ID: 1132826150

View in Genome Browser
Species Human (GRCh38)
Location 16:1906667-1906689
Sequence ACGAAAGGAGTCTGGGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132826143_1132826150 -5 Left 1132826143 16:1906649-1906671 CCGAGAGCCCCTGAGGACACGAA No data
Right 1132826150 16:1906667-1906689 ACGAAAGGAGTCTGGGCCTCAGG No data
1132826142_1132826150 -4 Left 1132826142 16:1906648-1906670 CCCGAGAGCCCCTGAGGACACGA No data
Right 1132826150 16:1906667-1906689 ACGAAAGGAGTCTGGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132826150 Original CRISPR ACGAAAGGAGTCTGGGCCTC AGG Intergenic