ID: 1132826696

View in Genome Browser
Species Human (GRCh38)
Location 16:1908783-1908805
Sequence GGCAGGTGGAAGGAGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132826688_1132826696 -1 Left 1132826688 16:1908761-1908783 CCCATGAGGTTGGACAGGCCACG No data
Right 1132826696 16:1908783-1908805 GGCAGGTGGAAGGAGCTGGCAGG No data
1132826689_1132826696 -2 Left 1132826689 16:1908762-1908784 CCATGAGGTTGGACAGGCCACGG No data
Right 1132826696 16:1908783-1908805 GGCAGGTGGAAGGAGCTGGCAGG No data
1132826684_1132826696 27 Left 1132826684 16:1908733-1908755 CCAGACAGAGGGAATAGCACATG No data
Right 1132826696 16:1908783-1908805 GGCAGGTGGAAGGAGCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132826696 Original CRISPR GGCAGGTGGAAGGAGCTGGC AGG Intergenic
No off target data available for this crispr