ID: 1132826697

View in Genome Browser
Species Human (GRCh38)
Location 16:1908794-1908816
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132826688_1132826697 10 Left 1132826688 16:1908761-1908783 CCCATGAGGTTGGACAGGCCACG No data
Right 1132826697 16:1908794-1908816 GGAGCTGGCAGGTGCCAGTGTGG No data
1132826694_1132826697 -8 Left 1132826694 16:1908779-1908801 CCACGGCAGGTGGAAGGAGCTGG No data
Right 1132826697 16:1908794-1908816 GGAGCTGGCAGGTGCCAGTGTGG No data
1132826689_1132826697 9 Left 1132826689 16:1908762-1908784 CCATGAGGTTGGACAGGCCACGG No data
Right 1132826697 16:1908794-1908816 GGAGCTGGCAGGTGCCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132826697 Original CRISPR GGAGCTGGCAGGTGCCAGTG TGG Intergenic
No off target data available for this crispr