGG - Exonic
1143093960 17:4466888-4466910 GTTCTCTGGAGAGCAACAGCAGG + Intronic
1143583859 17:7841857-7841879 AGTCACAGCGGAGCCTCAGCCGG + Intronic
1144671159 17:17133380-17133402 GGGCACTGCAGAGGAGCAGCAGG + Intronic
1144891311 17:18495900-18495922 GGCCACAGCAGGGCCAGAGCTGG + Intergenic
1145140912 17:20448417-20448439 GGCCACAGCAGGGCCAGAGCTGG - Intergenic
1146722168 17:35131174-35131196 GAGCACAGCAGACAAACAGCTGG + Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1151163575 17:72185786-72185808 GATTACAGCAGAGCAGCAGCAGG + Intergenic
1151524621 17:74656028-74656050 GGTCACAGCAGATAAAAACCAGG + Intergenic
1151701232 17:75743641-75743663 GGTCACAGGAGAGCAGGAGGTGG + Intronic
1152097045 17:78278443-78278465 GGTCCCAGCAGAGCTGCTGCTGG - Intergenic
1152149237 17:78588759-78588781 GTTCCCAGCAGAGGAACAGGAGG + Intergenic
1152218186 17:79046612-79046634 GGTCACAGCAGCGCAAGCACCGG - Exonic
1152647648 17:81477171-81477193 GGTCCCAGCAGAACGAGAGCAGG - Intergenic
1155700936 18:28742612-28742634 TCTCACAGCAGAGCTAGAGCTGG - Intergenic
1156389867 18:36640217-36640239 GGAAACATCAGAGCAACAGCTGG + Intronic
1157313150 18:46567334-46567356 GGACTCAGAAGAGCAAGAGCAGG - Intronic
1158732857 18:60044916-60044938 GGACACAGGGGAGCAGCAGCAGG + Intergenic
1160508732 18:79441557-79441579 GGTCACAGCCCACCCACAGCCGG - Intronic
1160665512 19:326234-326256 GGACACAGCAGAGCCACGGTTGG + Intronic
1160665530 19:326306-326328 GGACACGGCAGAGCCACGGCCGG + Intronic
1160665541 19:326342-326364 GGACACGGCAGAGCCACGGCCGG + Intronic
1160665552 19:326378-326400 GGACACGGCAGAGCCACGGCCGG + Intronic
1160735766 19:661749-661771 GGTCAAAGCGTAGCAACAGCCGG + Intronic
1160825118 19:1076237-1076259 GTTCACAGAAGAGGAAAAGCAGG - Intronic
1162063039 19:8108291-8108313 GGAAACAGGGGAGCAACAGCAGG + Intronic
1163764158 19:19153122-19153144 GGTCCCACGAGAGCAGCAGCAGG + Intronic
1167455513 19:49595383-49595405 GGTCCCAGCGGAGCCACGGCTGG + Exonic
1167620322 19:50556762-50556784 GGTGCCAGCAGAGGAACTGCCGG - Intronic
1167788392 19:51654933-51654955 GGTGACAGCAGACATACAGCCGG + Intergenic
925015018 2:516682-516704 GTTTAGAGCAGACCAACAGCAGG + Intergenic
925170574 2:1747793-1747815 TGCCACAGCAGAGCATCAACTGG + Intergenic
926761373 2:16281668-16281690 GCTCACAGTAGAGAAACATCAGG - Intergenic
927517939 2:23682826-23682848 AGTCACAGCAGAGCATCTCCAGG - Intronic
927997146 2:27494565-27494587 GGTCACAGCTGACCAGCAGGAGG + Exonic
928022875 2:27717147-27717169 GTTTTCAGGAGAGCAACAGCTGG - Intergenic
928272383 2:29868067-29868089 GGCTACAGCAGAGCAAAGGCTGG + Intronic
928274664 2:29889581-29889603 AGTGACAGCAGAGAGACAGCAGG + Intronic
932594469 2:73085660-73085682 GGCCACATCAGAGGAACAGCAGG + Intronic
932606161 2:73167008-73167030 GGACAGAGCAGGGCAACGGCAGG + Intergenic
933155408 2:78967587-78967609 GCTCACGGAAGAGCAAGAGCTGG + Intergenic
933518083 2:83331481-83331503 GGACAGAGCAGAACAAAAGCTGG - Intergenic
933926267 2:87093443-87093465 GGACAGAGCAGGGCAACGGCAGG - Intergenic
934854011 2:97717949-97717971 GATCACAGCAGAGCAGCCACGGG - Intronic
936016339 2:108961785-108961807 GGTCACGAGAGAGCAGCAGCAGG - Intronic
936373248 2:111920277-111920299 GGTCACAGCCCAGCCACAGGAGG - Intronic
941994786 2:171592094-171592116 GCTCACACAAGAGCAACAGGCGG - Intergenic
944617969 2:201482358-201482380 CGTCACAGCAGATGAGCAGCAGG - Intergenic
948025663 2:234774147-234774169 GGTCCCAGCAGAGCAGCAGGTGG - Intergenic
948457607 2:238114105-238114127 GGCCACAGCAGTGGAAAAGCAGG - Intronic
1170285416 20:14703286-14703308 GAACATAGAAGAGCAACAGCTGG + Intronic
1170859276 20:20087787-20087809 GGTCACAGCTGGGCAGAAGCAGG + Intronic
1171190414 20:23155178-23155200 GGTTACTGCACAGCAAAAGCCGG - Intergenic
1172638054 20:36423137-36423159 GGTCACAGCAAATAAATAGCAGG + Intronic
1174357439 20:50008089-50008111 GGTCACAGCAATGTACCAGCAGG + Intergenic
1174521700 20:51136230-51136252 GGGAACAGCAGAGAAACAGGTGG - Intergenic
1175815473 20:61881143-61881165 GGTCACAGCAGAGCAGGGTCAGG + Intronic
1178914909 21:36700751-36700773 GGTCTCAGCTCAGCAACGGCGGG - Intronic
1178938865 21:36888150-36888172 CCTCACAGTAGAGAAACAGCCGG - Intronic
1178946198 21:36949770-36949792 GCTCAAAGCAGAGTCACAGCTGG + Intronic
1179890684 21:44333764-44333786 CGTCAGAGAAGAGAAACAGCAGG + Intronic
1180438509 22:15338898-15338920 GGCCACAGTAGAGGCACAGCTGG - Intergenic
1180718498 22:17888983-17889005 GGCCACAGCACAGCAGCAGGGGG + Intronic
1180954757 22:19736720-19736742 GGTCCCATCAGGGCCACAGCTGG + Intergenic
1180965908 22:19787863-19787885 GGGCACAACACAGCAAGAGCAGG - Exonic
1181138682 22:20787634-20787656 GGTCACAGGGAGGCAACAGCAGG - Exonic
1181461121 22:23086553-23086575 AAGCACAGCAGAGCCACAGCTGG + Intronic
1182955035 22:34416211-34416233 TGTCACAGCAGCAGAACAGCAGG - Intergenic
1184768101 22:46582451-46582473 AGTGACAGCAGAGGCACAGCTGG - Intronic
1184960076 22:47922243-47922265 TGGCACAGTAGAGCAGCAGCTGG - Intergenic
1185318533 22:50189703-50189725 GGTCCCAGCAGAGCATCACCTGG - Intronic
1185318549 22:50189761-50189783 GGTCCCAGCAGAGCATCACCTGG - Intronic
1185318565 22:50189819-50189841 GGTCCCAGCAGAGCATCACCTGG - Intronic
949873803 3:8611060-8611082 GGTCCCAGCACAGCAGCTGCTGG - Intergenic
951032231 3:17895399-17895421 GGTAACAGCACAGCCACAGTGGG - Intronic
954785866 3:53092052-53092074 GCTCACAGCAGAGGAATACCTGG + Exonic
955002410 3:54939533-54939555 GGCCACAGCAGACAGACAGCAGG - Intronic
957931021 3:86878482-86878504 TGTCACAGCAGAGCAGGAGAAGG - Intergenic
958262402 3:91397029-91397051 GGTCACAGCAAGGCAGCAGCAGG - Intergenic
958764806 3:98354065-98354087 GGTAACAGCACAGGAACAGCAGG - Exonic
958767762 3:98390877-98390899 AGTAATAGCAGAGGAACAGCAGG - Exonic
960939269 3:122922809-122922831 GGACACAGGAGAGGGACAGCAGG - Intronic
961591422 3:127984523-127984545 GGCCACAGGAGAGCAGCAGAGGG + Exonic
961994892 3:131232079-131232101 TATCACAGCAGAGAAACAGTTGG - Intronic
963287246 3:143445012-143445034 GATCACAGCAGAGGAAAACCGGG - Intronic
970667472 4:18354064-18354086 GGTACCAGCACAGCAACAGGTGG - Intergenic
971519696 4:27533145-27533167 GGTCACAGCCAAGCAAAAGAAGG - Intergenic
971543403 4:27851711-27851733 GGTCACAGCTCAGCATCAGAGGG + Intergenic
973705145 4:53573645-53573667 GGTCACAGCGCTGCAACACCTGG + Exonic
973843679 4:54889194-54889216 GACCACACCAGACCAACAGCAGG + Intergenic
980615312 4:135213535-135213557 GGTCACATCAAAACAAAAGCAGG - Intergenic
981895604 4:149795724-149795746 GATAACAGCTCAGCAACAGCAGG + Intergenic
982209205 4:153021243-153021265 GGGCACAGCAGAGCCAGAGCAGG + Intergenic
984682342 4:182624544-182624566 GGTAACAGCAGAGGAGCAACAGG - Intronic
986199918 5:5571023-5571045 GGTCACGCCTGAGCCACAGCTGG + Intergenic
988579648 5:32458020-32458042 GGTGACAGGAGAGAGACAGCAGG + Intergenic
988959440 5:36355011-36355033 AGGCACAGAACAGCAACAGCAGG - Intergenic
989434170 5:41391704-41391726 GGTGCCAGCAGAGCCACAGTGGG + Intronic
992172512 5:74118198-74118220 AGTTACAGCAGAGCAGCAGTTGG + Intergenic
992681278 5:79155841-79155863 GCTGAAAGCAAAGCAACAGCTGG + Intronic
993648319 5:90486576-90486598 GGTTCCAGCAGAGAACCAGCAGG - Intronic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
995572163 5:113491782-113491804 GGACACACTAGAGCAACAGTTGG - Intergenic
996545210 5:124670803-124670825 AGTGACAGCAGAGCAACCACTGG + Intronic
996827634 5:127703347-127703369 AGGGACAGCAGAGCAATAGCAGG + Intergenic
996881422 5:128300890-128300912 GGTACCAGGAGAGCAAGAGCCGG + Exonic
997697299 5:135871756-135871778 GGCCACAGCAGTGGGACAGCTGG + Intronic
999802477 5:155050833-155050855 GGACACAGCAGAGGAAAGGCAGG - Intergenic
1001268115 5:170289913-170289935 CGTCTCAGCAGAGCAGAAGCTGG - Intronic
1001568081 5:172713364-172713386 GGTCACAGCTGAGAAGCTGCCGG - Intergenic
1002071676 5:176682214-176682236 GGTCAGAGCTGGGCTACAGCAGG - Intergenic
1002096812 5:176836200-176836222 GGGCCCAGGAGGGCAACAGCAGG + Intronic
1002358219 5:178648294-178648316 GGTCACAGCAGAGCAAGAACAGG + Intergenic
1002512159 5:179727768-179727790 GGTGACAGGAGAGGAACAGAGGG + Intronic
1004548700 6:16625658-16625680 GGTCCCAGCAGAGAAACAGATGG + Intronic
1004938306 6:20529482-20529504 GGTAACAGCAGAGGAATAGAGGG - Intergenic
1005417890 6:25621019-25621041 TATGACAGCAGAGCTACAGCTGG - Intergenic
1006005360 6:30997659-30997681 GGTCACAGAAGTGCAAGAGTAGG + Intergenic
1006581972 6:35082488-35082510 AGCCACAGCAGAGGCACAGCAGG - Intronic
1006815101 6:36844782-36844804 GGGCACAGAAGAGCAGAAGCGGG + Intergenic
1007071323 6:39040433-39040455 GGTCAGACCAGAACAACAGAGGG + Intergenic
1008881246 6:56382690-56382712 GGTCACTGCAAAAAAACAGCTGG + Intronic
1008993015 6:57625848-57625870 GGTCACAGCAAGGCAGCAGCAGG + Intronic
1009181629 6:60524953-60524975 GGTCACAGCAAGTCAGCAGCAGG + Intergenic
1010541264 6:77094838-77094860 GTTCACAGCACAGGAACAGGAGG - Intergenic
1012382314 6:98634763-98634785 GGGCACAGCAGAGGAGCAGAGGG - Intergenic
1012691479 6:102318753-102318775 GGTCCCAGAAGAACAAAAGCTGG - Intergenic
1017243441 6:152196269-152196291 GGTACCAGCATAGCAACAACAGG - Intronic
1018206952 6:161445287-161445309 GGTCAGTGCCGAGCACCAGCAGG - Intronic
1019506363 7:1393460-1393482 GGACACAGCATGGCCACAGCGGG + Intergenic
1019514485 7:1433734-1433756 GGTCCCAGCAGGGCCAGAGCAGG - Intronic
1019574782 7:1732128-1732150 GGTCACAGCGGAGCAAGCACAGG + Intronic
1019851017 7:3557447-3557469 GGTCACAAAAGAGCAAGACCAGG + Intronic
1020693030 7:11381637-11381659 TGCCATAGCATAGCAACAGCAGG - Intronic
1021397307 7:20166249-20166271 GGTGACAGGAGAGCAACTGTTGG + Intronic
1022874170 7:34511683-34511705 TCTCACAGCAGAGCAACCTCGGG + Intergenic
1023583803 7:41708161-41708183 CCTCACAGGAGAGCAACACCTGG - Intergenic
1026979118 7:74516346-74516368 GTTCAGAGCCCAGCAACAGCAGG + Intronic
1027807043 7:82840215-82840237 GGAAATAGCAGAGAAACAGCCGG + Intronic
1031129316 7:117813209-117813231 GGTCCCAGCAGTGCAAAAGGGGG - Intronic
1033430965 7:141289240-141289262 GATGACAGCAGAGCCAGAGCTGG - Intronic
1033551192 7:142449825-142449847 AGTCACAGCAAAGGAACACCTGG - Intergenic
1034328798 7:150264152-150264174 GGTCACAACCCAGCAACAGGCGG + Intronic
1034669250 7:152845599-152845621 GGTCACAACCCAGCAACAGGCGG - Intronic
1034987164 7:155523515-155523537 GGTCACTGCTGAGCAGCTGCAGG - Intronic
1035262039 7:157668106-157668128 GGGCACAGCAGAGGAGCAGGCGG - Intronic
1037007738 8:13803500-13803522 GGACAAAGAAAAGCAACAGCAGG - Intergenic
1037635873 8:20700775-20700797 GGTCACTGCAGACCCACAGAGGG + Intergenic
1041099229 8:54379734-54379756 GGTCACCGGAGAGCATCAGTGGG + Intergenic
1042748340 8:72131843-72131865 GGTCACAGCAAAACAACAAAGGG - Intergenic
1047931008 8:129728295-129728317 GGTCACTGCACAGAAACAGTGGG - Intergenic
1047956656 8:129981729-129981751 GATCACAGCAGAGCAGGACCAGG + Intronic
1048049794 8:130806196-130806218 GGCAAAAGCAGAGCAAGAGCTGG - Intronic
1048579703 8:135720716-135720738 TCTCACAGCAGAGCAGGAGCAGG - Intergenic
1049388025 8:142354047-142354069 GCTGACAGCAGAGCAGGAGCGGG + Intronic
1051262729 9:15280619-15280641 GGTCTCAGCTAAGCAAAAGCGGG - Intronic
1051721167 9:20039182-20039204 GGTCACAGAAGAGACACACCAGG - Intergenic
1054812485 9:69446080-69446102 GGCCACTGCAGAGCAGCATCTGG - Intronic
1055147128 9:72949283-72949305 GGGAACAGCTGAGCAGCAGCTGG + Intronic
1055715120 9:79109010-79109032 GGTCACATCAGTGCAAGAGGTGG - Intergenic
1055977461 9:81968981-81969003 AGGCACAGCAGAGCAGCTGCAGG + Intergenic
1056811484 9:89768475-89768497 GGTCCAATCAGAGCAAAAGCAGG + Intergenic
1057229917 9:93315040-93315062 GGTCCCATCAGAGCAAAAGTGGG - Intronic
1057798200 9:98172968-98172990 TGTCACAGCAGAGCATCTGAGGG + Intronic
1057810389 9:98252830-98252852 GGCCACATGAGAACAACAGCGGG + Intronic
1059078112 9:111216790-111216812 GGTCACAGCAGAGAGACTTCTGG - Intergenic
1060113901 9:120926222-120926244 CGTCACAGCTGAGTCACAGCAGG + Exonic
1061390949 9:130316753-130316775 GGTCACAGCAGAGGGTCACCTGG + Intronic
1061478844 9:130886422-130886444 CGTCACAAGAGAGCAAGAGCTGG - Intronic
1061627512 9:131849744-131849766 GGTCACCGCTGAGGACCAGCAGG + Intergenic
1061848096 9:133399433-133399455 GGTCACAGCTGAGCTACAAAAGG - Intronic
1062637024 9:137496980-137497002 GATCACAGCAAAGCAGCCGCGGG + Intronic
1186626941 X:11304556-11304578 GGTAACAGGAGAGCAACACCAGG + Intronic
1187497850 X:19811817-19811839 GTTCACAGCACAGCCACAACTGG + Intronic
1189197239 X:39162593-39162615 GGTCCCAGCAGAGCCACAGACGG + Intergenic
1196466143 X:115973249-115973271 GATAACAGCTCAGCAACAGCAGG + Intergenic
1199848625 X:151709462-151709484 GGTCACAGTTGAGGAAGAGCAGG + Intergenic