ID: 1132826694

View in Genome Browser
Species Human (GRCh38)
Location 16:1908779-1908801
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132826694_1132826697 -8 Left 1132826694 16:1908779-1908801 CCACGGCAGGTGGAAGGAGCTGG No data
Right 1132826697 16:1908794-1908816 GGAGCTGGCAGGTGCCAGTGTGG No data
1132826694_1132826699 -4 Left 1132826694 16:1908779-1908801 CCACGGCAGGTGGAAGGAGCTGG No data
Right 1132826699 16:1908798-1908820 CTGGCAGGTGCCAGTGTGGTGGG No data
1132826694_1132826704 27 Left 1132826694 16:1908779-1908801 CCACGGCAGGTGGAAGGAGCTGG No data
Right 1132826704 16:1908829-1908851 AATAAGGAGCGCATGTAGGACGG No data
1132826694_1132826702 11 Left 1132826694 16:1908779-1908801 CCACGGCAGGTGGAAGGAGCTGG No data
Right 1132826702 16:1908813-1908835 GTGGTGGGCGTGCTGGAATAAGG No data
1132826694_1132826700 4 Left 1132826694 16:1908779-1908801 CCACGGCAGGTGGAAGGAGCTGG No data
Right 1132826700 16:1908806-1908828 TGCCAGTGTGGTGGGCGTGCTGG No data
1132826694_1132826705 30 Left 1132826694 16:1908779-1908801 CCACGGCAGGTGGAAGGAGCTGG No data
Right 1132826705 16:1908832-1908854 AAGGAGCGCATGTAGGACGGAGG No data
1132826694_1132826703 23 Left 1132826694 16:1908779-1908801 CCACGGCAGGTGGAAGGAGCTGG No data
Right 1132826703 16:1908825-1908847 CTGGAATAAGGAGCGCATGTAGG No data
1132826694_1132826698 -5 Left 1132826694 16:1908779-1908801 CCACGGCAGGTGGAAGGAGCTGG No data
Right 1132826698 16:1908797-1908819 GCTGGCAGGTGCCAGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132826694 Original CRISPR CCAGCTCCTTCCACCTGCCG TGG (reversed) Intergenic