ID: 1132826158

View in Genome Browser
Species Human (GRCh38)
Location 16:1906694-1906716
Sequence GGGACTTCCTGCAGGGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132826145_1132826158 15 Left 1132826145 16:1906656-1906678 CCCCTGAGGACACGAAAGGAGTC No data
Right 1132826158 16:1906694-1906716 GGGACTTCCTGCAGGGGCGCTGG No data
1132826146_1132826158 14 Left 1132826146 16:1906657-1906679 CCCTGAGGACACGAAAGGAGTCT No data
Right 1132826158 16:1906694-1906716 GGGACTTCCTGCAGGGGCGCTGG No data
1132826147_1132826158 13 Left 1132826147 16:1906658-1906680 CCTGAGGACACGAAAGGAGTCTG No data
Right 1132826158 16:1906694-1906716 GGGACTTCCTGCAGGGGCGCTGG No data
1132826143_1132826158 22 Left 1132826143 16:1906649-1906671 CCGAGAGCCCCTGAGGACACGAA No data
Right 1132826158 16:1906694-1906716 GGGACTTCCTGCAGGGGCGCTGG No data
1132826142_1132826158 23 Left 1132826142 16:1906648-1906670 CCCGAGAGCCCCTGAGGACACGA No data
Right 1132826158 16:1906694-1906716 GGGACTTCCTGCAGGGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132826158 Original CRISPR GGGACTTCCTGCAGGGGCGC TGG Intergenic