ID: 1132826688

View in Genome Browser
Species Human (GRCh38)
Location 16:1908761-1908783
Sequence CGTGGCCTGTCCAACCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132826688_1132826695 -5 Left 1132826688 16:1908761-1908783 CCCATGAGGTTGGACAGGCCACG No data
Right 1132826695 16:1908779-1908801 CCACGGCAGGTGGAAGGAGCTGG No data
1132826688_1132826700 22 Left 1132826688 16:1908761-1908783 CCCATGAGGTTGGACAGGCCACG No data
Right 1132826700 16:1908806-1908828 TGCCAGTGTGGTGGGCGTGCTGG No data
1132826688_1132826698 13 Left 1132826688 16:1908761-1908783 CCCATGAGGTTGGACAGGCCACG No data
Right 1132826698 16:1908797-1908819 GCTGGCAGGTGCCAGTGTGGTGG No data
1132826688_1132826699 14 Left 1132826688 16:1908761-1908783 CCCATGAGGTTGGACAGGCCACG No data
Right 1132826699 16:1908798-1908820 CTGGCAGGTGCCAGTGTGGTGGG No data
1132826688_1132826697 10 Left 1132826688 16:1908761-1908783 CCCATGAGGTTGGACAGGCCACG No data
Right 1132826697 16:1908794-1908816 GGAGCTGGCAGGTGCCAGTGTGG No data
1132826688_1132826696 -1 Left 1132826688 16:1908761-1908783 CCCATGAGGTTGGACAGGCCACG No data
Right 1132826696 16:1908783-1908805 GGCAGGTGGAAGGAGCTGGCAGG No data
1132826688_1132826702 29 Left 1132826688 16:1908761-1908783 CCCATGAGGTTGGACAGGCCACG No data
Right 1132826702 16:1908813-1908835 GTGGTGGGCGTGCTGGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132826688 Original CRISPR CGTGGCCTGTCCAACCTCAT GGG (reversed) Intergenic
No off target data available for this crispr