ID: 1132826153

View in Genome Browser
Species Human (GRCh38)
Location 16:1906674-1906696
Sequence GAGTCTGGGCCTCAGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132826146_1132826153 -6 Left 1132826146 16:1906657-1906679 CCCTGAGGACACGAAAGGAGTCT No data
Right 1132826153 16:1906674-1906696 GAGTCTGGGCCTCAGGAGTGGGG No data
1132826145_1132826153 -5 Left 1132826145 16:1906656-1906678 CCCCTGAGGACACGAAAGGAGTC No data
Right 1132826153 16:1906674-1906696 GAGTCTGGGCCTCAGGAGTGGGG No data
1132826143_1132826153 2 Left 1132826143 16:1906649-1906671 CCGAGAGCCCCTGAGGACACGAA No data
Right 1132826153 16:1906674-1906696 GAGTCTGGGCCTCAGGAGTGGGG No data
1132826147_1132826153 -7 Left 1132826147 16:1906658-1906680 CCTGAGGACACGAAAGGAGTCTG No data
Right 1132826153 16:1906674-1906696 GAGTCTGGGCCTCAGGAGTGGGG No data
1132826142_1132826153 3 Left 1132826142 16:1906648-1906670 CCCGAGAGCCCCTGAGGACACGA No data
Right 1132826153 16:1906674-1906696 GAGTCTGGGCCTCAGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132826153 Original CRISPR GAGTCTGGGCCTCAGGAGTG GGG Intergenic