ID: 1132826143

View in Genome Browser
Species Human (GRCh38)
Location 16:1906649-1906671
Sequence TTCGTGTCCTCAGGGGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132826143_1132826155 14 Left 1132826143 16:1906649-1906671 CCGAGAGCCCCTGAGGACACGAA No data
Right 1132826155 16:1906686-1906708 CAGGAGTGGGGACTTCCTGCAGG No data
1132826143_1132826156 15 Left 1132826143 16:1906649-1906671 CCGAGAGCCCCTGAGGACACGAA No data
Right 1132826156 16:1906687-1906709 AGGAGTGGGGACTTCCTGCAGGG No data
1132826143_1132826151 0 Left 1132826143 16:1906649-1906671 CCGAGAGCCCCTGAGGACACGAA No data
Right 1132826151 16:1906672-1906694 AGGAGTCTGGGCCTCAGGAGTGG No data
1132826143_1132826159 28 Left 1132826143 16:1906649-1906671 CCGAGAGCCCCTGAGGACACGAA No data
Right 1132826159 16:1906700-1906722 TCCTGCAGGGGCGCTGGCGCTGG No data
1132826143_1132826150 -5 Left 1132826143 16:1906649-1906671 CCGAGAGCCCCTGAGGACACGAA No data
Right 1132826150 16:1906667-1906689 ACGAAAGGAGTCTGGGCCTCAGG No data
1132826143_1132826153 2 Left 1132826143 16:1906649-1906671 CCGAGAGCCCCTGAGGACACGAA No data
Right 1132826153 16:1906674-1906696 GAGTCTGGGCCTCAGGAGTGGGG No data
1132826143_1132826157 16 Left 1132826143 16:1906649-1906671 CCGAGAGCCCCTGAGGACACGAA No data
Right 1132826157 16:1906688-1906710 GGAGTGGGGACTTCCTGCAGGGG No data
1132826143_1132826152 1 Left 1132826143 16:1906649-1906671 CCGAGAGCCCCTGAGGACACGAA No data
Right 1132826152 16:1906673-1906695 GGAGTCTGGGCCTCAGGAGTGGG No data
1132826143_1132826158 22 Left 1132826143 16:1906649-1906671 CCGAGAGCCCCTGAGGACACGAA No data
Right 1132826158 16:1906694-1906716 GGGACTTCCTGCAGGGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132826143 Original CRISPR TTCGTGTCCTCAGGGGCTCT CGG (reversed) Intergenic